Inactive matriptase-2 mutants found in IRIDA patients still repress hepcidin in a transfection assay despite having lost their serine protease activity.

Abstract

Mutations of the TMPRSS6 gene, which encodes Matriptase-2, are responsible for iron-refractory iron-deficiency anemia. Matriptase-2 is a transmembrane protease that downregulates hepcidin expression. We report one frameshift (p.Ala605ProfsX8) and four novel missense mutations (p.Glu114Lys, p.Leu235Pro, p.Tyr418Cys, p.Pro765Ala) found in IRIDA patients. These mutations lead to changes in both the catalytic and noncatalytic domains of Matriptase-2. Analyses of the mutant proteins revealed a reduction of autoactivating cleavage and the loss of N-Boc-Gln-Ala-Arg-p-nitroanilide hydrolysis. This resulted either from a direct modification of the active site or from the lack of the autocatalytic cleavage that transforms the zymogen into an active protease. In a previously described transfection assay measuring the ability of Matriptase-2 to repress the hepcidin gene (HAMP) promoter, all mutants retained some, if not all, of their transcriptional repression activity. This suggests that caution is called for in interpreting the repression assay in assessing the functional relevance of Matriptase-2 substitutions. We propose that Matriptase-2 activity should be measured directly in the cell medium of transfected cells using the chromogenic substrate. This simple test can be used to determine whether a sequence variation leading to an amino acid substitution is functionally relevant or not.

Full text

Page 1

UNCORRECTED ACCEPTED ARTICLE

1
UNCORRECTED ACCEPTED ARTICLE
Research Article
Human Mutation
DOI 10.1002/humu.22116
Supporting Information for this preprint is available from the
Human Mutation editorial office upon request (humu@wiley.com)

Inactive Matriptase-2 Mutants Found in IRIDA Patients Still Repress Hepcidin in a
Transfection Assay Despite Having Lost Their Serine Protease Activity

Flavia Guillem1, Caroline Kannengiesser1,2, Claire Oudin2, Anne Lenoir3,4,5, Pavle Matak3,4,5,
Jean Donadieu6, Bertrand Isidor7, Francoise Méchinaud8, Patricia Aguilar-Martinez9, Carole
Beaumont1, Sophie Vaulont3,4,5, Bernard Grandchamp1,2, Gael Nicolas3,4,5

1INSERM UMR773, Université Paris Diderot, Paris, France.
2APHP, Hôpital Xavier Bichat, Département de Génétique, Paris, France.
3 Inserm, U1016, Institut Cochin, Paris, France.
4 CNRS, UMR 8104, Paris, France.
5 Université Paris Descartes, Sorbonne Paris Cité, Paris, France
6AP-HP, Hôpital Armand Trousseau, Hématologie Oncologie Pédiatrique Paris, France.
7CHU de Nantes, Hôpital Mère et Enfant, Génétique Médicale, Nantes, France
8 Children’s Cancer Center, The Royal Children’s Hospital, Melbourne, Australia.
9CHRU Montpellier, Hôpital St Eloi, Hématologie Biologique, Montpellier, France.

Page 2

UNCORRECTED ACCEPTED ARTICLE

2
Corresponding author: Bernard Grandchamp, APHP, Hôpital Xavier Bichat, Département de
Génétique, 46 rue Henri Huchard, 75018 Paris, France. E-mail :
bernard.grandchamp@bch.aphp.fr

The work was supported by grants ANR 2009 RARE 007 01 and ANR 2010 BLAN 1130 01.


Abstract
Mutations of the TMPRSS6 gene, which encodes Matriptase-2, are responsible for Iron
Refractory Iron-Deficiency Anemia. Matriptase-2 is a transmembrane protease that down-
regulates hepcidin expression. We report one frameshift (p.Ala605ProfsX8) and four novel
missense mutations (p.Glu114Lys, p.Leu235Pro, p.Tyr418Cys, p.Pro765Ala) found in IRIDA
patients. These mutations lead to changes in both the catalytic and non-catalytic domains of
Matriptase-2. Analyses of the mutant proteins revealed a reduction of autoactivating cleavage
and the loss of N-Boc-Gln-Ala-Arg-p-nitroanilide hydrolysis. This resulted either from a direct
modification of the active site or from the lack of the autocatalytic cleavage that transforms the
zymogen into an active protease. In a previously described transfection assay measuring the
ability of Matriptase-2 to repress the hepcidin gene (HAMP) promoter, all mutants retained
some, if not all, of their transcriptional repression activity. This suggests that caution is called for
in interpreting the repression assay in assessing the functional relevance of Matriptase-2
substitutions. We propose that Matriptase-2 activity should be measured directly in the cell
medium of transfected cells using the chromogenic substrate. This simple test can be used to

Page 3

UNCORRECTED ACCEPTED ARTICLE

3
determine whether a sequence variation leading to an amino acid substitution is functionally
relevant or not.

Key words: TMPRSS6, Matriptase-2, hepcidin, anemia, IRIDA


Introduction
Patients with Iron Refractory Iron Deficiency Anemia (IRIDA; MIM# 206200) absorb
insufficient amounts of iron from the diet and respond inadequately to oral iron therapy. IRIDA
is characterized by low serum iron, low serum ferritin, and high plasma levels of hepcidin, the
master regulator of systemic iron homeostasis. This disease is caused by biallelic mutations of
the TMPRSS6 gene (MIM# 609862) that encodes Matriptase-2 (MT2), a transmembrane serine
protease of the type-two transmembrane serine protease (TTSP) family, which is mainly
expressed in the liver. The role of MT2 in iron homeostasis was initially demonstrated by the
discovery of a homozygous splice site mutation of Tmprss6 in the Mask mouse (Du, et al., 2008)
followed by the characterization of the Tmprss6 knockout mice (Folgueras et al., 2008). These
mice suffer from microcytic anemia due to reduced absorption of dietary iron caused by high
levels of hepcidin. Hepcidin gene (HAMP) expression is mainly dependent upon Bone
Morphogenetic Protein 6 (BMP6) and hemojuvelin (HJV). Binding of the BMP6 cytokine to its
receptors activates a signaling cascade leading to HAMP transcription via phosphorylation of
Son of Mother Against Decapentaplegic (SMAD) 1/5/8 effectors. HJV, a GPI-linked membrane
protein synthesized by the hepatocytes, is a BMP6 coreceptor (Babitt, et al., 2006; Xia, et al.,
2008). The critical role of the BMP6/HJV/SMAD pathway in iron homeostasis is supported by

Page 4

UNCORRECTED ACCEPTED ARTICLE
that needs its own trypsin-like serine protease activity to become activated. Autoactivation of the

4
the loss of hepcidin expression and massive parenchymal iron overload observed in several
mouse models, including mice in which BMP type I receptor genes (Alk2, Alk3) have been
deleted in the liver (Steinbicker, et al., 2011), Bmp6-/- (Meynard, et al., 2009, Andriopoulos, et
al., 2009) and Hjv-/- mice (Vaulont, et al., 2005) as well as in mice with targeted liver deletion of
Smad4 (Wang, et al., 2005). Similar severe iron overload (juvenile hemochromatosis) is
observed in patients with mutations in HFE2, which encodes for the HJV protein. On the basis of
transfection experiments, it has been postulated that MT2 down-regulates hepcidin levels by
binding to and proteolytically degrading the BMP co-receptor HJV (Silvestri, et al., 2008).
However, recent experiments performed in vivo do not support this hypothesis. Indeed, Gibert et
al showed that the increase in hepcidin expression that follows the knockdown of the Tmprss6
gene in a zebrafish embryo is independent of HJV (Gibert, et al., 2011). Furthermore, Krijt et al
showed that in Tmprss6-/- mice, the amount of membrane-bound HJV (mHJV) protein in liver
was significantly reduced, and not increased as expected (Krijt, et al., 2011).
From its N- to its C-terminus, MT2 is composed of a small cytoplasmic domain, a
transmembrane domain, a stem region consisting of a SEA (sea urchin Sperm protein
Enterokinase Agrin) domain, two CUB (C1s/C1r, Urchin embryonic growth factor and Bone
morphogenetic protein) domains, three LDLRA (low-density lipoprotein receptor class A)
domains, and a carboxy terminal serine protease (SP) domain (see Figure 1A). Three residues in
the SP domain, Histidine 617, Aspartate 668 and Serine 762 (the catalytic triad) are essential for
protease activity (Szabo and Bugge, 2011). Like other TTSPs, MT2 is synthesized as a zymogen
zymogen is characterized by a cleavage after the Arginine 576 within a highly-conserved Arg-
Ile-Val-Gly-Gly (RIVGG) motif located at the junction between the SP domain and the stem

Page 5

UNCORRECTED ACCEPTED ARTICLE

5
(Figure 1A). It has been shown that MT2 is activated via a transactivation mechanism involving
multimerization of the zymogen (Stirnberg, et al., 2010) at the plasma membrane. Following
activation, the SP domain remains bound to the stem by a disulfide bound. The active protease is
released from the cell membrane into the extracellular medium by proteolytic cleavage within
the stem (Stirnberg, et al., 2010). So far, 34 MT2 mutations have been identified in human
patients with IRIDA (Altamura, et al., 2010; Beutler, et al., 2009; Choi, et al., 2011; De Falco, et
al., 2010; Edison, et al., 2009; Finberg, et al., 2008; Guillem, et al., 2008; Melis, et al., 2008;
Ramsay, et al., 2009b; Sato, et al., 2011; Silvestri, et al., 2009; Tchou, et al., 2009). These
include missense, nonsense, frameshift, and splice junction mutations. Missense mutations have
been found in several different protein domains of the extracellular part of the zymogen, and
some of them have been further characterized by transfection experiments, usually by assessing
the ability of mutated proteins to repress the hepcidin promoter linked to a luciferase reporter
gene (Altamura, et al., 2010; De Falco, et al., 2010; Du, et al., 2008; Ramsay, et al., 2009b;
Silvestri, et al., 2009; Silvestri, et al., 2008). Here we describe five mutations observed in IRIDA
patients, one homozygous frameshift mutation, found in one family, and four missense mutations
located in the CUB1, CUB2, SEA, and SP domains of MT2, found in two families with
compound heterozygosity of the affected children. We studied the functional consequences of
the mutations on the activation of the zymogen, the release of the protease activity into the
medium of transfected cells and the repression of the hepcidin promoter. We also studied two
designed mutant controls: p.Arg576Ala (R576A) and p.Ser762Ala (S762A). The (R576A)
mutant was designed to prevent the autoactivation of MT2 by replacing the arginine that is
targeted by the autocatalytic activating cleavage. The S762A mutant is a catalytically inactive

Page 6

UNCORRECTED ACCEPTED ARTICLE

6
protein in which the serine residue directly involved in the proteolytic activity of the enzyme has
been replaced by an alanine (Stirnberg, et al., 2010).

Page 7

UNCORRECTED ACCEPTED ARTICLE
iron supplementation was discontinued.

7
Materials and Methods
Patients (see Table 1 and Figure 2)
Family A: Two affected brothers were born to healthy, first-cousin parents from Algeria. The
eldest brother received several courses of oral iron during his childhood. No hematological data
were available from before he was diagnosed with microcytic anemia when he was 15 years old.
At the time of diagnosis he had 7.3 g/dL hemoglobin, and a MCV of 54 fL. Since then, he had
received several courses of intravenous iron, and when 25 years of age he had a normal
hemoglobin level (12 g/dL), although the microcytosis persisted. His serum ferritin had risen
from 6 μg/L (when 15 years of age) to 230 μg/L (when 25 years of age). His younger brother
was noted by his parents to display pallor at birth. He was diagnosed with microcytic anemia
when he was 1 year old (Hb: 7.4 g/dL and MCV: 51 fL). Intravenous (IV) iron was administered
from the age of 8 years, and he responded well, with 12 g/dL of hemoglobin and an MCV of 64
fL at the age of 17 years.
Family B: Two affected brothers were born to non-consanguineous parents of French origin.
Both patients presented with microcytic hypochromic anemia at 4 years and 6 months of age,
respectively. Occult gastrointestinal blood loss and gluten enteropathy were excluded.
Hematological and bone marrow examinations ruled out other possible causes of anemia. With
oral iron treatment, both patients reached an acceptable hemoglobin level (11 g/dL), but
remained microcytic with low serum iron, normal total iron binding capacity (TIBC), and very
low transferrin saturation. Both of them displayed a decrease in hemoglobin concentration when
Family C: The patient was a French boy born to non-consanguineous parents. He was diagnosed
with hypochromic microcytic anemia when he was 3 years old, and was given oral iron

Page 8

UNCORRECTED ACCEPTED ARTICLE

8
continuously for 17 months. His hemoglobin concentration progressively rose to 12 g/dL, but
then fell back to 10.5 g/dL when the treatment was discontinued. A year and a half later he was
given a single dose of intravenous iron. This was followed by an increase in hemoglobin
concentration that persisted for 2 years. He was then given oral iron supplementation again.
Serum hepcidin concentrations were measured by ELISA (Intrinsic Life Sciences, USA) and are
shown in Table 1.
Blood samples for genetic analysis were obtained from the patients or their parents after they had
signed informed consent forms in accordance with the requirements of the French Bioethics
legislation.

TMPRSS6 sequencing and DNA constructs
Exons and intron-exon junctions of the TMPRSS6 gene were sequenced as previously described
(Guillem, et al., 2008) and compared to the reference sequence NM_153609.2 (GenBank).
Mutant alleles are named according to journal guidelines (www.hgvs.org) and have been
submitted to the Leiden Open Variation Database (http://www.lovd.nl/TMPRSS6). The full-
length human MT2 cDNA with a C-terminal FLAG epitope cloned in the pcDNA3.1 vector was
kindly provided by Carlos Lopez Otin. Expressing vectors encoding MT2 mutants found in
IRIDA patients: p.Glu114Lys (E114K), p.Leu235Pro (L235P), p.Tyr418Cys (Y418C),
p.Pro765Ala (P765A), p.Ala605Pro+8fsX (A605fs), and designed mutants Arg576Ala (R576A)
and Ser762Ala (S762A), were obtained by mutagenesis of wild-type cDNA using a Quickchange
site-directed mutagenesis kit (Stratagene), sequences of the oligonucleotides are available upon
request. To generate MT2-V5 expressing vectors, pcDNA wild type (WT) MT2-FLAG was
digested using BsteII and XhoI enzymes, and the digested plasmid was purified on agarose gel

Page 9

UNCORRECTED ACCEPTED ARTICLE

9
and dephosphorylated. An insert containing a V5 tag was made by hybridizing two
oligonucleotides phosphorylated at their 5’ extremity (sequences are available upon request), and
ligation into the previously digested plasmid. In order to introduce the FLAG sequence in front
of the stop codon of the A605fs mutant, we used four primers for Site Directed, Ligase-
Independent Mutagenesis (SLIM) according to Chiu et al. protocol (Chiu, et al., 2004): PCR was
performed with the four primers Rt 5’cccagcggtcagcgatgagggccccccacagatgtgtcg3’, Rs
5’gggccccccacagatgtgtcg3’, Fs 5’gactacaaggacgacgatgac3’, Ft
5’tcatcgctgaccgctggggactacaaggacgacgatgac3’ with pcDNA3 WT MT2 as a DNA template. To
generate the pcDNA WT HJV construct, the full human ORF was amplified from human liver
cDNA and inserted into pcDNA3 using TOPO cloning (Invitrogen). The whole cDNA sequence
of each construct was verified by sequencing after mutagenesis.


Cell culture
HeLa and Huh7 cells were cultured at 37°C in Dulbecco’s modified Eagle’s Medium (DMEM)
with L-glutamine and 1 g/L glucose, supplemented with antibiotics (penicillin, streptomycin),
and 10% heat decomplemented fetal bovine serum, in 95% humidified air and 5% CO2.

Western blots on cell lysates and concentrated media
HeLa and Huh7 cells seeded in 10-cm diameter dishes and grown up to 50-70% confluence were
transiently transfected with Fugene HD reagent (Roche) in optiMEM according to the
Manufacturer’s instructions. After 24 h, the medium was replaced with 4.5 mL of fresh
optiMEM with antibiotics. The medium was collected 24h later, and concentrated using 10-kDa

Page 10

UNCORRECTED ACCEPTED ARTICLE

10
molecular weight cutoff ultrafiltration membranes (Amicon ultra, Millipore). Cells were lysed in
lysis buffer (Cell Signaling Technology) supplemented with an antiprotease cocktail (Roche).
Forty μg of proteins in denaturing and reducing Laemmli buffer were loaded per well of 10% or
12% polyacrylamide gel for cell lysates (CL) and concentrated media (CM), respectively.
Proteins were transferred onto an Immobilon-P transfer membrane (Millipore), using an
Invitrogen electrophoresis system. After blotting, membranes were blocked overnight at 4°C in
7% milk diluted in TBS-Tween (0.15%). Membranes were incubated with a mouse anti-FLAG
M2 monoclonal antibody (Sigma) diluted 1/10000 (CL) or 1/5000 (CM), and then with a sheep
secondary anti-mouse antibody diluted 1/3000 (Amersham Bioscience). Anti-actin primary
antibody (Sigma) and anti-mouse secondary antibody (Amersham Bioscience) were used at
1/7500 dilution. All the antibodies were incubated for one hour (with the exception of actin:
30 min) at room temperature. Immunoblots were visualized by chemiluminescence using the
HRP (horseradish peroxidase) substrate (Millipore).

Immunofluorescence
Huh7 cells grown to 50-70% confluence on a glass coverslip 1.8 cm in diameter were transiently
transfected with pcDNA WT MT2 or with constructs expressing the missense mutants. The
transfection medium was replaced after 24h with fresh optiMEM, and immunofluorescence
labeling was performed 24h later. The dilution of primary rabbit polyclonal anti-FLAG antibody
(Sigma) was 1/250, and the dilution of the anti-rabbit secondary antibody labeled with FITC
(Invitrogen) was 1/200.

Luciferase assay

Page 11

UNCORRECTED ACCEPTED ARTICLE

11
Huh7 cells seeded at 50-70% confluence in a 24-well plate were transiently transfected with TK
Renilla plasmid encoding Renilla reniformis luciferase, and with a construction containing the
Photinus pyralis luciferase gene controlled by the HAMP gene promoter (Patel, et al., 2012).
Cells were also co-transfected with the pcDNA HJV-expressing vector and WT or mutated MT2
expressing plasmid, in optiMEM. After 48h, the cells were lysed with passive lysis buffer
(Promega), and the luciferase activity was determined according to the Manufacturer’s
instructions (Dual glo luciferase reporter assay, Promega). The relative luciferase activity was
determined as the ratio of the HAMP promoter Photinus pyralis firefly to Renilla reniformis
luciferase activity. Experiments were performed in triplicate.

Measurement of MT2 proteolytic activity
Hela cells were transfected with either WT or mutant MT2-expressing constructs as described
above. After 24 hours, 50μg of proteins from concentrated media were used to measure the
protease activity by monitoring the release of p-nitroanilide from the chromogenic substrate N-
(tert-butoxycarbonyl)-Gln-Ala-Arg-p-nitroanilide (400 μM) at a wavelength of 405 nm during an
incubation of 20 minutes in Tris/Saline buffer (50 mM Tris, 150 mM NaCl, pH8.0) at 37°C.

Co-Immunoprecipitation assay
Cell lysates obtained as described for the Western blots were incubated with 2 μg of anti-V5
monoclonal antibodies (Invitrogen) or anti-FLAG monoclonal antibodies for one hour at 4°C.
BioAdem beads PAG (protein A and G) diluted in lysis buffer were added to the immune
complexes and incubated overnight at 4°C while stirring. After washing three times with lysis

Page 12

UNCORRECTED ACCEPTED ARTICLE

12
buffer, proteins bound to antibodies were eluted with PAG elution buffer. This experiment was
performed using Ademtech magnetic devices.

Results
We describe five patients with IRIDA belonging to three families (Table 1 and Figure 2). Two
brothers in family A were diagnosed with typical features of IRIDA: microcytic anemia with low
serum iron, high concentration of plasma hepcidin, no response to oral iron and only a partial
response to intravenous iron therapy. In contrast, in the other two families, the patients (two
brothers in family B and a single affected child in family C), had an unusual clinical history since
they had responded partially to sustained oral iron therapy. Otherwise, they also showed typical
symptoms of IRIDA with persisting microcytosis under therapy. Their plasma hepcidin level was
in the normal range though abnormally high when their hemoglobin concentration was taken into
account (Ganz, et al., 2008). However, it should be noted that patients from both these families
would have been considered to be unresponsive to oral iron according to the usual criteria, since
only long-lasting and sustained oral iron therapy was able to maintain even a subnormal
hemoglobin concentration, and the hemoglobin level fell when oral iron was discontinued.
We identified four novel and one previously described mutations of the TMPRSS6 gene in the
three families (Figure 2). In family A, a previously reported mutation (Finberg, et al., 2008) was
found in the homozygous state in the two brothers born to consanguineous parents, and consisted
of a single nucleotide deletion: c.1813delG; p.Ala605ProfsX8 (A605fs). This mutation was
predicted to lead either to RNA degradation or to a truncated protein. In family B, the affected
brothers were heterozygous for two missense mutations, c.704T>C; p.Leu235Pro (L235P) in the
CUB domain 1 and c.1253A>G; p.Tyr418Cys (Y418C) in the CUB domain 2. The father and the

Page 13

UNCORRECTED ACCEPTED ARTICLE

13
mother were heterozygous for the L235P mutation and the Y418C mutation, respectively. In
family C, the proband was heterozygous for two other missense mutations: c.340G>A;
p.Glu114Lys (E114K) in the SEA domain and c.2293C>G; p.Pro765Ala (P765A) in the SP
domain. The father and the mother were heterozygous for the P765A mutation and the E114K
mutation, respectively. The location of the mutations in the different protein domains is shown
on Figure 1A. All four amino acid substitutions affect evolutionarily conserved residues (Figure
1B) and were predicted to be damaging by Polyphen2 software
(http://genetics.bwh.harvard.edu/cgi-bin/pph2).

MT2 missense mutant proteins are targeted to the plasma membrane
In order to find out whether the missense mutations found in IRIDA patients modify the
localization of the protein at the cell membrane, Huh7 cells were transiently transfected with the
cDNA encoding the WT MT2 and each of the four missense IRIDA mutants with a FLAG-
epitope. In non-permeabilized cells, the MT2 mutants were detected at the membrane of Huh7
cells, in a similar way to the WT protein (Supp. Figure S1).

Repression of HJV-induced HAMP promoter activity by MT2 mutants
To assess the impact of MT2 mutations on hepcidin gene activity, we transfected Huh7 cells with
a HAMP promoter-Photinus luciferase reporter vector and a TK-Renilla luciferase vector to
normalize transfection efficiency between samples. Cells were also co-transfected with the HJV-
expressing vector, and either WT or mutant MT2-expressing vectors. We tested the five IRIDA
mutants plus two designed mutants as controls: R576A and S762A. WT MT2 repressed HJV-
induced luciferase activity 8 fold compared to HJV transfection alone (Figure 3). Surprisingly,

Page 14

UNCORRECTED ACCEPTED ARTICLE

14
all the mutants repressed HAMP promoter-driven luciferase expression, and only some of them
(Y418C, L235P, E114K and R576A) were significantly, although moderately, less efficient than
WT MT2. The A605fs mutant displayed only weak repressor activity. We performed this
experiment three times, and Figure 3 shows the results of one representative experiment.
Repression of the hepcidin promoter was also demonstrated under conditions where HuH7 cells
were transfected with MT2-expressing vectors in the absence of the HJV-expressing vector both
under unstimulated conditions and in the presence of added BMP2 (Supp. Figure S2). This
suggests that both the wild-type MT2 and the missense mutants are able to interfere with
endogenous HJV when overexpressed in HuH7 cells.

Autocleavage of MT2 mutants
In order to determine the autocatalytic cleavage activity of MT2 mutants, HeLa cells were
transfected with plasmid constructs expressing either WT MT2 or each of the MT2 mutants, or
combinations of Y418C/L235P and E114K/P765A mutants. The corresponding proteins were
detected in cell lysates (CL) with an apparent molecular weight of 120 kDA for both WT MT2
and the missense mutants, corresponding to full length zymogens (Figure 4A, CL). As expected,
the truncated mutant that lacks 198 amino acid residues was detected with an apparent molecular
weight of 90 kDa (Figure 4A, CL). When the concentrated medium (CM) of HeLa cells
transfected with WT MT2-FLAG cDNA was analyzed using sodium dodecyl sulfate (SDS)
PolyAcrylamide Gel Electrophoresis (PAGE) under reducing conditions, the hallmark of the
autoactivating cleavage of the zymogen was present, i.e. a 30-kDa fragment corresponding to the
SP domain (Figure 4A, CM). As expected, the R576A mutant could not be processed at the
RIVGG site, and the corresponding 30-kDa fragment was not detected in the cell medium. The

Page 15

UNCORRECTED ACCEPTED ARTICLE

15
S762A mutant was not cleaved either, confirming that the catalytic activity of the MT2 zymogen
itself is necessary for its activating cleavage to occur. Similarly, no 30-kDa fragment was
observed for the Y418C, L235P, and E114K mutants, either alone or in combination while
transfection of the P765A mutant resulted in a reduction of the intensity of the 30-kDa fragment
compared to that found for WT MT2. For the A605fs mutant, which is completely devoid of the
SP domain, no cleavage fragment was detected.
In transfected Huh7 cells, no residual autocleavage was observed with any of the mutants studied
(Figure 4B, CM).

MT2 missense mutants are not trans-activated by wild-type protein
Stirnberg, et al. demonstrated that a MT2 protein mutated in the catalytic serine S762A can be
modified by trans-cleavage at the RIVGG site by its WT counterpart (Stirnberg, et al., 2010). We
investigated whether the missense IRIDA variants could be processed in the same way. Huh7
cells were co-transfected with a plasmid expressing either one of the FLAG-labeled mutants and
the WT MT2 expressing construct with a V5 epitope. Full length MT2-V5 and the autoactivation
fragment were detected with the anti-V5 antibody in the cell lysate and cell medium, respectively
(Figure 5, CL and CM). When the S762A MT2-FLAG mutant was co-transfected with WT
MT2-V5, a 30-kDa fragment was also detected with the anti-FLAG antibody by Western blot
analysis under reducing conditions, in agreement with data previously reported (Stirnberg, et al.,
2010). In contrast, none of the four IRIDA mutants was cleaved by WT MT2. This may indicate
a conformational defect that either prevents the formation of MT2 oligomers or modifies the
accessibility of the RIVGG cleavage site.