Polymorphism of rotavirus genotype G1 in Brazil: in silico analysis of variant strains circulating in Rio de Janeiro from 1996 to 2004.

Abstract

The polymorphism of species A rotavirus genotype G1 strains (RVA-G1) circulating in Rio de Janeiro between 1996 and 2004 was evaluated. The VP7 encoding gene of 36 G1 isolates was sequenced and compared to references strains. The deduced amino acid sequences were used as basis for in silico analysis of the VP7 protein. We observed the circulation of two major G1 lineages and five sublineages during the studied period. Comparison between the VP7 trimeric structures of a rotavirus vaccine strain and Brazilian G1 strains showed mutations at amino acid residues located at the calcium binding site and at several neutralizing antibody recognition sites. Although the rotavirus vaccine program has clearly been successful in Brazil, these results suggest the possibility of the emergence of G1 strains that could evade the immune response elicited by a RVA vaccine and cause a vaccine breakthrough. Consequently, continuous monitoring of rotavirus intragenotypes diversity is critical to understand how it could affect vaccine effectiveness.

Full text

Page 1

(This is a sample cover image for this issue. The actual cover is not yet available at this time.)
This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright

Page 2

Author's personal copy
Polymorphism of rotavirus genotype G1 in Brazil: In silico analysis of variant
strains circulating in Rio de Janeiro from 1996 to 2004
Adriana Gonçalves Maranhãoa, João Lídio S.G. Vianez-Júniorb, Fabrício José Benatia, Paulo Mascarello
Bischb, Norma Santosa,⇑
aDepartamento de Virologia, Instituto de Microbiologia Paulo de Góes, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
bInstituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
a r t i c l e i n f o
Article history:
Received 24 October 2011
Received in revised form 20 April 2012
Accepted 21 April 2012
Available online 3 May 2012
Keywords:
Rotavirus
Polymorphism
Genotyping
Vaccine
a b s t r a c t
The polymorphism of species A rotavirus genotype G1 strains (RVA-G1) circulating in Rio de Janeiro
between 1996 and 2004 was evaluated. The VP7 encoding gene of 36 G1 isolates was sequenced and
compared to references strains. The deduced amino acid sequences were used as basis for in silico analysis
of the VP7 protein. We observed the circulation of two major G1 lineages and five sublineages during the
studied period. Comparison between the VP7 trimeric structures of a rotavirus vaccine strain and Brazil-
ian G1 strains showed mutations at amino acid residues located at the calcium binding site and at several
neutralizing antibody recognition sites. Although the rotavirus vaccine program has clearly been success-
ful in Brazil, these results suggest the possibility of the emergence of G1 strains that could evade the
immune response elicited by a RVA vaccine and cause a vaccine breakthrough. Consequently, continuous
monitoring of rotavirus intragenotypes diversity is critical to understand how it could affect vaccine
effectiveness.
? 2012 Elsevier B.V. All rights reserved.
1. Introduction
Rotaviruses (RVs) are members of the Reoviridae family, and
classified into seven species (A–G) commonly referred to as ‘‘RVs
groups’’ (Matthijnssens et al., 2011). Rotaviruses species A (RVA)
are the main etiologic agents of acute gastroenteritis and responsi-
ble for nearly 400,000 deaths worldwide (Parashar et al., 2006).
The viral genome consists of 11 segments of double-stranded
(ds) RNA encoding six structural proteins (VP) and five or six
(dependingon the strain)
(Matthijnssens et al., 2011). The genome is enclosed within a
three-layered particle. The inner layer consists of VP2, which en-
closes the genome, and the two minor structural proteins VP1
and VP3, thus forming the core. The middle layer, which consists
of VP6, surrounds the core, forming a doubly layered particle
(DLP). The outer layer, consisting of VP7 and spike-like projections
of VP4, encloses the DLP and completes the three-layered particle
(TLP) or infectious virion (Estes and Kapikian, 2007).
The outer capsid proteins VP7 and VP4 carry independent neu-
tralization and protective antigens and antibodies to either protein
can confer resistance to virulent rotavirus in a type-specific man-
non-structural proteins(NSP)
ner in experimental animals (Estes and Kapikian, 2007). A binary
system is used to classify RVA into P and G genotypes based on
the specificity of the VP4 and VP7-encoding genes, respectively
(Estes and Kapikian, 2007). Thus far, 35 P genotypes and, 27 G
genotypes have been identified (Matthijnssens et al., 2011).
The mechanisms driving rotavirus diversification include inter-
segmental recombination, rearrangement,
(Gouvea and Brantly, 1995; Desselberger, 1996; Suzuki et al.,
1998; Iturriza-Gómara et al., 2001; Estes and Kapikian, 2007). Ge-
netic and antigenic diversity of viruses are generally driven by
immunologic selection. Point mutations are often described for
RVA and these mutations eventually can lead to the emergence
of virus strains that can escape neutralization by specific antibod-
ies (Dyall-Smith et al., 1986; Ciarlet et al., 1997). Crystal structure
of VP7 showed that it is a trimer stabilized by two Ca2+ions bound
at each subunit interface of the trimer (Dormitzer et al., 2000; Aoki
et al., 2009). Uncoating of VP7, probably by withdrawal of Ca2+dis-
sociates the VP7 trimer and initiates penetration-inducing confor-
mational changes in the VP4 protein (Aoki et al., 2009).
Neutralizing antibodies against VP7 can stabilize the trimer inhib-
iting the uncoating trigger for VP4 rearrangement (Aoki et al.,
2009). The VP7 gene encodes 326 amino acids and carries nine var-
iable regions (VR1-VR9) highly divergent across the G genotypes.
Four of these regions A (aa 87–101), B (aa 141–151), C (aa 208–
224) and F (aa 235–242) have been shown to be of antigenic
importance (Dyall-Smith et al., 1986; Ciarlet et al., 1997). Antigenic
regions A and C are mainly involved in virus neutralization, and
and reassortment
1567-1348/$ - see front matter ? 2012 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.meegid.2012.04.018
⇑Corresponding author. Address: Departamento de Virologia, Instituto de
Microbiologia, Universidade Federal do Rio de Janeiro, Cidade Universitária, CCS –
Bl. I, Ilha do Fundão, Rio de Janeiro – RJ, 21.941-590, Brazil. Tel.: +55
2125608344x165; fax: +55 21 2560-8028.
E-mail address: nsantos@micro.ufrj.br (N. Santos).
Infection, Genetics and Evolution 12 (2012) 1397–1404
Contents lists available at SciVerse ScienceDirect
Infection, Genetics and Evolution
journal homepage: www.elsevier.com/locate/meegid

Page 3

Author's personal copy
together form a conformational antigenic site, in which different
epitopes correlate functionally with each other (Kobayashi et al.,
1991). Structural reconstruction of VP7 have shown that mutation
in this protein permit escape from neutralization by various mono-
clonal antibodies mapped to two regions named 7-1, which is
immunodominant and includes several epitopes into the confor-
mational antigenic site formed by the antigenic regions A and C
and, region 7-2 that includes mostly epitopes located in the anti-
genic region B (Aoki et al., 2009). Moreover, molecular analysis
has demonstrated the existence of at least nine different lineages
and thirteen sublineages of human RVA-G1 strains that either
alternate or co-circulate in the population (Parra et al., 2005; Arista
et al., 2006; Phan et al., 2007; Arora et al., 2009).
Two RVA vaccines have recently been introduced in several
countries. Rotateq?(Merck and Co., Witehouse Sation, NJ, USA) is
an oral pentavalent rotavirus vaccine consisting of 5 human-bo-
vine reassortants carrying the VP7 genes of human G1, G2, G3
and G4 and VP4 gene of human P[8]. Rotarix?(GlaxoSmithKline,
Genval, Belgium) is a monovalent vaccine composed of an attenu-
ated human rotavirus strain G1P[8]. Both vaccines contains G1
strains that were isolated in the 80s’; strain 82-12 isolate in
1988 (Ward and Bernstein, 2009) is the parental strain of Rotarix?
vaccine [Rotarix?, RVA/Vaccine/USA/Rotarix-A41CB052A/1988/
G1P1A[8]) and strain WI79 isolate in 1983 was used to generate
the WI79-9 reassortant contained in the Rotateq?vaccine in
1992(Rotateq?, RVA/Vaccine/USA/RotaTeq-WI79-9/1992/G1P7
[5]) (Matthijnssens et al., 2010). A RVA vaccine candidate, the
HRV-BRV vaccine, is an oral pentavalent vaccine containing five
human-bovine reassortant carrying the VP7 genes of human G1–
G4 and G9. The serotype 1 strain (D strain) isolated in 1974 (Wyatt
et al., 1983) was used to generate the DxUK reassortant in this vac-
cine in 1984 (RVA/Vaccine/USA/HRV-BRV-DxUK/1984/G1P7[5])
(Midthun et al., 1985; Kapikian et al., 2005).
Antigenic and genomic variations have been demonstrated for
both neutralizing antigens (VP4 and VP7) of RVA, particularly
among the six most common genotypes G1-G4, G9 and P[8] which
are the main targets for vaccine development (Santos and Hoshino,
2005). The effects of such variations on the efficacy of these vac-
cines are yet to be determined. However, based on serological
(Green and Kapikian, 1992; O’Ryan et al., 1994; Jin et al., 1996)
and molecular studies (Parra et al., 2005; Arista et al., 2006; Rodrí-
guez-Castillo et al., 2006; Phan et al., 2007; Arora et al., 2009; Arora
et al., 2011) it is reasonable to speculate that these variations could
be responsible for vaccine breakthrough, forcing a reassessment of
the strategies for vaccine production.
In 2006, the Brazilian Ministry of Health introduced the mono-
valent G1P[8] (Rotarix?) vaccine in its national immunization pro-
gram. Therefore, it is vital to monitor the emergence of G1 variants
strains that could escape the vaccine-induced immunity in the
country. Herein, we describe the genetic evolution of RVA-G1
strains detected in Brazil during a nine years period and discus
its possible implication on the efficacy of a RVA vaccine program.
2. Materials and methods
2.1. Ethics
The Ethics Committees of the Hospital Universitário Clementino
Fraga Filho, and the Instituto de Puericultura e Pediatria Martagão
Gesteira of the Federal University of Rio de Janeiro, Rio de Janeiro,
Brazil, approved the study protocol.
2.2. Stool specimens
A total of 91 stool specimens collected between January 1996
and December 2004 from Brazilian children <5 years old with
acute diarrhea that had been shown to be positive for rotavirus
G1P[8] (Benati et al., 2010) were included in this study. The human
strain RVA/Human-tc/USA/Wa/1974/G1P1A[8] was used as proto-
type for RVA G1P[8] in all experiments.
2.3. RNA extraction and RT-PCR amplification
The viral dsRNA was extracted from stools using the Totally
RNA Kit (Applied Biosystems/Ambion, Austin, TX) according to
the manufacturer’s recommendations, and subjected to reverse
transcription followed by PCR using the Beg9-End9 primers
(Gouvea et al., 1990).
2.4. Sequencing and phylogenetic analysis
The amplified cDNAs of 36 G1 strains purified using the Wizard
SV Gel and PCR Clean Up System (Promega, Madison, WI), and the
sequences were determined with the BigDye terminator cycle
sequencing kit and the ABI PRISM 3100 automated DNA sequencer
(Applied Biosystems, Foster City, CA). The primers used for
sequencing were Beg9, End9 (Gouvea et al., 1990), and VP71F – T
GTATTATCCAACTGAAGC, VP74F – TTATCCAACAATCGGGAGAA, VP
75F – GAATTTCCGTCTGGCTAAC, VP70R – TGGATAATACAAACA-
TAAT, and VP72R – TATTCCTAACGTTTGTGTAT selected in this
study. The DNA sequences were assembled and analyzed with
the programs SeqMan, EditSeq, and MegAlign in the Lasegene soft-
ware package (DNASTAR, Madison, WI). The phylogenetic analysis
was carried out with MEGA software, version 5.0 (Kumar et al.,
2004). Distances were corrected using the Jukes-Cantor model
and the phylogenetic tree was constructed using the neighbor-
joining method. The statistical significance was estimated by boot-
strap analysis with 1,000 pseudoreplicates. The sequences were
compared to that of G1 rotavirus strains obtained from the Gen-
Bank (RVA/Vaccine/USA/Rotarix – A41CB052A/1988/G1P1A[8] –
JN849114; RVA/Human-tc/USA/Wa/1974/G1P1A[8] – M21843;
RVA/Vaccine/USA/RotaTeq-WI79-9/1992/G1P7[5]
RVA/Vaccine/USA/HRV-BRV-DxUK/1984/G1P7[5]
RVA/Human-tc/USA/D/1974/G1P1A[8] – EF672574; RVA/Human/
IT/PA78/89/1989/G1P[8] – DQ377572; RVA/Human/KP/Kor-64/
1988/G1P[8]– U26378;RVA/Human/JP/Au19/1997/G1P[6]
AB018697; RVA/Human/JP/417/1991/G1P[8] – D16328; RVA/Hu-
man/UY/Mvd9816/1998/G1–
Mvd9814/1998/G1 – AF480291; RVA/Human/UY/Mvd9606/1996/
G1 – AF480263; RVA/Human/BR/IALR23/1996/G1 – HM998612;
RVA/Human/BR/IALR16/1996/G1 – HM998611; RVA/Human/BR/
Brz-3/1991/G1– U26363; RVA/Human/BR/Brz-5/1992/G1
U26367; RVA/Human/BR/rj31022-86/1986/Brazil – DQ857952;
RVA/Human/BR/rj5321-02/2002/Brazil
man/BR/rj7363-03/2003/Brazil–
rj8200-04/2004/Brazil – DQ857951; RVA/Human/PY/Py02SR11/
2002-05/G1P1A[8]– EF179186;
2002-05/G1P1A[8] – EF179190; RVA/Human/UY/Mvd9608/1996/
G1 – AF480264; RVA/Human/JP/7014/JP/2005-06/G1 – EF079064;
RVA/Human/JP/7206/JP/2005-06/G1 – EF079065; RVA/Human/IT/
PA164/99/1999/G1 – DQ377588; RVA/Human/IT/PA430/00/2000/
G1 – DQ377591; RVA/Human/USA/2008747322/2008/G3P[8] –
HM773741). Genome sequences of rotavirus strains obtained in
this study were deposited into GenBank (accession numbers
JN232039–JN232074).
–
–
GU565057;
GQ225777;
–
AF480293; RVA/Human/UY/
–
–DQ857946; RVA/Hu-
DQ857950; RVA/Human/BR/
RVA/Human/PY/Py03SR286/
2.5. Prediction of 3D structure of VP7 protein and comparative analysis
A similarity search was carried out in the Protein Data Bank
(PDB) (http://www.ncbi.nlm.nih.gov/protein) using BLASTP (Altschul
et al., 1990) to find suitable templates. The structure of the VP7
protein from a simian rotavirus complexed with an antibody was
1398
A.G. Maranhão et al./Infection, Genetics and Evolution 12 (2012) 1397–1404

Page 4

Author's personal copy
downloaded from PDB database by entering PDB ID code 3FMG
(Aoki et al., 2009), and used as template for comparative modeling.
The 3D structures of VP7 were modeled individually using the win-
dows version of MODELLER 9v8 (Eswar et al., 2006) which can be
accessed freely from their website http://salilab.org/modeller.
The modeled structures were subjected to analysis by Ramachan-
dran plots generated by PROCHECK freely accessed at http://
www.ebi.ac.uk/thornton-srv/software/PROCHECK and, further val-
idation was employed using ProSA (Wiederstein and Sippl, 2007)
accessible at http://prosa.services.came.sbg.ac.at. The root mean
square deviation (RMSD) of the backbone atoms (Carbon) was cal-
culated using the program PyMOL which was also used for molec-
ular structure visualization (http://pymol.org/).
3. Results
3.1. Sequencing and phylogenetic analysis
The complete VP7 coding sequence of 36 G1 strains was deter-
mined. Phylogenetic analysis of the nucleotide sequences showed
that the Brazilian G1 strains clustered into two G1 lineages (G1-I
and G1-II) and five sublineages (Ia, Ib, Ic, IIc and IId). A co-circula-
tion of the lineages was observed throughout the study. None of
our samples clustered with either vaccine strain RVA/Vaccine/
USA/Rotarix-A41CB052A/1988/G1P1A[8] that belong to sublineage
G1-IIa, vaccines strains (RVA/Vaccine/USA/RotaTeq-WI79-9/1992/
G1P7[5] and RVA/Vaccine/USA/HRV-BRV-DxUK/1984/G1P7[5]) or
the reference strain (RVA/Human-tc/USA/Wa/1974/G1P1A[8]) that
belong to lineage G1-III (Fig. 1). Likewise, comparison of VP7 se-
quences of Brazilian strains isolated in Rio de Janeiro (Araújo
et al., 2007) and São Paulo (Carmona et al, unpublished data) be-
tween 1996 and 2004 as well as South American strains isolated
between 1996 and 2005 obtained from the GenBank did not cluster
with vaccine strains, except for two strains from Paraguay isolated
in 1996 that clustered with the Rotarix vaccine. On the other hand,
two Brazilian strains, Brz-3 and Brz-5 isolated in 1991 and 1992,
respectively, from placebo controls participating in a rotavirus vac-
cine trial in Belém (Jin et al., 1996) clustered in lineage III together
with DxUK and WI79-9 vaccine strains (Fig. 1).
The degree of nucleotide identity among the Brazilian strains
within each lineage was >95.3% and 97.6% for lineages I and II,
respectively. The identity between the lineages I and II ranged from
93.9% to 95.0%. When compared to the lineage of vaccine strains
this identity ranged from 90.5% to 98.7% The amino acid identity
within each lineage was >96.0% and 98.2% for lineages I and II,
respectively. The percentage between lineages was from 93.9% to
96.0%. When compared to the lineage of reference strains identity
ranged from 95.1% to 98.5%.
The majority of the amino acid changes between the Brazilian
G1 strains from both lineages (I and II) and G1 reference strains
(lineage III) occurred within the hypervariable regions, including
the antigenic regions A–C (Fig. 2).
3.1.1. 3D structure and comparative analysis
The 3D models generated in our analysis exhibited good stereo-
chemical qualities, with more than 99% of its residues within al-
lowed regions of the Ramachandran plot. The RMSD measures
the structural similarity between optimally superposed structures,
and is used as indicative of the model quality. The highest RMSD
between each model and 3FMG was 0.27 Å. The ProSa Z-score mea-
sures the deviation of the total energy of a structure of interest in
regard to an energy distribution derived from random conforma-
tions. The Z-scores of the generated VP7 models ranged from
?7.42 to ?7.39. Those values are in agreement with the scores of
proteins with similar size (?230 residues), indicating that the
models have no major errors.
The proteins were modeled in their trimeric forms using the
biological unit of 3FMG. The VP7 trimer is stabilized by calcium
ions located at the interfaces of the subunits (Aoki et al., 2009).
The regions on VP7, 7-1 and 7-2, are located at the exposed sur-
faces of the calcium binding sites, or between domains from the
same subunit (Aoki et al., 2009), as exemplified in Fig. 3. Compar-
ison between the VP7 trimeric structures of the vaccine strain RVA/
Vaccine/USA/Rotarix-A41CB052A/1988/G1P1A[8] and the Brazil-
ians G1 strains showed mutations at amino acid residues located
at the calcium binding site (aa 231 Asp ? Asn) and at the antibody
recognition sites (aa 94 [Asn ? Ser], 217 [Met ? Thr or Met ? Ile];
and 291 [Lys ? Arg]) (Fig. 4).
Amino acid residues known to contribute to calcium ligation in
the simian rotavirus 3D protein 3FGM (aa 177, 182, 206, 214, 216,
228, 229 and 231) (Aoki et al., 2009) were found to be conserved and
placed in equivalent spacial positions on the models in comparison
with vaccine strain RVA/Vaccine/USA/Rotarix-A41CB052A/1988/
G1P1A[8], with exception of the 231-Asp ? Asn mutation in
lineage G1-Ia (Fig. 2). The residues proposed as integrin binding
site (aa 253–255) (Aoki et al., 2009) and as possible glycosylation
sites of the VP7 protein (aa 69–71 and aa 238–240) (Jayasinghe
and Palombo, 1999) remained conserved among all Brazilians
contemporary strains analyzed in this study.
4. Discussion
Several studies have investigated the genetic variation of RVA-
G1 strains reveling an incredible genetic variability among such
strains and widespread geographic distribution of its lineages
and sublineages (Xin et al., 1993; Jayasinghe and Palombo, 1999;
Maunula and von Bonsdorff, 2002; Parra et al., 2005; Arista et al.,
2006; Rodríguez-Castillo et al., 2006; Phan et al., 2007; Arora
et al., 2009, 2011; Nagaoka et al., 2012; Zeller et al., 2012). What
is still not clear however is whether such variability will have
any impact on the efficacy of RVA vaccines. In a study conducted
in the US in 1991–1992 to evaluate the efficacy of two RVA vaccine
candidates, a rhesus tetravalent (RRV-TV) and a serotype G1 mono-
valent (RRV-S1), both contained the RVA/Human-tc/USA/D/1974/
G1P1A[8] strain, Jin et al. (1996) described the occurrence of vac-
cine breakthrough (i.e., vaccine failure). The authors investigate
the possibility that such event was caused by G1 strains that were
sufficiently antigenic distinct from the vaccine strain to evade the
neutralizing antibodies elicited by the vaccine. The serologic anal-
ysis of the G1 breakthrough strains compared to that of Wa strains,
whose VP7 protein is nearly identical do the D strain used in the
vaccines, revealed that although the pos-immunization neutraliz-
ing antibody titers to Wa elicited by vaccination were significantly
greater than to the breakthrough strains, this difference did not
correlate with lack of protection since similar differences in titers
were found using sera from vaccines who either experienced
asymptomatic infections or no infections. The authors also ana-
lyzed the genetic makeup of the breakthrough strains comparing
their sequences to the Wa and D strains and G1 control strains iso-
lated from placebo recipients. They found that all breakthrough
and control strains were distinct from Wa and D in antigenically
important regions throughout the VP7 protein, including in regions
A, B and C. In region A, 10 out of 12 breakthrough strains and 1 out
of 3 control strains had a 97-Asp ? Glu change; all strains had a
147-Ser ? Asn in region B. Those specific changes have now been
sowed to be important neutralizing site (Aoki et al., 2009). The
authors concluded that, although the results were not robust en-
ough to support the hypothesis that immune selection of antigen-
ically distinct escape mutants led to vaccine breakthrough, it could
A.G. Maranhão et al./Infection, Genetics and Evolution 12 (2012) 1397–1404
1399

Page 5

Author's personal copy
not be excluded that the breakthrough could be partially due to
antigenic differences in the VP7 proteins of circulating G1strains
(Jin et al., 1996).
Escape mutations selected by neutralizing monoclonal antibod-
ies that recognize VP7 from G1 serotype strains have been identi-
fied in amino acid residues 94, 96–100, 104, 145, 147–148, 201,
R115-1998
R321-2004
Mvd9816-1998
Mvd9814-1998
R312-2003
R283-2002
R241-2000
R264-2001
417-1991
R153-1999
IALR23-1996
IALR16-996
R117-1998
R15-1996
R63-1997
Py02SR11-2002/05
Py03SR286-2002-05
Mvd9608-1996
Mvd9606-1996
Rotarix-USA-1988
7014/JP-2005/06
7206/JP-2005/06
R289-2002
PA164/99-1999
PA430/00-2000
R169-1999
R238-2000
R305-2003
R315-2004
Kor/64-Korea-1988
PA78/89-1989
Brz-3-1991
Brz-5-1992
WI79-9-1992
Wa-1974
D-1974
DxUK-1984
Au19-1997
G3
100
100
95
55
100
100
96
99
97
72
99
99
99
97
77
93
92
90
69
70
93
65
55
59
100
100
100
75
99
0.005
Ic
Ib
Ia
I
IIb
IIa
IIc
IId
II
IV
V
III
VI
Fig. 1. Phylogenetic analysis of the partial VP7 nucleotide sequence (49–996) of genotype G1 rotavirus strains. The distances were corrected using the Jukes-Cantor model.
The phylogenetic tree was constructed by the neighbor-joining method and statistical support was provided by bootstrapping of 1000 pseudoreplicates. Bootstrap values
above 50% are given at branch nodes. Distance scale is in substitutions/site.
1400
A.G. Maranhão et al./Infection, Genetics and Evolution 12 (2012) 1397–1404

Page 6

Author's personal copy
211, 213, 217, 221 and 291, all located within regions 7-1 and 7-2
(Kobayashi et al., 1991; Aoki et al., 2009). More convincing, sero-
logical analysis demonstrate the association of preexisting anti-
bodies that block the amino acid residue 94 (antigenic region
A/7-1) of G1 strains with resistance to illness or virus shedding
in adults volunteers challenged with a virulent G1 strain (D strain)
(Green and Kapikian, 1992). A similar study demonstrate the asso-
ciation of antibodies that block the amino acid residue 213 (anti-
genic region C/7-1) of G1strains with protection against illness in
children with natural rotavirus infections (O’Ryan et al., 1994). In
this study we observed substitutions in amino acids residues
which are located within the antigenic regions A/7-1 (aa
94/Asn ? Ser – all strains belonging to sublineage G1-Ic); region
C/7-1 (217/Met ? Thr – all Brazilian lineage G1-I strains analyzed
in this study) and; region 7-1 (aa 291/Lys?Arg – all Brazilian line-
age G1-I strains analyzed in this study). Although the majority of
the amino acid differences were conservative or semi-conservative
they were located in the exposed surface of the protein within the
VP7 neutralization domain 7-1 which spans the intersubunit
boundary and is an immunodominant region. These results suggest
that the Brazilian strains, particularly those of lineage G1-I that
accumulates mutations in all (lineage Ic) or most (lineages Ia and
Ib) of these amino acid residues, could evolve over time into a var-
iant that escape the immune response elicited by the vaccine and
consequently cause a vaccine breakthrough. Incidentally, at least
partial cross-protection for different lineages has demonstrated
for rotaviruses G9 serotype. Hoshino et al. (2004) analyzed the
relationship of the phylogenetic lineages to the neutralization
specificities of various G9 strains and reported that antibodies
raised against lineage 1 G9 strains, represented by the earliest
strains recovered in the United States and Japan, efficiently
neutralized the contemporary G9 strains from lineages 2 and 3;
Fig. 2. Alignment of the deduced amino acid of the VP7 gene of genotype Brazilian G1 rotavirus strains compared to vaccine strains A41CB052A, DxUK and WI79-9. Strains of
the same lineage are indicated by curly brackets. Conserved amino acid residues are indicated by dots. Residues in the variable regions are marked by black boxes.
A.G. Maranhão et al./Infection, Genetics and Evolution 12 (2012) 1397–1404
1401

Page 7

Author's personal copy
however, antibodies against the lineage 3 G9 strains did not
efficiently neutralize strains belonging to lineage 1.
Yet, it is quite remarkable that the contemporary G1 strains
analyzed in the present study, as well as other recent publications
(Parra et al., 2005; Arista et al., 2006; Phan et al., 2007; Araújo
et al., 2007; Arora et al., 2009; Nagaoka et al., 2012; Zeller et al.,
2012) have a genetic makeup different from that of the G1 refer-
ence strains Wa isolated in 1974 and the vaccines strains D, iso-
lated in 1974, WI79 isolated in 1983 and 82-12 isolated in 1988.
If we considered rotavirus as diverse virus population (Gouvea
and Brantly, 1995) it would be possible that these G1 mutant
strains represent a non dominant variant on the pool of G1 strain
circulating among the human population since earlier 1970s. As
the population developed immune response against the dominant
strains the mutant G1 strains were able to emerge.
G1 is the most prevalent rotavirus strain around the world
(Santos and Hoshino, 2005). Temporal fluctuation of rotavirus
genotypes has been described, with some genotypes such as G2
displaying a circle pattern of 10-years interval (Bishop et al.,
1991; Santos and Hoshino, 2005; Leite et al., 2008). Still, although
the frequency of G1 fluctuates it is always present in the popula-
tion. Perhaps the introduction of new variants could explain the
continuous circulation of such strains in the population, as sug-
gested by others (Xin et al., 1993; Jayasinghe and Palombo,
1999; Maunula and von Bonsdorff, 2002; Parra et al., 2005; Arista
et al., 2006; Rodríguez-Castillo et al., 2006; Phan et al., 2007;
Arora et al., 2009, 2011; Nagaoka et al., 2012; Zeller et al.,
2012). In this context the continuous emergence of such variant
strains would represent a threat for the efficacy of rotavirus
vaccine program.
Several studies have shown the rotavirus vaccines efficacy
(Vesikari et al., 2006a, 2006b; Ruiz-Palacios et al., 2006). Even
though Brazilian contemporary G1 strains are of a different lineage
of the vaccine strain currently used in the country, the rotavirus
vaccine program has clearly been successful in Brazil (do Carmo
et al., 2011). Nevertheless, it is worth to continue monitoring
Fig. 2 (continued)
1402
A.G. Maranhão et al./Infection, Genetics and Evolution 12 (2012) 1397–1404

Page 8

Author's personal copy
rotavirus intragenotype diversity in the post-vaccination era, to
understand the impact of variant strains on vaccine effectiveness.
Acknowledgments
We thank Soluza dos Santos Gonçalves for the technical assis-
tance. This study was supported in part by Conselho Nacional de
Desenvolvimento Científico e Tecnológico (CNPq), Coordenação
de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) and,
Fundação Carlos Chagas de Amparo à Pesquisa do Estado do Rio
de Janeiro (FAPERJ), Brazil.
There is no conflict of interest to declare.
References
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local
alignment search tool. J. Mol. Biol. 215, 403–410.
Aoki, S.T., Settembre, E.C., Trask, S.D., Greenberg, H.B., Harrison, S.C., Dormitzer, P.R.,
2009. Structure of rotavirus outer-layer protein VP7 bound with a neutralizing
fab. Science 324, 1444–1447.
Araújo, I.T., Assis, R.M., Fialho, A.M., Mascarenhas, J.D., Heinemann, M.B., Leite, J.P.,
2007. Brazilian P[8], G1, P[8], G5, P[8], G9, and P[4], G2 rotavirus strains:
nucleotide sequence and phylogenetic analysis. J. Med. Virol. 79, 995–1001.
Arista, S., Giammanco, G.M., de Grazia, S., Ramirez, S., Lo Biundo, C., Colomba, C.,
Cascio, A., Martella, V., 2006. Heterogeneity and temporal dynamics of evolution
of G1 human rotaviruses in a settled population. J. Virol. 80, 10724–10733.
Arora, R., Chhabra, P., Chitambar, S.D., 2009. Genetic diversity of genotype G1
rotaviruses co-circulating in western India. Vir. Res. 146, 36–40.
Arora, R., Shobha, D., Chitambar, D., 2011. Full genomic analysis of Indian G1P[8]
rotavirus strains. Infect. Genet. Evol. 11, 504–511.
Benati, F.J., Maranhão, A.G., Lima, R.S., da Silva, R.C., Santos, N., 2010. Multiple-gene
characterization of rotavirus strains: evidence of genetic linkage among VP7,
VP4, VP6 and NSP4 encoding genes. J. Med. Virol. 82, 1797–1802.
Bishop, R.F., Unicomb, L.E., Barnes, G.L., 1991. Epidemiology of rotavirus serotypes
in Melbourne, Australia, from 1973 to 1989. J. Clin. Microbiol. 29, 862–868.
Ciarlet, M., Hoshino, Y., Liprandi, F., 1997. Single point mutations may affect the
serotype reactivity of serotype G11 porcine rotavirus strains: a widening
spectrum? J. Virol. 71, 8213–8220.
Desselberger, U., 1996. Genome rearrangements of rotavirus. Adv. Virus Res. 46, 69–
95.
do Carmo, G.M.I., Yen, C., Cortes, J., Siqueira, A.A., de Oliveira, W.K., Cortez-Escalante,
J.J., Lopman, B., Flannery, B., de Oliveira, L.H., Carmo, E.H., Patel, M., 2011.
Decline in diarrhea mortality and admissions after routine childhood rotavirus
immunization in Brazil: a time-series analysis. PLoS Med. 8 (4), e1001024.
Dormitzer, P.R., Greenberg, H.B., Harrison, S.C., 2000. Purified recombinant rotavirus
VP7 forms soluble, calcium-dependent trimers. Virology 277, 420–428.
Dyall-Smith, M.L., Lazdins, I., Tregear, G.W., Holmes, I.H., 1986. Location of the
major antigenic sites involved in rotavirus serotype-specific neutralization.
Proc. Natl. Acad. Sci. USA 83, 3465–3468.
Estes, M., Kapikian, A.Z., 2007. Rotaviruses. In: Knipe, D.M., Howley, P.M., Griffin,
D.E., Lamb, R.A., Martin, M.A., Roizman, B., Straus, S.E. (Eds.), Fields Virology,
fifth ed. Kluwer Healt Lippincott, Williams and Wilkins, Philadelphia, United
States, pp. 1917–1974.
Eswar, N., Marti-Renom, M.A., Webb, B., Madhusudhan, M.S., Eramian, D., Shen, M.,
Pieper, U., Sali, A., 2006. Comparative Protein Structure Modeling with
MODELLER. Current Protocols in Bioinformatics. John Wiley & Sons, Inc.,
Supplement 15, 5.6.1–5.6.30.
Gouvea, V., Brantly, M., 1995. Is rotavirus a population of reassortants? Trends
Microbiol. 3, 159–162.
Gouvea, V., Glass, R.I., Woods, P., Taniguchi, K., Clark, H.F., Forrester, B., Fang, Z.Y.,
1990. Polymerase chain reaction amplification and typing of rotavirus nucleic
acid from stool specimens. J. Clin. Microbiol. 28, 276–282.
Green, K.Y., Kapikian, A.Z., 1992. Identification of VP7 epitopes associated with
protection against human rotavirus illness or shedding in volunteers. J. Virol.
66, 548–553.
Hoshino, Y., Jones, R.W., Ross, J., Honma, S., Santos, N., Gentsch, J.R., Kapikian, A.Z.,
2004. Rotavirus serotype G9 strains belonging to VP7 gene phylogenetic
sequence lineage 1 may be more suitable for serotype G9 vaccine candidates
than those belonging to lineage 2 or 3. J. Virol. 78, 7795–7802.
Iturriza-Gómara, M., Isherwood, B., Desselberger, U., Gray, J., 2001. Reassortment
in vivo: driving force for diversity of human rotavirus strains isolated in the
United Kingdom between 1995 and 1999. J. Virol. 75, 3696–3705.
Jayasinghe, S.M., Palombo, E.A., 1999. Genetic homogeneity of human serotype G1
rotaviruses isolated during a single epidemic season: implications for vaccine
strategies. Acta Virol. 43, 53–55.
Jin, Q., Ward, R.L., Knowlton, D.R., Gabbay, Y.B., Linhares, A.C., Rappaport, R., Wood,
P.A., Glass, R.I., Gentsch, J.R., 1996. Divergence of VP7 genes of G1 rotaviruses
isolated from infants vaccinated with reassortant rhesus rotaviruses. Arch.
Virol. 141, 2057–2076.
Kapikian, A.Z., Simonsen, L., Vesikari, T., Hoshino, Y., Morens, D.M., Chanock, R.M., La
Montagne, J.R., Murphy, B.R., 2005. A hexavalent human rotavirus-bovine
rotavirus (UK) reassortant vaccine designed for use in developing countries and
delivered in a schedule with the potential to eliminate the risk of
intussusception. J. Infect. Dis. 192 (Suppl. 1), S22–S29.
Kobayashi, N., Taniguchi, K., Urasawa, S., 1991. Analysis of the newly identified
neutralization epitopes on VP7 of human rotavirus serotype 1. J. Gen. Virol. 72,
117–124.
Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular
evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5, 150–
163.
Leite, J.P., Carvalho-Costa, F.A., Linhares, A.C., 2008. Group A rotavirus genotypes
and the ongoing Brazilian experience: a review. Mem. Inst. Oswaldo Cruz. 103,
745–753.
Matthijnssens, J., Joelsson, D.B., Warakomski, D.J., Zhou, T., Mathis, P.K., van Maanen,
M.H., Ranheim, T.S., Ciarlet, M., 2010. Molecular and biological characterization
Fig. 3. A 3D model of the VP7 protein of the rotavirus Wa. The regions on VP7, 7-1
(red) and 7-2 (blue), are located at the exposed surfaces of the calcium binding sites,
or between domains from the same subunit. (For interpretation of the references to
color in this figure legend, the reader is referred to the web version of this article.)
Fig. 4. Cartoon representation of VP7 trimer from RVA/Vaccine/USA/Rotarix-
A41CB052A/1988/G1P1A[8] (blue) and R312 (salmon). Mutations in amino acids
involved in calcium binding (aa 231) and in antibody recognition (aa 94, 217 and
291) are shown as sticks. Calcium ions are represented as black spheres. (For
interpretation of the references to colour in this figure legend, the reader is referred
to the web version of this article.)
A.G. Maranhão et al./Infection, Genetics and Evolution 12 (2012) 1397–1404
1403

Page 9

Author's personal copy
of the 5 human-bovine rotavirus (WC3)-based reassortant strains of the
pentavalent rotavirus vaccine, RotaTeq. Virology 403, 111–127.
Matthijnssens, J., Attoui, H., Bányai, K., Brister, J.R., Buesa, J., Ciarlet, M.,
Desselberger, U., Esona, M.D., Estes, M.K., Gentsch, J.R., Iturriza-Gómara, M.,
Johne, R., Kirkwood, C., Martella, V., Mcdonald, S.M., Mertens, P.P.C., Nakagomi,
O., Parreño, V., Patton, J.T., Rahman, M., Ruggeri, F.M., Saif, L.J., Santos, N., Steyer,
A., Taniguchi, K., Van Ranst, M., 2011. Uniformity of rotavirus strain
nomenclature proposed by the Rotavirus Classification Working Group
(RCWG). Arch Virol. 156, 1397–1413.
Maunula, L., von Bonsdorff, C.H., 2002. Frequent reassortments may explain the
genetic heterogeneity of rotaviruses: analysis of Finnish rotavirus strains. J.
Virol. 76, 11793–11800.
Midthun, K., Greenberg, H.B., Hoshino, Y., Kapikian, A.Z., Wyatt, R.G., Chanock, R.M.,
1985. Reassortant rotaviruses as potential live rotavirus vaccine candidates. J.
Virol. 53, 949–954.
Nagaoka, Y., Tatsumi, M., Tsugawa, T., Yoto, Y., Tsutsumi, H., 2012. Phylogenetic and
computational structural analysis of VP7 gene of group a human rotavirus
G1P[8] strains obtained in Sapporo, Japan from 1987 to 2000. J. Med. Virol. 84,
832–838.
O’Ryan, M., Matson, D.O., Estes, M.K., Pickering, L.K., 1994. Anti-rotavirus G type-
specific and isotype-specific antibodies in children with natural rotavirus
infections. J. Infect. Dis. 169, 504–511.
Parra, G.I., Bok, K., Martinez, V., Russomando, G., Gómez, J., 2005. Molecular
characterization and genetic variation of the VP7 gene of human rotaviruses
isolated in Paraguay. J. Med. Virol. 77, 556–579.
Parashar, U.D., Gibson, C.J., Bresee, J.S., Glass, R.I., 2006. Rotavirus and severe
childhood diarrhea. Emerg. Infect. Dis. 2, 304–306.
Phan, T.G., Khamrin, P., Quang, T.D., Dey, S.K., Takanashi, S., Okitsu, S., Maneekarn,
N., Ushijima, H., 2007. Detection and genetic characterization of group A
rotavirus strains circulation among children with acute gastroenteritis in Japan.
J. Virol. 81, 4646–4653.
Rodríguez-Castillo, A., González, J.E.R., Noriega, L.P., Barrón, B.L., 2006. Analysis of
human rotavirus G1P[8] strains by RFLP reveals higher genetic drift in the VP7
than the VP4 gene during a 4-year period in Mexico. J. Virol. Meth. 138, 177–
183.
Ruiz-Palacios, G.M., Pérez-Schael, I., Velázquez, F.R., Abate, H., Breuer, T., Clemens,
S.C., Cheuvart, B., Espinoza, F., Gillard, P., Innis, B.L., Cervantes, Y., Linhares, A.C.,
López, P., Macías-Parra, M., Ortega-Barría, E., Richardson, V., Rivera-Medina,
D.M., Rivera, L., Salinas, B., Pavía-Ruz, N., Salmerón, J., Rüttimann, R., Tinoco, J.C.,
Rubio, P., Nuñez, E., Guerrero, M.L., Yarzábal, J.P., Damaso, S., Tornieporth, N.,
Sáez-Llorens, X., Vergara, R.F., Vesikari, T., Bouckenooghe, A., Clemens, R., De
Vos, B., O’Ryan, M.Human Rotavirus Vaccine Study Group, 2006. Safety and
efficacy of an attenuated vaccine against severe rotavirus gastroenteritis. N.
Engl. J. Med. 354, 11–22.
Santos, N., Hoshino, Y., 2005. Global distribution of rotavirus serotypes/genotypes
and its implication for the development and implementation of an effective
rotavirus vaccine. Rev. Med. Virol. 15, 29–56.
Suzuki, Y., Gojobori, T., Nakagomi, O., 1998. Intragenic recombination in rotaviruses.
FEBS 427, 183–187.
Vesikari, T., Karvonen, A.V., Majuri, J., Zeng, S.Q., Pang, X.L., Kohberger, R., Forrest,
B.D., Hoshino, Y., Chanock, R.M., Kapikian, A.Z., 2006a. Safety, efficacy, and
immunogenicity of 2 doses of bovine-human (UK) and rhesus-rhesus-human
rotavirus reassortant tetravalent vaccines in Finnish children. J. Infect. Dis. 194,
370–376.
Vesikari, T., Matson, D.O., Dennehy, P., Van Damme, P., Santosham, M., Rodriguez, Z.,
Dallas, M.J., Heyse, J.F., Goveia, M.G., Black, S.B., Shinefield, H.R., Christie, C.D.,
Ylitalo, S., Itzler, R.F., Coia, M.L., Onorato, M.T., Adeyi, B.A., Marshall, G.S.,
Gothefors, L., Campens, D., Karvonen, A., Watt, J.P., O’Brien, K.L., DiNubile, M.J.,
Clark, H.F., Boslego, J.W., Offit, P.A., Heaton, P.M.Rotavirus Efficacy and Safety
Trial (REST) Study Team, 2006b. Safety and efficacy of a pentavalent human-
bovine (WC3) reassortant rotavirus vaccine. N. Engl. J. Med. 354, 23–33.
Ward, R.L., Bernstein, D.I., 2009. Rotarix: a rotavirus vaccine for the world. Clin.
Infect. Dis. 48, 222–228.
Wiederstein, M., Sippl, M.J., 2007. ProSA-web: interactive web service for the
recognition of errors in three-dimensional structures of proteins. Nucleic Acids
Res. 35, W407–W410.
Wyatt, R.G., James Jr., H.D., Pittman, A.L., Hoshino, Y., Greenberg, H.B., Kalica, A.R.,
Flores, J., Kapikian, A.Z., 1983. Direct isolation in cell culture of human
rotaviruses and their characterization into four serotypes. J. Clin. Microbiol.
18, 310–317.
Xin, K.Q., Morikawa, S., Fang, Z.Y., Mukoyama, A., Okuda, K., Ushijima, H., 1993.
Genetic variation in VP7 gene of human rotavirus serotype 1 (G1 Type) isolated
in Japan and China. Virology 197, 813–816.
Zeller, M., Patton, J.T., Heylen, E., De Coster, S., Ciarlet, M., Van Ranst, M.,
Matthijnssens, J., 2012. Genetic analyses reveal differences in the VP7 and
VP4 antigenic epitopes between human rotaviruses circulating in Belgium and
rotaviruses in Rotarix and RotaTeq. J. Clin. Microbiol. 50, 966–976.
1404
A.G. Maranhão et al./Infection, Genetics and Evolution 12 (2012) 1397–1404