Article

Development of electrochemical DNA biosensor for Trichoderma harzianum based on ionic liquid/ZnO nanoparticles/chitosan/gold electrode

Journal of Solid State Electrochemistry (Impact Factor: 2.23). 01/2012; 16(1):273-282. DOI: 10.1007/s10008-011-1322-y

ABSTRACT Electrochemical DNA biosensor was successfully
developed by depositing the ionic liquid (e.g., 1-ethyl-3-
methylimidazolium trifluoromethanesulfonate ([EMIM]
[Otf])), ZnO nanoparticles, and chitosan (CHIT) nanocomposite
membrane on a modified gold electrode (AuE). The
electrochemical properties of the [EMIM][Otf]/ZnO/CHIT/
AuE for detection of DNA hybridization were studied. Under
optimal conditions using cyclic voltammetry, the target DNA
sequences could be detected in the concentration range of
1.0×10−18 to 1.82×10−4 mol L−1, and with the detection limit of 1.0×10−19 mol L−1. This DNA biosensor detection
approaches provide a quick, sensitive, and convenient method
to be used in the identification of Trichoderma harzianum

1 Follower
 · 
233 Views
  • [Show abstract] [Hide abstract]
    ABSTRACT: Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25°C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples. Copyright © 2015 Elsevier B.V. All rights reserved.
    Bioelectrochemistry 04/2015; 105. DOI:10.1016/j.bioelechem.2015.03.005 · 3.87 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: We developed an electrochemical thrombin aptasensor based on ZnO nanorods functionalized by electrostatically adsorption of 30-mer DNA aptamers. The sensor surface was characterized by AFM and SEM. The surface layer assembling was optimized using cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) with ferricyanide ions as redox markers. The peak current of the ferricyanide and the charge transfer resistance gradually decreased with increasing concentration of thrombin in the range from 3 pM to 100 nM due to formation of aptamer-thrombin complexes and slower diffusion of the marker ions through the surface layer. At optimal conditions, a limit of detection (LOD) of 3 pM for EIS measurements and 10 pM for CV response was calculated from the S/N=3.
    Electroanalysis 08/2013; 25(8). DOI:10.1002/elan.201300195 · 2.50 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: A new carbon ionic liquid electrode (CILE) has been constructed using a low melting point (39 °C) hydrophobic ionic liquid (IL) 1-propyl-3-methylimidazolium hexafluorophosphate ([Pmim][PF6]) as the binder. Both cyclic voltammetry and electrochemical impedance spectroscopy demonstrate that, in addition to the composition optimization of the IL/graphite composite, heating the composite at a temperature a little higher than the melting point of [Pmim][PF6] can also lower the background current and enhance the mechanical strength of the CILE. The heated CILE is more sensitive than the traditional carbon paste electrode for the detection of H2O2. Glucose oxidase (GOx) can be easily entrapped in the bulk IL/graphite composite. Heating the GOx-modified CILE (GOx-CILE) at the melting point of [Pmim][PF6] does not lower the catalytic activity of GOx. As compared with n-octylpyridinium hexafluorophosphate (melting point 65 °C) as the binder, [Pmim][PF6]-based CILE is much better in signal-to-noise ratio. Under the optimum conditions, the [Pmim][PF6]-based GOx-CILE has a linear amperometric response to glucose over a concentration range of 2.0–26 mM with the detection limit as low as 0.39 mM. It follows that choosing an IL with a melting point of ca. 40 °C as a binder to fabricate enzyme-entrapped CILEs is a good strategy for the enhancement of the performance of the electrode.
    Journal of Solid State Electrochemistry 10/2012; 16(10). DOI:10.1007/s10008-012-1772-x · 2.23 Impact Factor