Development of electrochemical DNA biosensor for Trichoderma harzianum based on ionic liquid/ZnO nanoparticles/chitosan/gold electrode

Journal of Solid State Electrochemistry (Impact Factor: 2.45). 01/2012; 16(1):273-282. DOI: 10.1007/s10008-011-1322-y


Electrochemical DNA biosensor was successfully
developed by depositing the ionic liquid (e.g., 1-ethyl-3-
methylimidazolium trifluoromethanesulfonate ([EMIM]
[Otf])), ZnO nanoparticles, and chitosan (CHIT) nanocomposite
membrane on a modified gold electrode (AuE). The
electrochemical properties of the [EMIM][Otf]/ZnO/CHIT/
AuE for detection of DNA hybridization were studied. Under
optimal conditions using cyclic voltammetry, the target DNA
sequences could be detected in the concentration range of
1.0×10−18 to 1.82×10−4 mol L−1, and with the detection limit of 1.0×10−19 mol L−1. This DNA biosensor detection
approaches provide a quick, sensitive, and convenient method
to be used in the identification of Trichoderma harzianum

Download full-text


Available from: S. G. Tan, Sep 01, 2015
  • Source
    • "/ZnO/CHIT/AuE (h,I,j) complementary strand of T. harzianum 1 aM – 0.182 mM 0.1 aM CV with MB 60 [30] 5 NAS-Modified Acrylic Microspheres (k) Complementary DNA 0.1 fM -100 μM 94.6 aM DPV using anthraquninone-2-sulfonic acid monohydrate sodium salt 30 [31] 6 GO-CHI/ITO (l) complementary strand of S. typhi 10 fM -50 nM 10 fM DPV with MB 1 [32] 7 AuNPs/CA/nBDD (m) complementary DNA sequences 0.158 pM -0.158 μM 9.8 pM DPV with Daunomycin - [33] 8 PEDOT-PSS/AgNPs/AuE (n,o) complementary sequence of Ganoderma boninense 1.0 fM -1.0 nM 0.5 fM DPV with ruthenium complex 25 [34] 9 Au NRs-GO nanocomposite (p) complementary DNA sequences 1.0 nM – 10 fM 3.5 fM DPV with MB 40 [35] 10 rGO–AuNPs DNA insertion sequence IS6110 of M. tuberculosis 1 fM -1 nM 1 fM DPV using Au–PANI tracer 120 [36] 11 ZnONWs/Au Electrode (q) breast cancer 1 gene 10.0 -100.0 μM 3.32 μM DPV 90 [37] 12 AuNPs/MoS 2 /Gr/GCE (r) complementary DNA sequences 50 fM -5.0 nM 2.2 fM DPV using SA-HRP-AuNPs tracer 90 [38] 13 MUA functionalized GNAs/ITO complementary strand of S. typhi 4 aM -24 fM 4 aM DPV with MB 1 Present study a chitosan. b multiwalled carbon nanotubes. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25°C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples. Copyright © 2015 Elsevier B.V. All rights reserved.
    Bioelectrochemistry 04/2015; 105. DOI:10.1016/j.bioelechem.2015.03.005 · 4.17 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Nanotechnology is playing an important role in the development of biosensors. The exclusive physical and chemical properties of nanomaterials make them exceptionally suitable for designing new and improved sensing devices, especially electrochemical sensors and biosensors. Room temperature ionic liquids (RTILs) are salts that exist in the liquid phase at and around 298 K and are entirely composed of ions: a bulky, asymmetric organic cation and usually an inorganic anion but some ILs also has organic anion. ILs have received much attention as a replacement for traditional volatile organic solvents as they possess many attractive properties such as intrinsic ion conductivity, low volatility, high chemical and thermal stability, low combustibility, and wide electrochemical windows, etc. Due to negligible or nonzero volatility of these solvents, they are considered “greener” for the environment in comparison to volatile organic compounds. ILs have been widely used in electrodeposition, electrosynthesis, electrocatalysis, electrochemical capacitor, lubricants, plasticizers, solvent, lithium batteries, solvents to manufacture nanomaterials, extraction, gas absorption agents etc. [1–4]. This review discusses the electrochemical sensors and biosensors based on carbon nanotubes, metal oxide nanoparticles, and ionic liquid/composite modified electrodes. The main thrust of the review is to present an overview on the advantages of use of RTILs along with nanomaterials for electrochemical sensors and biosensors. Consequently, recent developments and major strategies for enhancing sensing performance have been thoroughly discussed.
    BioNanoScience 09/2013; 3(3). DOI:10.1007/s12668-013-0094-5
  • [Show abstract] [Hide abstract]
    ABSTRACT: A new carbon ionic liquid electrode (CILE) has been constructed using a low melting point (39 °C) hydrophobic ionic liquid (IL) 1-propyl-3-methylimidazolium hexafluorophosphate ([Pmim][PF6]) as the binder. Both cyclic voltammetry and electrochemical impedance spectroscopy demonstrate that, in addition to the composition optimization of the IL/graphite composite, heating the composite at a temperature a little higher than the melting point of [Pmim][PF6] can also lower the background current and enhance the mechanical strength of the CILE. The heated CILE is more sensitive than the traditional carbon paste electrode for the detection of H2O2. Glucose oxidase (GOx) can be easily entrapped in the bulk IL/graphite composite. Heating the GOx-modified CILE (GOx-CILE) at the melting point of [Pmim][PF6] does not lower the catalytic activity of GOx. As compared with n-octylpyridinium hexafluorophosphate (melting point 65 °C) as the binder, [Pmim][PF6]-based CILE is much better in signal-to-noise ratio. Under the optimum conditions, the [Pmim][PF6]-based GOx-CILE has a linear amperometric response to glucose over a concentration range of 2.0–26 mM with the detection limit as low as 0.39 mM. It follows that choosing an IL with a melting point of ca. 40 °C as a binder to fabricate enzyme-entrapped CILEs is a good strategy for the enhancement of the performance of the electrode.
    Journal of Solid State Electrochemistry 10/2012; 16(10). DOI:10.1007/s10008-012-1772-x · 2.45 Impact Factor
Show more