The contrasting effect of macromolecular crowding on amyloid fibril formation.

Abstract

Amyloid fibrils associated with neurodegenerative diseases can be considered biologically relevant failures of cellular quality control mechanisms. It is known that in vivo human Tau protein, human prion protein, and human copper, zinc superoxide dismutase (SOD1) have the tendency to form fibril deposits in a variety of tissues and they are associated with different neurodegenerative diseases, while rabbit prion protein and hen egg white lysozyme do not readily form fibrils and are unlikely to cause neurodegenerative diseases. In this study, we have investigated the contrasting effect of macromolecular crowding on fibril formation of different proteins.
As revealed by assays based on thioflavin T binding and turbidity, human Tau fragments, when phosphorylated by glycogen synthase kinase-3β, do not form filaments in the absence of a crowding agent but do form fibrils in the presence of a crowding agent, and the presence of a strong crowding agent dramatically promotes amyloid fibril formation of human prion protein and its two pathogenic mutants E196K and D178N. Such an enhancing effect of macromolecular crowding on fibril formation is also observed for a pathological human SOD1 mutant A4V. On the other hand, rabbit prion protein and hen lysozyme do not form amyloid fibrils when a crowding agent at 300 g/l is used but do form fibrils in the absence of a crowding agent. Furthermore, aggregation of these two proteins is remarkably inhibited by Ficoll 70 and dextran 70 at 200 g/l.
We suggest that proteins associated with neurodegenerative diseases are more likely to form amyloid fibrils under crowded conditions than in dilute solutions. By contrast, some of the proteins that are not neurodegenerative disease-associated are unlikely to misfold in crowded physiological environments. A possible explanation for the contrasting effect of macromolecular crowding on these two sets of proteins (amyloidogenic proteins and non-amyloidogenic proteins) has been proposed.

Full text

Page 1

The Contrasting Effect of Macromolecular Crowding on
Amyloid Fibril Formation
Qian Ma., Jun-Bao Fan., Zheng Zhou, Bing-Rui Zhou, Sheng-Rong Meng, Ji-Ying Hu, Jie Chen, Yi Liang*
State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, China
Abstract
Background: Amyloid fibrils associated with neurodegenerative diseases can be considered biologically relevant failures of
cellular quality control mechanisms. It is known that in vivo human Tau protein, human prion protein, and human copper,
zinc superoxide dismutase (SOD1) have the tendency to form fibril deposits in a variety of tissues and they are associated
with different neurodegenerative diseases, while rabbit prion protein and hen egg white lysozyme do not readily form fibrils
and are unlikely to cause neurodegenerative diseases. In this study, we have investigated the contrasting effect of
macromolecular crowding on fibril formation of different proteins.
Methodology/Principal Findings: As revealed by assays based on thioflavin T binding and turbidity, human Tau fragments,
when phosphorylated by glycogen synthase kinase-3b, do not form filaments in the absence of a crowding agent but do
form fibrils in the presence of a crowding agent, and the presence of a strong crowding agent dramatically promotes
amyloid fibril formation of human prion protein and its two pathogenic mutants E196K and D178N. Such an enhancing
effect of macromolecular crowding on fibril formation is also observed for a pathological human SOD1 mutant A4V. On the
other hand, rabbit prion protein and hen lysozyme do not form amyloid fibrils when a crowding agent at 300 g/l is used but
do form fibrils in the absence of a crowding agent. Furthermore, aggregation of these two proteins is remarkably inhibited
by Ficoll 70 and dextran 70 at 200 g/l.
Conclusions/Significance: We suggest that proteins associated with neurodegenerative diseases are more likely to form
amyloid fibrils under crowded conditions than in dilute solutions. By contrast, some of the proteins that are not
neurodegenerative disease-associated are unlikely to misfold in crowded physiological environments. A possible
explanation for the contrasting effect of macromolecular crowding on these two sets of proteins (amyloidogenic proteins
and non-amyloidogenic proteins) has been proposed.
Citation: Ma Q, Fan J-B, Zhou Z, Zhou B-R, Meng S-R, et al. (2012) The Contrasting Effect of Macromolecular Crowding on Amyloid Fibril Formation. PLoS ONE 7(4):
e36288. doi:10.1371/journal.pone.0036288
Editor: Ilia V. Baskakov, University of Maryland, United States of America
Received January 6, 2012; Accepted March 29, 2012; Published April 30, 2012
Copyright: ? 2012 Ma et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study was supported by National Key Basic Research Foundation of China (http://www.most.gov.cn/, Grant no. 2012CB911003, to YL), National
Natural Science Foundation of China (http://www.nsfc.gov.cn/, grant nos. 30970599 and 31170744, to YL), and Fundamental Research Funds for the Central
Universities of China (http://www.moe.edu.cn/, grant no. 1104006, to YL). The funders had no role in study design, data collection and analysis, decision to
publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: liangyi@whu.edu.cn
. These authors contributed equally to this work.
Introduction
Amyloid fibril formation has been traditionally and widely
investigated in dilute solutions [1–4]. However, the inside of a cell
is poorly modeled by such dilute solutions and biochemical
reactions within cells including fibril formation differ greatly from
those in dilute solutions [5–15]. One of the differences is that most
biological fluids contain a high total concentration of macromol-
ecules, termed macromolecular crowding or crowded physiolog-
ical environments [6–8].
Amyloid fibrils associated with neurodegenerative diseases such
as Alzheimer disease, prion disease, and amyotrophic lateral
sclerosis (ALS) [1,16–18] can be considered biologically relevant
failures of cellular quality control mechanisms including molecular
chaperones, proteolysis, autophagy, and proteasomes [19,20].
Human Tau protein forms filaments in the brains of patients with
Alzheimer disease [17], and glycogen synthase kinase-3b (GSK-
3b) phosphorylation plays an important role in Alzheimer disease
[11]. It is known that in vivo human Tau protein [17,20], human
prion protein (PrP) and its pathogenic mutants [16,21,22], and
human copper, zinc superoxide dismutase (SOD1) pathogenic
mutants [18,23,24] have the tendency to form fibril deposits in a
variety of tissues and they are associated with Alzheimer disease,
prion disease, and ALS, respectively, while the rabbit PrP
[13,25,26] and hen egg white lysozyme [27] do not readily form
fibrils and are unlikely to cause neurodegenerative diseases.
Furthermore, misfolded Tau protein accumulating in Alzheimer
disease and misfolded SOD1 accumulating in ALS can cause
aggregation of their native counterparts in crowded physiological
environments through a mechanism similar to the infectious prion
protein PrPSccausing aggregation of its cellular isoform PrPC
[18,20].
In this study, we want to know the role of crowded physiological
environments in amyloid fibril formation. We investigated the
PLoS ONE | www.plosone.org1April 2012 | Volume 7 | Issue 4 | e36288

Page 2

contrasting effect of macromolecular crowding on fibril formation
of amyloidogenic proteins, such as GSK-3b phosphorylated
human Tau protein, human PrP and its pathogenic mutants
E196K and D178N, and pathological human SOD1 mutant A4V,
and non-amyloidogenic proteins, such as the rabbit PrP and hen
egg white lysozyme, by using thioflavin T (ThT) binding and
turbidity assays. We demonstrated that macromolecular crowding
dramatically promoted fibril formation of these amyloidogenic
proteins but remarkably inhibited aggregation of the two non-
amyloidogenic proteins. Our results suggest that proteins associ-
ated with neurodegenerative diseases are more likely to form
amyloid fibrils in crowded physiological environments than in
dilute solutions but some non-amyloidogenic proteins are unlikely
to aggregate and to form amyloid fibrils in crowded physiological
environments.
Materials and Methods
Ethics statement
All research involving original human work was approved by
the Institutional Review Board of the College of Life Sciences,
Wuhan University (Wuhan, China), leaded by Dr. Hong-Bing
Shu, the Dean of the college, in accordance with the guidelines for
the protection of human subjects. Written informed consent for
the original human work that produced the plasmid samples was
obtained.
Materials
The crowding agents, Ficoll 70, Ficoll 400, dextran 70,
polyethylene glycol (PEG) 2000, and PEG 20000 were purchased
fromSigma-Aldrich(St.Louis,
MW=6 kDa) and ThT were also obtained from Sigma-Aldrich.
Dithiothreitol (DTT), urea, and Sarkosyl were purchased from
Amresco (Solon, OH). Guanidine hydrochloride (GdnHCl) was
obtained from Promega (Madison, WI). All other chemicals used
were made in China and were of analytical grade.
MO). Heparin(average
Plasmids and proteins
The cDNA encoding human Tau fragments Tau244–372and
Tau244–441were amplified using the plasmid for human Tau40
(kindly provided by Dr. Michel Goedert) as a template. The PCR-
amplified fragments were subcloned into pRK172 vector.
Recombinant Tau244–372 and Tau244–441 were expressed in
Escherichia coli and purified to homogeneity by SP-Sepharose
chromatography as described [2,28]. Purified Tau protein was
analyzed by SDS-PAGE with one band and confirmed by mass
spectrometry. The concentrations of human Tau fragments were
determined according to their absorbance at 214 nm with a
standard curve drawn by bovine serum albumin. His-tagged GSK-
3b cDNA was amplified using human GSK-3b plasmid (kindly
provided by Dr. Thilo Hagen) as a template. Recombinant GSK-
3b was expressed in Escherichia coli and purified to homogeneity by
Ni-NTA-Sepharose and SP-Sepharose chromatography sequen-
tially as described [11].
The human/rabbit PrP cDNA was subcloned into pET30a
vector. Single mutants of human PrP were generated using
primers ACAACCACCAAGGGGAAGAACTTCA CCGAG/
CTCGGTGAAGTTCTTCCCCTTGGTGGTTGT for E196K
andAACAACTTTGTGCACAACTGCGTCAATATCAC/
GTGATATTGACGCAGTTGTGCACAAAGTTGTT
D178N. Recombinant full-length human/rabbit prion proteins
and two pathogenic human PrP mutants E196K and D178N were
expressed in Escherichia coli, isolated on a Ni-Sepharose column,
and further purified by HPLC on a C4 reversed-phase column
for
(Shimadzu, Kyoto, Japan) as described by Bocharova and co-
workers [29]. Purified human/rabbit prion proteins were
confirmed by SDS-PAGE and mass spectrometry to be single
species with an intact disulfide bond. The concentrations of the
rabbit PrP and human PrP were determined by their absorbance
at 280 nm using the molar extinction coefficient values of 57,995
and 57,995 M21cm21, respectively, deduced from the composi-
tion of the proteins online.
Human SOD1 mutant A4V was generated from wild-type
human SOD1 which cloned in pET3d vector (kindly provided by
Dr. Thomas O’Halloran) using primers CTTCAGCACGCA-
CACGACCTTCGTGGCCATGG/CCATGGCCAC-
GAAGGTCG TGTGCGTGCTGAAG. Such a pathological
mutant was expressed in Escherichia coli and purified to homoge-
neity by Q-Sepharose chromatography as described [30]. Purified
human SOD1 was analyzed by SDS-PAGE with one band. The
demetallated (apo) SOD1 was prepared according to previously
published protocols [31]. The concentration of human SOD1 was
determined according to its absorbance at 280 nm using the molar
extinction coefficient value of 10,800 M21cm21/dimer [31]. Hen
egg white lysozyme was obtained from Sigma-Aldrich and was
used without further purification. The A1%1 cmvalue of 26.5 at
280 nm [32] was used for protein concentration measurements.
Phosphorylation of Tau244–441
Recombinant Tau244–441(0.5 mg/ml) was phosphorylated by
GSK-3b (20 mg/ml) in the phosphorylation solution containing
2 mM ATP, 8 mM MgCl2, 5 mM EGTA, 1 mM phenylmethyl-
sulfonyl fluoride, 2 mM DTT, and 60 mM HEPES (pH 7.4) at
37uC for 20 h and terminated by heating the reaction solutions at
95uC for 5 min. The cooled phosphorylated Tau244–441 was
centrifuged at 10,000 g for 10 min to remove protein aggregates
and the protein was concentrated and stored at 220uC [11].
Thioflavin T binding assays
A 2.5 mM ThT stock solution was freshly prepared in 10 mM
Tris-HCl buffer (pH 7.5) for human Tau and prepared in
phosphate-bufferedsaline solution
2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, adjusted to
pH 7.0) for prion proteins and human SOD1, and passed through
a 0.22-mm pore size filter before use to remove insoluble particles.
The method for fibrillization of Tau fragments was similar to the
method described by the Mandelkow lab [33] with minor changes
[11]. 12 mM Tau244–372and GSK-3b phosphorylated Tau244–441
were incubated in 10 mM Tris-HCl buffer (pH 7.5) containing
1 mM DTT and 20 mM ThT with or without a crowding agent at
37uC for up to 2 h in the presence of heparin. The method for
fibrillization of SOD1 was similar to the method described by the
Valentine lab [30] with minor changes. 50 mM apo-SOD1 mutant
was incubated at in 37uC in 10 mM NaH2PO4-Na2HPO4buffer
(pH 7.4) containing 1 mM DTT in the absence and presence of
crowding agents with continuous shaking at 220 rpm, and samples
(50 ml) were diluted into NaH2PO4-Na2HPO4buffer containing
62.5 mM ThT, giving a final volume of 500 ml. The fluorescence of
ThT was excited at 440 nm with a slit-width of 7.5 nm and the
emission was measured at 480 nm with a slit-width of 7.5 nm on
an LS-55 luminescence spectrometer (PerkinElmer Life Sciences,
Shelton, CT).
The methods for fibrillization of prion proteins were similar to
the methods described by the Baskakov lab [29,34] with minor
changes. A stock solution of the human/rabbit PrPs in 6 M
GdnHCl was diluted to a final concentration of 10 mM and
incubated at 37uC in PBS buffer (pH 7.0) containing 2 M
GdnHCl for prion proteins and in PBS buffer containing 1 M
(PBS,140 mMNaCl,
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org2April 2012 | Volume 7 | Issue 4 | e36288

Page 3

GdnHCl and 3 M urea for the rabbit PrP in the absence and
presence of crowding agents with continuous shaking at 220 rpm,
and samples (50 ml) were diluted into PBS buffer containing
12.5 mM ThT, giving a final volume of 2.5 ml. The fluorescence
of ThT was excited at 450 nm with a slit-width of 5/7.5 nm and
the emission was measured at 480 nm with a slit-width of 5/
7.5 nm for human/rabbit PrPs on an LS-55 luminescence
spectrometer.
The method for aggregation of hen lysozyme was similar to the
method described by the Dobson lab [35] with minor changes.
Hen lysozyme was denatured in HCl solution (pH 2.0) containing
100 mM NaCl and 0.2% NaN3 at 37uC for 3–5 days. The
lysozyme solution was then mixed with stock solutions of crowding
agents, to yield a solution of 350 mM lysozyme in HCl (pH 2.0)
containing a chosen concentration of a crowding agent, followed
by incubated at 37uC for 14 days with continuous shaking at
220 rpm. Samples (10 ml) were diluted into 10 mM NaH2PO4-
Na2HPO4buffer (pH 7.0) containing 100 mM NaCl and 65 mM
ThT, giving a final volume of 3 ml. The fluorescence of ThT was
excited at 440 nm with a slit-width of 10 nm and the emission was
measured at 482 nm with a slit-width of 5 nm on an LS-55
luminescence spectrometer.
Control experiments were performed to ensure that the
crowding agents had no influence on the above ThT binding
assays.
Turbidity assays
12 mM Tau fragments (Tau244–372and GSK-3b phosphorylated
Tau244–441) were incubated without agitation in 10 mM Tris-HCl
buffer (pH 7.5) containing 3 mM heparin and 1 mM DTT at 37uC
and the solutions were placed into 1-cm path length acryl cuvettes
followed by monitoring the turbidity at 400 nm using a UV-2550
Probe spectrophotometer (Shimadzu, Kyoto, Japan). The prepa-
ration of the samples before the first measurement took 1 min.
Aggregation of 350 mM hen egg white lysozyme was carried out
as stated above, during the incubation time, 500 ml samples were
taken out and placed into 1-cm path length acryl cuvettes followed
by monitoring the turbidity at 400 nm using a UV-2550 Probe
spectrophotometer.
All kinetic experiments were repeated three times. The
experiments were pretty reproducible. Every time crowding agents
enhanced fibril formation of the three amyloidogenic proteins
(human Tau fragments, the human PrP, and human SOD1) and
inhibited aggregation of the rabbit PrP and hen egg white
lysozyme, although the ThT fluorescence intensities (or the
turbidity at 400 nm) were slightly different in different batches.
Kinetic model
Kinetic parameters were determined by fitting ThT fluores-
cence intensity versus time to the empirical Hill equation [4,11]:
F t ð Þ~F ?
ðÞ
t=t50
ð
ðÞn
1z t=t50
Þn
ð1Þ
where F(‘) is the fluorescence intensity in the long time limit, t50is
the elapsed time at which F is equal to one-half of F(‘), and n is a
cooperativity parameter.
Sarkosyl-soluble SDS-PAGE
Amyloid formation of 20 mM human/rabbit PrPs and patho-
logical human PrP mutants E196K and D178N was carried out as
stated above, during the incubation time, 200 ml samples were
taken out and dialyzed against 20 mM sodium acetate buffer
(pH 5.0) to remove GdnHCl. Then 25 ml samples were taken out
and added with 2.5 ml of 100 mM Tris-HCl (pH 7.0) and 2.5 ml of
20% Sarkosyl. The mixture was left at room temperature for
30 min and then centrifugated at 17,000 g for 30 min with an
Eppendorf 5810R centrifuge (Eppendorf AG, Hamburg, Ger-
many). The supernatant was taken out and mixed with 26loading
buffer and separated by 13.5% SDS-PAGE. Gel was stained by
Coomassie Blue R250.
Sarkosyl-insoluble SDS-PAGE
Fibrillization of 50 mM apo-SOD1 mutant A4V was carried out
as stated above, during the incubation time, 50 ml samples were
taken out and added into 50 ml of 10 mM NaH2PO4-Na2HPO4
buffer (pH 7.4) containing 10% Sarkosyl. Aggregation of 350 mM
hen egg white lysozyme was carried out as stated above, during the
incubation time, 50 ml samples were taken out and added into
70 ml of 10 mM NaH2PO4-Na2HPO4buffer (pH 7.0) containing
10% Sarkosyl. The mixtures were left at room temperature for
30 min and then centrifugated on a CS150GXL micro ultracen-
trifuge (Hitachi, Tokyo, Japan) at 150,000 g for 30 min. The
supernatant (Sarkosyl-soluble SOD1/lysozyme) was removed, and
the pellet (Sarkosyl-insoluble SOD1/lysozyme) was re-suspended
in 26 loading buffer and subjected to 13.5% SDS-PAGE. After
the electrophoresis the gels were stained with Coomassie Blue
R250.
Transmission electron microscopy
The formation of fibrils by human Tau fragments, by the
human/rabbit PrPs, by human SOD1, and by hen egg white
lysozyme was confirmed by electron microscopy of negatively
stained samples. The incubation time was chosen within a time
range of the plateau of each kinetic curve of ThT fluorescence.
Sample aliquots of 10 ml were placed on carbon-coated copper
grids, and left at room temperature for 1–2 min, rinsed with H2O
twice, and then stained with 2% (w/v) uranyl acetate for another
1–2 min. The stained samples were examined using an H-8100 (or
an H-7000 FA) transmission electron microscope (Hitachi, Tokyo,
Japan) operating at 100 kV or an FEI Tecnai G2 20 transmission
electron microscope (Hillsboro, OR) operating at 200 kV.
Results
Macromolecular crowding enhances fibril formation of
amyloidogenic proteins
Ficoll 70, Ficoll 400, and dextran 70 are widely accepted as
perfect models for the principal crowding components in living
cells where the folding and misfolding of proteins take place,
because their interactions with proteins can be described using
pure excluded-volume models [7,13]. By contrast, PEG is another
kind of crowding agent, whose interactions with proteins cannot be
described quantitatively in terms of excluded volume alone [7]. In
this study, the effects of three macromolecular crowding agents,
Ficoll 70, dextran 70, and PEG 2000, on human Tau filament
formation were examined by ThT binding and turbidity assays
(Fig. 1), as a function of crowder concentration. Three human Tau
fragments, non-phosphorylated Tau244–372and Tau244–441, and
Tau244–441phosphorylated by GSK-3b, were employed. Effects of
added crowding agents on the rate of fibril formation of Tau244–372
were monitored via measurement of the time-dependent ThT
fluorescence (Fig. 1A and 1B) and turbidity (Fig. 1C and 1D). Both
measurements indicated that the addition of crowding agents
dramatically accelerated fibrillization of human Tau fragments
Tau244–372.
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org3April 2012 | Volume 7 | Issue 4 | e36288

Page 4

For most protein aggregation systems, increasing concentration
of the protein results in increased rates of aggregation. Typical
data for protein concentration-dependent ThT fluorescence of
Tau244–372are shown in Figure 1E and 1F. As shown in Figure 1E
and 1F, there was no observed increase of ThT fluorescence up to
1 h when Tau244–372is 1 mM, and by increasing the concentration
of Tau244–372up to 4 mM, both the rates of filament formation and
the maximum intensity of the ThT fluorescence increased. But the
presence of 100 g/l PEG 2000 promoted the process even at
1 mM, and enhanced both the overall rates of the reaction and the
maximum intensity of ThT fluorescence.
SDS-PAGE profiles of Tau244–441and Tau244–441phosphory-
lated by GSK-3b are shown in Figure 2E. Nonphosphorylated
Tau244–441(lane 2) migrated as a single band, and phosphorylated
Tau244–441(lane 3) migrated slower. As revealed by assays based
on ThT binding (Figure 2A and 2B) and turbidity (Figure 2C and
2D), human Tau fragment Tau244–441, when phosphorylated by
GSK-3b, did not form filaments in the absence of a crowding
agent but did form fibrils in the presence of a crowding agent
(Ficoll 70 or dextran 70). The above results suggest a compensa-
tion mechanism of macromolecular crowding to the lost capability
of fibril formation caused by the phosphorylation of Tau and
Figure 1. Macromolecular crowding enhances Tau244–372fibrillization. Filament formation of human Tau fragment Tau244–372in the absence
and in the presence of Ficoll 70 (A) and dextran 70 (B) respectively, monitored by ThT fluorescence. The crowding agent concentrations were 0 (a),
50 g/l (b), 100 g/l (c), and 200 g/l (d), respectively. Filament formation of Tau244–372in the absence and in the presence of Ficoll 70 (C) and dextran 70
(D) respectively, monitored by turbidity. The crowding agent concentrations were 0 (open square), 50 g/l (solid circle), 100 g/l (solid triangle), and
200 g/l (inverted solid triangle), respectively. The empirical Hill equation was fitted to the data and the solid lines represented the best fit. The final
concentration of human Tau fragment was 12 mM. E and F: filament formation of Tau244–372at different concentrations in absence (a, c, and d) and in
the presence of 100 g/l PEG 2000 (b, e, and f), represented by ThT fluorescence intensity at plateau. The data with error bars are expressed as the
mean 6 S.D. (n=3). The assays were carried out at 37uC.
doi:10.1371/journal.pone.0036288.g001
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org4 April 2012 | Volume 7 | Issue 4 | e36288

Page 5

phosphorylated Tau associated with Alzheimer disease is more
likely to form amyloid fibrils under crowded conditions than in
dilute solutions. An alternative explanation for the above results is
that macromolecular crowding is accelerating a process that by
phosphorylation might have been retarded.
Human familial prion diseases are associated with about
40 point mutations of the gene coding for the prion protein
[16,22,36]. We then investigated the effects of macromolecular
crowding on fibril formation of the human PrP and its pathogenic
mutants E196K and D178N. As shown in Figure 3A and
Figure 4A and 4C, the presence of Ficoll 70 at concentrations of
100–200 g/l in the reaction systems significantly accelerated
amyloid formation of the human PrP and its pathogenic mutants
E196K and D178N on the investigated time scale. Similarly, the
presence of Ficoll 400 at 50–150 g/l in the reaction systems also
significantly accelerated fibril formation of the human PrP and its
pathogenic mutants on the investigated time scale (Fig. 3B and
Fig. 4B and 4D). Furthermore, the enhancing effect of Ficoll 400
on fibril formation of the human PrP and its pathogenic mutants
was stronger than that of Ficoll 70 (Figs. 3 and 4). Clearly, the
presence of a strong crowding agent dramatically promoted
amyloid fibril formation of human prion protein and its two
pathogenic mutants E196K and D178N (Figs. 3 and 4).
Figure 2. Macromolecular crowding enhances GSK-3b phosphorylated Tau244–441 fibrillization. Filament formation of GSK-3b
phosphorylated Tau244–441in the absence and in the presence of Ficoll 70 (A and C) and dextran 70 (B and D), respectively, monitored by ThT
fluorescence (A and B) and turbidity (C and D). The crowding agent concentrations were 0 (open square), 100 g/l (solid circle), 200 g/l (solid triangle),
and 300 g/l (inverted solid triangle), respectively. The empirical Hill equation was fitted to the data and the solid lines represented the best fit. The
final concentration of human Tau fragment was 12 mM. The assays were carried out at 37uC. (E) SDS-PAGE profiles of non-phosphorylated and GSK-3b
phosphorylated Tau244–441fragments. Lane 1, molecular weight SDS calibration kit protein standards. Lane 2 represents non-phosphorylated Tau244–
441and lane 3 represents GSK-3b phosphorylated Tau244–441. Proteins in the gel were visualized by a Coomassie Brilliant Blue R staining.
doi:10.1371/journal.pone.0036288.g002
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org5April 2012 | Volume 7 | Issue 4 | e36288

Page 6

Pathological human SOD1 mutant A4V is the most common
familial ALS mutation in North America and has a particularly
short disease duration [37]. We finally investigated the effects of
macromolecular crowding on fibril formation of such a pathogenic
mutant. As shown in Figure 5A and 5B, the presence of dextran 70
or PEG 20000 at concentrations of 100–200 g/l in the reaction
systems significantly accelerated fibril formation of A4V on the
investigated time scale. Furthermore, the enhancing effect of PEG
Figure 3. Macromolecular crowding enhances amyloid fibril formation of human prion protein. Fibril formation of human prion protein
in the absence and in the presence of Ficoll 70 (A) and Ficoll 400 (B), respectively, monitored by ThT fluorescence. The empirical Hill equation was
fitted to the data and the solid lines represented the best fit. The final concentration of human PrP was 10 mM. The crowding agent concentrations
were 0 (open square), 50 g/l (solid square), 100 g/l (solid circle), 150 g/l (solid triangle), and 200 g/l (inverted solid triangle), respectively. The human
PrP was denatured in PBS buffer (pH 7.0) containing 2 M GdnHCl. The assays were carried out at 37uC.
doi:10.1371/journal.pone.0036288.g003
Figure 4. Macromolecular crowding enhances amyloid fibril formation of pathological human prion protein mutants. Fibril formation
of pathogenic mutant E196K in the absence and in the presence of Ficoll 70 (A) and Ficoll 400 (B), respectively, and another pathogenic mutant
D178N in the absence and in the presence of Ficoll 70 (C) and Ficoll 400 (D), respectively, monitored by ThT fluorescence. The empirical Hill equation
was fitted to the data and the solid lines represented the best fit. The final concentrations of human PrP mutants were 10 mM. The crowding agent
concentrations were 0 (open square), 50 g/l (solid square), 100 g/l (solid circle), 150 g/l (solid triangle), and 200 g/l (inverted solid triangle),
respectively. The assays were carried out at 37uC.
doi:10.1371/journal.pone.0036288.g004
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org6 April 2012 | Volume 7 | Issue 4 | e36288

Page 7

20000 on fibril formation of the SOD1 mutant was stronger than
that of dextran 70 (Fig. 5). Clearly, an enhancing effect of
macromolecular crowding on fibril formation is also observed for a
pathological human SOD1 mutant A4V (Fig. 5).
Macromolecular crowding inhibits aggregation of some
non-amyloidogenic proteins
For the rabbit PrP, time dependence of ThT fluorescence as a
function of crowder concentration is shown in Figures 6 and S1.
Effects of crowding agents on amyloid fibril formation of the rabbit
PrP denatured in PBS buffer containing 1 M GdnHCl and 3 M
urea (or denatured in PBS buffer containing 2 M GdnHCl, the
same conditions as those of the human PrP) depended on the
concentrations of the crowding agents. As shown in Figures 6 and
S1A–C, the rabbit PrP did not form amyloid fibrils when a
crowding agent (Ficoll 70, dextran 70 or PEG 2000) at 300 g/l is
used but did form fibrils in the absence of a crowding agent.
Furthermore, aggregation of the rabbit PrP was remarkably
inhibited by Ficoll 70, dextran 70 and PEG 2000 at 200 g/l on the
investigated time scale, accompanied by a remarkable decline of
the maximum ThT intensity (Fig. 6D), while the presence of any of
the three crowding agents at 100 g/l promoted aggregation of the
rabbit PrP denatured by 1 M GdnHCl and 3 M urea to some
extent (Fig. 6) or inhibited aggregation of the rabbit PrP denatured
by 2 M GdnHCl (Fig. S1). In addition, the inhibitory effect of
dextran 70 on aggregation of the rabbit PrP was stronger than that
of Ficoll 70 (Fig. 6A and 6B).
We then investigated the effects of macromolecular crowding on
amyloid formation of hen egg white lysozyme, another non-
amyloidogenic protein. For hen lysozyme, time dependence of
ThT fluorescence as a function of crowder concentration is shown
in Figure 7. As shown in Figure 7A and 7B, hen lysozyme almost
did not form amyloid fibrils when a crowding agent (Ficoll 70 or
dextran 70) at 300 g/l is used but did form fibrils in the absence of
a crowding agent. Furthermore, aggregation of hen lysozyme was
markedly inhibited by Ficoll 70 and dextran 70 at 200 g/l on the
investigated time scale, accompanied by a decline of the maximum
ThT intensity, while the presence of 100 g/l dextran 70 almost did
not inhibit aggregation of hen lysozyme (Fig. 7). Time-dependent
turbidity of hen lysozyme as a function of crowder concentration is
shown in Figure S2. As shown in Figure S2, hen lysozyme almost
did not form aggregates when 300 g/l Ficoll 70 is used but did
form aggregates in the absence of a crowding agent, further
supporting the conclusion reached by ThT binding assays that
macromolecular crowding remarkably inhibits aggregation of hen
lysozyme.
The amount of protein fibrils/monomers present in the
solution measured by centrifugation assays
ThT fluorescence is not perfectly specific for amyloid fibrils and,
depending on the particular protein and experimental conditions,
assays may render both false positive (spectroscopic change upon
binding to non-fibrillar material) and false negative results (its
fluorescence not being affected by some amyloid fibrils).
Considering this, we investigated the correlation between the
spectroscopic signal monitored and the amount of protein fibrils/
monomers present in the solution measured by centrifugation
assays. In order to semi-quantify the decrease/increase of
monomeric proteins in the presence of crowding agents, we
carried out Sarkosyl-soluble SDS-PAGE experiments after centri-
fugation assays. As shown in Figure 8A and 8B, a clear band
corresponding to Sarkosyl-soluble human PrP monomers was
observed when the human PrP was incubated in the absence of a
crowding agent for 8 h, while the human PrP monomer band was
observed when the human PrP was incubated with 150 g/l Ficoll
70 for a remarkably shorter time (2–4 h). As shown in Figure 9A–
D, a clear band corresponding to Sarkosyl-soluble human PrP
monomers was observed when pathological human PrP mutants
E196K and D178N were incubated in the absence of a crowding
agent for around 7 h, while the human PrP monomer band was
observed when E196K and D178N were incubated with 150 g/l
Ficoll 70 for a much shorter time (2–3 h for E196K and 1–2 h for
D178N). As shown in Figure 8C and 8D, a clear band
corresponding to Sarkosyl-soluble rabbit PrP monomers was
observed when the rabbit protein was incubated with 100 g/l
Ficoll 70 for 3 h, while the rabbit PrP monomer band was
observed when the rabbit protein was incubated in the absence of
a crowding agent for a shorter time (2 h). The above results
indicate that while crowding agents dramatically promote fibril
formation of human PrP and its two pathogenic mutants E196K
and D178N, they inhibit aggregation of the rabbit PrP by
stabilizing its native state.
Figure 5. Macromolecular crowding enhances fibril formation of pathological human SOD1 mutant. Fibril formation of pathogenic
mutant A4V in the absence and in the presence of dextran 70 (A) and PEG 20000 (B), respectively, monitored by ThT fluorescence. The empirical Hill
equation was fitted to the data and the solid lines represented the best fit. The final concentration of human SOD1 mutant was 50 mM. The crowding
agent concentrations were 0 (open square), 100 g/l (solid circle), and 200 g/l (solid triangle), respectively. The assays were carried out at 37uC.
doi:10.1371/journal.pone.0036288.g005
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org7 April 2012 | Volume 7 | Issue 4 | e36288

Page 8

Figure 6. Macromolecular crowding inhibits aggregation formation of rabbit prion protein. Aggregation of rabbit prion protein in the
absence and in the presence of Ficoll 70 (A), dextran 70 (B), and PEG 2000 (C), respectively, monitored by ThT fluorescence. The empirical Hill
equation was fitted to the data and the solid lines represented the best fit. The final concentration of rabbit PrP was 10 mM. The crowding agent
concentrations were 0 (open square), 100 g/l (solid circle), 200 g/l (solid triangle), and 300 g/l (inverted solid triangle), respectively. (D) Effects of
macromolecular crowding on ThT fluorescence intensity of rabbit PrP fibrils at plateau in absence and in the presence of Ficoll 70, dextran 70 or PEG
2000. The crowding agent concentrations were 0 (the first column), 100 g/l (the second column), 200 g/l (the third column), and 300 g/l (the fourth
column), respectively. The data with error bars are expressed as the mean 6 S.D. (n=3). The rabbit PrP was denatured in PBS buffer (pH 7.0)
containing 1 M GdnHCl and 3 M urea. The assays were carried out at 37uC.
doi:10.1371/journal.pone.0036288.g006
Figure 7. Macromolecular crowding inhibits aggregation formation of hen egg white lysozyme. Aggregation of hen egg white lysozyme
in the absence and in the presence of Ficoll 70 (A) and dextran 70 (B), respectively, monitored by ThT fluorescence. The empirical Hill equation was
fitted to the data and the solid lines represented the best fit. The final concentration of hen lysozyme was 350 mM. The crowding agent
concentrations were 0 (open square), 100 g/l (solid circle), 200 g/l (solid triangle), and 300 g/l (inverted solid triangle), respectively. The assays were
carried out at 37uC.
doi:10.1371/journal.pone.0036288.g007
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org8 April 2012 | Volume 7 | Issue 4 | e36288

Page 9

In order to semi-quantify the increase/decrease of protein fibrils
in the presence of crowding agents, we carried out Sarkosyl-
insoluble SDS-PAGE experiments after centrifugation assays. As
shown in Figure 10A and 10B, a clear band corresponding to
Sarkosyl-insoluble SOD1 fibrils was observed when pathological
human SOD1 mutant A4V was incubated in the absence of a
crowding agent for 36 h, while the Sarkosyl-insoluble SOD1 band
was observed when A4V was incubated with 100 g/l dextran 70
for a much shorter time (12 h). Furthermore, when A4V was
incubated for 48 h, the intensity of the Sarkosyl-insoluble SOD1
band in the presence of 100 g/l dextran 70 was remarkably higher
than that in the absence of a crowding agent. As shown in
Figure 10C and 10D, a clear band corresponding to Sarkosyl-
insoluble lysozyme fibrils was observed when hen egg white
lysozyme was incubated without or with 200 g/l Ficoll 70 for
120 h. When hen lysozyme was incubated for 217/240/268/292/
314/336 h, the intensity of the Sarkosyl-insoluble lysozyme band
in the presence of 200 g/l Ficoll 70 was remarkably lower than
that in the absence of a crowding agent (Fig. 10C and 10D). The
above results indicate that while crowding agents significantly
promote fibril formation of pathological human SOD1 mutant
A4V, they inhibit aggregation of hen lysozyme by stabilizing its
native conformation.
Characterization of the morphology of protein
aggregates formed in the presence of crowding agents
TEM was employed to characterize the morphology of protein
aggregates formed in the absence and in the presence of crowding
agents. Figures 11, 12, 13, 14 and 15 show TEM images of Tau
fragment samples, human/rabbit PrP samples, pathological
human PrP mutant samples, pathological human SOD1 mutant
samples, and hen lysozyme samples incubated in the solution of a
crowding agent (Ficoll 70 or dextran 70). For non-phosphorylated
Tau244–372, the addition of 150 g/l Ficoll 70 had no significant
effect on the morphology of Tau samples, and long and branched
fibrils as well as straight filaments were observed in both samples
(Fig. 11A and 11B). In the presence of 300 g/l Ficoll 70, the
majority of GSK-3b phosphorylated Tau244–441was observed as
short amyloid fibrils (Fig. 11D), but no fibrils were observed for
phosphorylated Tau244–441in the absence of a crowder (Fig. 11C),
further supporting the conclusion reached by ThT binding and
turbidity assays that macromolecular crowding dramatically
promotes fibril formation of GSK-3b phosphorylated Tau244–441.
In absence of a crowding agent, the human PrP formed fibrils with
a length of 100–300 nm after incubation for 9 h (Fig. 12A). In the
presence of 150 g/l Ficoll 70, however, abundant short amyloid
fibrils and spherical or ellipsoidal particles were observed when
human PrP samples were incubated for 3 h (Fig. 12B). In absence
of a crowding agent, the fibrils formed by the rabbit PrP appear
long and twisted structure after incubation for 3 h (Fig. 12C). In
the presence of 200 g/l Ficoll 70, however, some short amyloid
fibrils and a few fibrils with a length of 100–300 nm were observed
when rabbit PrP samples were incubated for 3 h (Fig. 12D). The
amount of fibrils formed by the rabbit PrP in the presence of
Figure 8. Time-dependent SDS-PAGE analysis of Sarkosyl-soluble human prion protein (A and B) and rabbit prion protein (C and D)
incubated in 0 g/l (A and C), 150 g/l (B), and 100 g/l (D) Ficoll 70. Samples were taken and dialyzed against 20 mM sodium acetate buffer,
and incubated with 100 mM Tris-HCl buffer containing 2% Sarkosyl for 30 min. Then the samples were centrifugated at 17,000 g for 30 min and the
supernatants were mixed with 26loading buffer and separated by 13.5% SDS-PAGE. Gel was stained by Coomassie Blue R250. The human/rabbit
PrPs were denatured in PBS buffer (pH 7.0) containing 2 M GdnHCl.
doi:10.1371/journal.pone.0036288.g008
Figure 9. Time-dependent SDS-PAGE analysis of Sarkosyl-
soluble pathological human prion protein mutants E196K (A
and B) and D178N (C and D) incubated in 0 g/l (A and C) and
150 g/l (B and D) Ficoll 70. Samples were taken and dialyzed against
20 mM sodium acetate buffer, and incubated with 100 mM Tris-HCl
buffer containing 2% Sarkosyl for 30 min. Then the samples were
centrifugated at 17,000 g for 30 min and the supernatants were mixed
with 26 loading buffer and separated by 13.5% SDS-PAGE. Gel was
stained by Coomassie Blue R250.
doi:10.1371/journal.pone.0036288.g009
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org9April 2012 | Volume 7 | Issue 4 | e36288

Page 10

200 g/l Ficoll 70 (Fig. 12D) appears to be markedly less than that
in the absence of a crowding agent (Fig. 12C) on the same time
scale, further supporting the conclusion reached by ThT binding
assays that macromolecular crowding remarkably inhibits aggre-
gation of the rabbit PrP. The addition of 150 g/l Ficoll 70 had no
significant effect on the morphology of pathological human PrP
mutant E196K and D178N samples, and many fibrils with a
length of 100–300 nm were observed in these samples (Fig. 13A–
D). Similarly, the addition of 100 g/l dextran 70 had no significant
effect on the morphology of pathological human SOD1 mutant
A4V samples, and long and curved fibrils as well as non-fibrillar
material were observed in both samples (Fig. 14A and 14B). The
addition of 100 g/l Ficoll 70 had no significant effect on the
morphology of hen egg white lysozyme samples, and long and
bundled fibrils were observed in both samples (Fig. 15A and 15B).
In the presence of 200 g/l Ficoll 70, however, hen lysozyme
formed abundant fibrils with a length of 100–500 nm as well as
some short amyloid fibrils (Fig. 15C). Clearly, fibrils of different
proteins formed in the presence of the same crowder (for example,
Ficoll 70) were of different morphologies.
Discussion
Ficoll 70, Ficoll 400, and dextran 70 are widely used to mimic
the excluded-volume effects in crowded physiological environ-
ments [7,13]. Compared with dextran 70, Ficoll 70 behaves much
more like a rigid sphere with a radius around 55 A˚[10,38]. Ficoll
70 or Ficoll 400 is a highly branched copolymer of two short
building blocks, sucrose and epichlorohydrin, making it less
flexible and more compact than dextran 70 on a molecular weight
basis, and the molecular weight of Ficoll 400 is much larger than
that of Ficoll 70. In contrast, dextran 70, a flexible, long-chain poly
(D-glucose) with sparse, short branches, is not usually considered a
rod-like polymer like double-stranded DNA is and better modeled
as a rod-like particle [10,38]. In the present study, we found that
the enhancing effect of Ficoll 400 on fibril formation of the human
PrP was stronger than that of Ficoll 70 and the inhibitory effect of
dextran 70 on aggregation of the rabbit PrP was stronger than that
of Ficoll 70, supporting the conclusion that crowder size and shape
are important factors that modulate the net effect of macromo-
lecular crowding on proteins [38].
Our data indicate opposite effects of macromolecular crowding
on different proteins, and provide clues to the question of whether
the effects of macromolecular crowding on protein misfolding
obey a universal rule or must be understood on a case-by-case
basis.
The molecular details of protein misfolding are in general not
well understood, owing to the complexity and variability of
aggregation reactions and technical difficulties in characterizing
aggregates, due to their often heterogeneous and fibrillar nature
[39]. As mentioned above, amyloid fibrils associated with
neurodegenerative diseases can be considered biologically relevant
failures of cellular quality control mechanisms. It is known that in
vivo human Tau protein [17,20], the human PrP and its
pathogenic mutants [16,21,22,36], and human SOD1 pathogenic
Figure 10. Time-dependent SDS-PAGE analysis of Sarkosyl-insoluble pathological human SOD1 mutant A4V (A and B) and hen egg
white lysozyme (C and D) incubated in 0 g/l (A and C) and 100 g/l dextran 70 (B) or 200 g/l Ficoll 70 (D). Samples were taken and
incubated with 10 mM NaH2PO4-Na2HPO4buffer containing 10% Sarkosyl for 30 min followed by centrifuging at 150,000 g for 30 min. Pellets were
re-suspended with 26loading buffer and separated by 13.5% SDS-PAGE. Gel was stained by Coomassie Blue R250.
doi:10.1371/journal.pone.0036288.g010
Figure 11. Transmission electron micrographs of human Tau
fragment samples at physiological pH after incubation under
different conditions. Tau244–372(A and B) and GSK-3b phosphorylat-
ed Tau244–441(C and D) samples were incubated for 1 h (A and B) or 2 h
(C and D) in the absence of a crowding agent (A and C) and in the
presence of 150 g/l Ficoll 70 (B) or 300 g/l Ficoll 70 (D), respectively. A
2% (w/v) uranyl acetate solution was used to negatively stain the fibrils.
The scale bars represent 200 nm.
doi:10.1371/journal.pone.0036288.g011
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org 10April 2012 | Volume 7 | Issue 4 | e36288

Page 11

mutants [18,23,24] have the tendency to form fibril deposits in a
variety of tissues and thereby cause Alzheimer disease, prion
disease, and ALS, respectively, while the rabbit PrP [13,25,26] and
hen egg white lysozyme [27] do not readily form fibrils and are
unlikely to cause neurodegenerative diseases. In the present study,
we demonstrated that macromolecular crowding dramatically
promoted fibril formation of amyloidogenic proteins, such as
GSK-3b phosphorylated human Tau protein, the human PrP and
its pathogenic mutants E196K and D178N, and pathological
human SOD1 mutant A4V, but remarkably inhibited aggregation
of some non-amyloidogenic proteins, such as the rabbit PrP and
hen egg white lysozyme. Human Tau protein is a natively
unfolded protein [17,40] so that the most probable path to be
followed in the presence of crowders is the formation of compact
and stable fibrils as we demonstrate here. However, there are
many natively unfolded proteins (for example, histones and
transcription factors) that are known to be non-amyloidogenic.
Crowding agents have been shown to promote aggregation of
some of these proteins (for example, histones) [14] although not of
the others [15]. In the case of folded proteins, where the starting
materials are denatured proteins, a competition between folding
and aggregation is established. The human PrP is a stable folded
protein with a long, flexible N-terminal tail [41], and pathological
mutants E196K [42], D178N [43], and A4V [44] are all folded
proteins with reduced stability, so that macromolecular crowding
enhances aggregation of these not-particularly-stable proteins
more than folding. However, both the rabbit PrP and hen
lysozyme are exceptionally stable folded proteins so that
macromolecular crowding stabilizes their native conformations,
enhancing folding of these proteins more than aggregation. We
thus suggest a contrasting effect of macromolecular crowding on
amyloid fibril formation: proteins associated with neurodegener-
ative diseases are more likely to form amyloid fibrils under
crowded conditions than in dilute solutions; by contrast, some of
the proteins that are not neurodegenerative disease-associated are
unlikely to aggregate and to form amyloid fibrils in crowded
physiological environments. Therefore macromolecular crowding
could play an important role in the cellular quality control
mechanisms.
A possible explanation for the contrasting effect of macromo-
lecular crowding on these two sets of proteins (amyloidogenic
proteins and non-amyloidogenic proteins) has been proposed. The
Figure 12. Transmission electron micrographs of human/rabbit
PrP samples at physiological pH after incubation under
different conditions. Human (A and B) and rabbit (C and D) PrP
samples were incubated for 9 h (A) or 3 h (B, C, and D) in the absence of
a crowding agent (A and C) and in the presence of 150 g/l Ficoll 70 (B)
or 200 g/l Ficoll 70 (D), respectively. A 2% (w/v) uranyl acetate solution
was used to negatively stain the fibrils. The scale bars represent
200 nm. The human/rabbit PrPs were denatured in PBS buffer (pH 7.0)
containing 2 M GdnHCl.
doi:10.1371/journal.pone.0036288.g012
Figure 13. Transmission electron micrographs of pathological
human PrP mutant samples at physiological pH after incuba-
tion under different conditions. Pathogenic mutant E196K (A and
B) and D178N (C and D) samples were incubated for 8 h (A and C) or 2 h
(B and D) in the absence of a crowding agent (A and C) and in the
presence of 150 g/l Ficoll 70 (B and D), respectively. A 2% (w/v) uranyl
acetate solution was used to negatively stain the fibrils. The scale bars
represent 200 nm.
doi:10.1371/journal.pone.0036288.g013
Figure 14. Transmission electron micrographs of pathological
human SOD1 mutant samples at physiological pH after
incubation under different conditions. Pathogenic mutant A4V
samples were incubated for 108 h in the absence of a crowding agent
(A) and in the presence of 100 g/l dextran 70 (B), respectively. A 2% (w/
v) uranyl acetate solution was used to negatively stain the fibrils. The
scale bars represent 200 nm.
doi:10.1371/journal.pone.0036288.g014
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org 11April 2012 | Volume 7 | Issue 4 | e36288

Page 12

promotion of human Tau fragments, the human PrP and its
pathogenic mutants, and pathological human SOD1 mutant into
fibrils by macromolecular crowding is largely caused by the
stabilization of intermolecular dimers [7] and the enhancement of
the assembly of human Tau, human prion, and human SOD1
molecules by macromolecular crowding. The observations that
fibril formation of the rabbit PrP and hen lysozyme are
uninhibited remarkably at low crowder concentration and
suppressed at higher crowder concentration are interesting and
are possibly attributed to the competition between a conforma-
tional transition and an aggregation reaction along the lines of the
scheme proposed (Fig. 16). Crowder would be expected to increase
both kagg, the rate constant for aggregation, and Kfold, the
equilibrium constant for compaction to more folded state that
does not aggregate. What might be happening here is that crowder
initially increases kagg, and also increases Kfold, but not enough to
increase the equilibrium fraction of the folded state. As the amount
of crowder increases, kaggcontinues to increase, but at some point
the equilibrium between partially and fully folded monomer shifts
toward the fully folded state and then aggregation is disfavored
because even though the rate constant for aggregation is higher,
the concentration of unfolded monomer, which is the substrate for
aggregation is diminished.
Hen egg white lysozyme was used at a concentration of
350 mM, which is much higher than that of other proteins. Such
high concentration was used because of the following reasons.
Firstly, aggregation of hen lysozyme is concentration-dependent,
and increasing concentration of the enzyme could increase the rate
of aggregation and facilitate the following measurements,
considering it usually takes weeks to form amyloid fibrils from a
solution of hen lysozyme (1 mM) at pH 2.0 [35]. Secondly, the
concentration of hen lysozyme we used (5 g/l) is one order of
magnitude lower than that of a crowding agent (50–300 g/l),
which is not enough to create crowding effect on its own.
Misfolding or/and aggregation is an inevitable outcome of a
protein’s life [1,20]. For non-amyloidogenic proteins, the resulting
molecules are normally cleared by cellular quality control
mechanisms [19,20] in combination with the strong inhibition of
fibrillization of such proteins by the crowded physiological
environment, thereby not causing any neurodegenerative diseases.
Figure 15. Transmission electron micrographs of hen egg white
lysozyme samples at pH 2.0 after incubation under different
conditions. Hen lysozyme samples were incubated for 14 days in the
absence of a crowding agent (A) and in the presence of 100 g/l Ficoll 70
(B), or 200 g/l Ficoll 70 (C), respectively. A 2% (w/v) uranyl acetate
solution was used to negatively stain the fibrils. The scale bars represent
200 nm.
doi:10.1371/journal.pone.0036288.g015
Figure 16. Scheme describing the competition between a
conformational transition and an aggregation reaction of a
protein in the presence of a crowding agent.
doi:10.1371/journal.pone.0036288.g016
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org12April 2012 | Volume 7 | Issue 4 | e36288

Page 13

For amyloidogenic proteins, however, the combined effects of
accelerated production owing to elevated oxidative stress and
protein crowding and reduced ability of cells to degrade damaged
proteins increase protein aggregation [11,20]. Incomplete degra-
dation of aggregates can result in production of smaller fragments
that can serve as seeds for further aggregation, thereby increasing
aggregate burden and causing neurodegenerative diseases [11,20].
In brief, keeping balance is healthful, but losing balance causes
diseases.
The enhancing effect of macromolecular crowding on amyloi-
dogenic protein misfolding is a double-edged sword. On the one
hand, a crowded physiological environment could play an
exacerbating role in the pathogenesis of neurodegenerative
diseases by accelerating amyloidogenic protein misfolding and
inducing human prion fibril fragmentation which is considered to
be an essential step in prion replication [45]. On the other hand, it
has been reported that soluble oligomers and/or protofibrils
formed by amyloidogenic proteins are actually the pathogenic
species and that fibrils are innocuous (or less toxic/infectious) [46–
48], and thus a crowded physiological environment could play a
neuroprotective role in the onset and progression of neurodegen-
erative diseases by inducing the most toxic amyloidogenic protein
oligomers and/or protofibrils to form innocuous amyloid fibrils.
In conclusion we have shown that: (i) human Tau fragments,
when phosphorylated by GSK-3b, do not form filaments in the
absence of a crowding agent but do form fibrils in the presence of a
crowding agent (Ficoll 70 or dextran 70), and the presence of a
strong crowding agent dramatically promotes amyloid fibril
formation of the human PrP and its two pathogenic mutants
E196K and D178N; (ii) such an enhancing effect of macromolec-
ular crowding on fibril formation is also observed for a
pathological human SOD1 mutant A4V; (iii) the rabbit PrP and
hen egg white lysozyme do not form amyloid fibrils when a
crowding agent (Ficoll 70 or dextran 70) at 300 g/l is used but do
form fibrils in the absence of a crowding agent; (iv) aggregation of
these two proteins is remarkably inhibited by Ficoll 70 and dextran
70 at 200 g/l on the investigated time scale. Information obtained
from the present study can enhance our understanding of the
molecular mechanisms of neurodegenerative diseases such as
Alzheimer disease, prion disease, and ALS, and should lead to a
better understanding of how proteins misfold and how proteins
avoid misfolding in crowded physiological environments.
Supporting Information
Figure S1
fibril formation of rabbit prion protein. Amyloid formation
of rabbit prion protein in the absence and in the presence of Ficoll
70 (A), dextran 70 (B), and PEG 2000 (C), respectively, monitored
by ThT fluorescence. The empirical Hill equation was fitted to the
data and the solid lines represented the best fit. The final
concentration of rabbit PrP was 10 mM. The crowding agent
concentrations were 0 (open square), 100 g/l (solid circle), 200 g/l
(solid triangle), and 300 g/l (inverted solid triangle), respectively.
The rabbit PrP was denatured in PBS buffer (pH 7.0) containing
2 M GdnHCl. The assays were carried out at 37uC.
(DOC)
Macromolecular crowding inhibits amyloid
Figure S2
tion formation of hen egg white lysozyme. Aggregation of
hen egg white lysozyme in the absence and in the presence of
Ficoll 70, monitored by turbidity. The empirical Hill equation was
fitted to the data and the solid lines represented the best fit. The
final concentration of hen lysozyme was 350 mM. The crowding
agent concentrations were 0 (open square), 100 g/l (solid circle),
200 g/l (solid triangle), and 300 g/l (inverted solid triangle),
respectively. The assays were carried out at 37uC.
(DOC)
Macromolecular crowding inhibits aggrega-
Acknowledgments
We sincerely thank Prof. Allen P. Minton (National Institute of Diabetes
and Digestive and Kidney Diseases, National Institutes of Health) and Prof.
Huan-Xiang Zhou (Institute of Biophysics, Florida State University) for
their helpful suggestions. We thank Prof. Michel Goedert (Laboratory of
Molecular Biology, Medical Research Council) for his kind gift of the Tau
plasmids, Prof. Thilo Hagen (University of Nottingham) for his kind gift of
the GSK-3b plasmids, Prof. Geng-Fu Xiao (Wuhan Institute of Virology,
Chinese Academy of Sciences) for his kind gift of the human/rabbit PrPC
plasmids, and Prof. Thomas O’Halloran (Chemistry of Life Processes
Institute, Northwestern University) for his kind gift of the human SOD1
plasmids.
Author Contributions
Conceived and designed the experiments: YL. Performed the experiments:
QM J-BF ZZ B-RZ S-RM J-YH. Analyzed the data: QM J-BF ZZ YL.
Contributed reagents/materials/analysis tools: JC. Wrote the paper: QM
J-BF YL.
References
1.
2.
Dobson CM (2003) Protein folding and misfolding. Nature 426: 884–890.
Mo ZY, Zhu YZ, Zhu HL, Fan JB, Chen J, et al. (2009) Low micromolar zinc
accelerates the fibrillization of human Tau via bridging of Cys-291 and Cys-322.
J Biol Chem 284: 34648–34657.
Zhu HL, Ferna ´ndez C, Fan JB, Shewmaker F, Chen J, et al. (2010) Quantitative
characterization of heparin binding to Tau protein. Implication for inducer-
mediated Tau filament formation. J Biol Chem 285: 3592–3599.
Zhu HL, Meng SR, Fan JB, Chen J, Liang Y (2011) Fibrillization of human Tau
is accelerated by exposure to lead via interaction with His-330 and His-362.
PLoS One 6: e25020.
Minton AP (2006) How can biochemical reactions within cells differ from those
in test tubes? J Cell Sci 119: 2863–2869.
Ellis RJ (2001) Macromolecular crowding: an important but neglected aspect of
the intracellular environment. Curr Opin Struct Biol 11: 114–119.
Zhou HX, Rivas G, Minton AP (2008) Macromolecular crowding and
confinement: biochemical, biophysical, and potential physiological consequenc-
es. Annu Rev Biophys 37: 375–397.
Spitzer J (2011) From water and ions to crowded biomacromolecules: in vivo
structuring of a prokaryotic cell. Microbiol Mol Biol Rev 75: 491–506.
Zhou BR, Liang Y, Du F, Zhou Z, Chen J (2004) Mixed macromolecular
crowding accelerates the oxidative refolding of reduced, denatured lysozyme:
implications for protein folding in intracellular environments. J Biol Chem 279:
55109–55116.
3.
4.
5.
6.
7.
8.
9.
10. Du F, Zhou Z, Mo ZY, Shi JZ, Chen J, et al. (2006) Mixed macromolecular
crowding accelerates the refolding of rabbit muscle creatine kinase: implications
for protein folding in physiological environments. J Mol Biol 364: 469–482.
11. Zhou Z, Fan JB, Zhu HL, Shewmaker F, Yan X, et al. (2009) Crowded cell-like
environment accelerates the nucleation step of amyloidogenic protein misfold-
ing. J Biol Chem 284: 30148–30158.
12. Jiao M, Li HT, Chen J, Minton AP, Liang Y (2010) Attractive protein-polymer
interactions markedly alter the effect of macromolecular crowding on protein
association equilibria. Biophys J 99: 914–923.
13. Zhou Z, Yan X, Pan K, Chen J, Xie ZS, et al. (2011) Fibril formation of the
rabbit/human/bovine prion proteins. Biophys J 101: 1483–1492.
14. Munishkina LA, Ahmad A, Fink AL, Uversky VN (2008) Guiding protein
aggregation with macromolecular crowding. Biochemistry 47: 8993–9006.
15. Johansen D, Jeffries CM, Hammouda B, Trewhella J, Goldenberg DP (2011)
Effects of macromolecular crowding on an intrinsically disordered protein
characterized by small-angle neutron scattering with contrast matching.
Biophys J 100: 1120–1128.
16. Prusiner SB (1998) Prions. Proc Natl Acad Sci USA 95: 13363–13383.
17. Goedert M (1993) Tau protein and the neurofibrillary pathology of Alzheimer’s
disease. Trends Neurosci 16: 460–465.
18. Polymenidou M, Cleveland DW (2011) The seeds of neurodegeneration: prion-
like spreading in ALS. Cell 147: 498–508.
19. Wickner S, Maurizi MR, Gottesman S (1999) Posttranslational quality control:
folding, refolding, and degrading proteins. Science 286: 1888–1893.
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org13April 2012 | Volume 7 | Issue 4 | e36288

Page 14

20. Lee SJ, Desplats P, Sigurdson C, Tsigelny I, Masliah E (2010) Cell-to-cell
transmission of non-prion protein aggregates. Nat Rev Neurol 6: 702–706.
21. Soto C (2011) Prion hypothesis: the end of the controversy? Trends Biochem Sci
36: 151–158.
22. Capellari S, Strammiello R, Saverioni D, Kretzschmar H, Parchi P (2011)
Genetic Creutzfeldt-Jakob disease and fatal familial insomnia: insights into
phenotypic variability and disease pathogenesis. Acta Neuropathol 121: 21–37.
23. Wang Q, Johnson JL, Agar NYR, Agar JN (2008) Protein aggregation and
protein instability govern familial amyotrophic lateral sclerosis patient survival.
PLoS Biol 6: e170.
24. Ip P, Mulligan VK, Chakrabartty A (2011) ALS-causing SOD1 mutations
promote production of copper-deficient misfolded species. J Mol Biol 409:
839–852.
25. Vorberg I, Groschup MH, Pfaff E, Priola SA (2003) Multiple amino acid
residues within the rabbit prion protein inhibit formation of its abnormal
isoform. J Virol 77: 2003–2009.
26. Nisbet RM, Harrison CF, Lawson VA, Masters CL, Cappai R, et al. (2010)
Residues surrounding the glycosylphosphatidylinositol anchor attachment site of
PrP modulate prion infection: insight from the resistance of rabbits to prion
disease. J Virol 84: 6678–6686.
27. Swaminathan R, Ravi VK, Kumar S, Kumar MVS, Chandra N (2011)
Lysozyme: A model protein for amyloid research. Adv Protein Chem Struct Biol
84: 63–111.
28. Barghorn S, Biernat J, Mandelkow E (2005) Purification of recombinant Tau
protein and preparation of Alzheimer-paired helical filaments in vitro. Methods
Mol Biol 299: 35–51.
29. Bocharova OV, Breydo L, Parfenov AS, Salnikov VV, Baskakov IV (2005) In
vitro conversion of full-length mammalian prion protein produces amyloid form
with physical properties of PrPSc. J Mol Biol 346: 645–659.
30. Chattopadhyay M, Durazo A, Sohn SH, Strong CD, Gralla EB, et al. (2008)
Initiation and elongation in fibrillation of ALS-linked superoxide dismutase.
Proc Natl Acad Sci USA 105: 18663–18668.
31. Lyons TJ, Nersissian A, Goto JJ, Zhu H, Gralla EB, et al. (1998) Metal ion
reconstitution studies of yeast copper-zinc superoxide dismutase: the ‘‘phantom’’
subunit and the possible role of Lys7p. J Biol Inorg Chem 3: 650–662.
32. Arnaudov LN, de Vries R (2005) Thermally induced fibrillar aggregation of hen
egg white lysozyme. Biophys J 88: 515–526.
33. von Bergen M, Barghorn S, Mu ¨ller SA, Pickhardt M, Biernat J, et al. (2006) The
core of Tau-paired helical filaments studied by scanning transmission electron
microscopy and limited proteolysis. Biochemistry 45: 6446–6457.
34. Makarava N, Lee CI, Ostapchenko VG, Baskakov IV (2007) Highly
promiscuous nature of prion polymerization. J Biol Chem 282: 36704–36713.
35. Krebs MRH, Wilkins DK, Chung EW, Pitkeathly MC, Chamberlain AK, et al.
(2000) Formation and seeding of amyloid fibrils from wild-type hen lysozyme
and a peptide fragment from the b-domain. J Mol Biol 300: 541–549.
36. van der Kamp MW, Daggett V (2009) The consequences of pathogenic
mutations to the human prion protein. Protein Eng Des Sel 22: 461–468.
37. Stathopulos PB, Rumfeldt JA, Scholz GA, Irani RA, Frey HE, et al. (2003) Cu/
Zn superoxide dismutase mutants associated with amyotrophic lateral sclerosis
show enhanced formation of aggregates in vitro. Proc Natl Acad Sci USA 100:
7021–7026.
38. Christiansen A, Wang Q, Samiotakis A, Cheung MS, Wittung-Stafshede P
(2010) Factors defining effects of macromolecular crowding on protein stability:
an in vitro/in silico case study using cytochrome c. Biochemistry 49: 6519–6530.
39. Meiering EM (2008) The threat of instability: neurodegeneration predicted by
protein destabilization and aggregation propensity. PLoS Biol 6: e193.
40. Mandelkow E, Song YH, Schweers O, Marx A, Mandelkow EM (1995) On the
structure of microtubules, tau, and paired helical filaments. Neurobiol Aging 16:
347–354.
41. Aguzzi A, Sigurdson C, Heikenwaelder M (2008) Molecular mechanisms of
prion pathogenesis. Annu Rev Pathol 3: 11–40.
42. Peoc’h K, Manivet P, Beaudry P, Attane F, Besson G, et al. (2000) Identification
of three novel mutations (E196K, V203I, E211Q) in the prion protein gene
(PRNP) in inherited prion diseases with Creutzfeldt-Jakob disease phenotype.
Hum Mutat 15: 482.
43. Swietnicki W, Petersen RB, Gambetti P, Surewicz WK (1998) Familial
mutations and the thermodynamic stability of the recombinant human prion
protein. J Biol Chem 273: 31048–31052.
44. Vassall KA, Stubbs HR, Primmer HA, Tong MS, Sullivan SM, et al. (2011)
Decreased stability and increased formation of soluble aggregates by immature
superoxide dismutase do not account for disease severity in ALS. Proc Natl Acad
Sci USA 108: 2210–2215.
45. Sun Y, Makarava N, Lee CI, Laksanalamai P, Robb FT, et al. (2008)
Conformational stability of PrP amyloid fibrils controls their smallest possible
fragment size. J Mol Biol 376: 1155–1167.
46. Conway KA, Lee SJ, Rochet JC, Ding TT, Williamson RE, et al. (2000)
Acceleration of oligomerization, not fibrillization, is a shared property of both a-
synuclein mutations linked to early-onset Parkinson’s disease: Implications for
pathogenesis and therapy. Proc Natl Acad Sci USA 97: 571–576.
47. Kayed R, Head E, Thompson JL, McIntire TM, Milton SC, et al. (2003)
Common structure of soluble amyloid oligomers implies common mechanism of
pathogenesis. Science 300: 486–489.
48. Silveira JR, Raymond GJ, Hughson AG, Race RE, Sim VL, et al. (2005) The
most infectious prion protein particles. Nature 437: 257–261.
Contrasting Effect of Crowding on Fibril Formation
PLoS ONE | www.plosone.org14April 2012 | Volume 7 | Issue 4 | e36288