Higher expression of CCL2, CCL4, CCL5, CCL21, and CXCL8 chemokines in the skin associated with parasite density in canine visceral leishmaniasis.

Abstract

The immune response in the skin of dogs infected with Leishmania infantum is poorly understood, and limited studies have described the immunopathological profile with regard to distinct levels of tissue parasitism and the clinical progression of canine visceral leishmaniasis (CVL).
A detailed analysis of inflammatory cells (neutrophils, eosinophils, mast cells, lymphocytes, and macrophages) as well as the expression of chemokines (CCL2, CCL4, CCL5, CCL13, CCL17, CCL21, CCL24, and CXCL8) was carried out in dermis skin samples from 35 dogs that were naturally infected with L. infantum. The analysis was based on real-time polymerase chain reaction (PCR) in the context of skin parasitism and the clinical status of CVL. We demonstrated increased inflammatory infiltrate composed mainly of mononuclear cells in the skin of animals with severe forms of CVL and high parasite density. Analysis of the inflammatory cell profile of the skin revealed an increase in the number of macrophages and reductions in lymphocytes, eosinophils, and mast cells that correlated with clinical progression of the disease. Additionally, enhanced parasite density was correlated with an increase in macrophages and decreases in eosinophils and mast cells. The chemokine mRNA expression demonstrated that enhanced parasite density was positively correlated with the expression of CCL2, CCL4, CCL5, CCL21, and CXCL8. In contrast, there was a negative correlation between parasite density and CCL24 expression.
These findings represent an advance in the knowledge about skin inflammatory infiltrates in CVL and the systemic consequences. Additionally, the findings may contribute to the design of new and more efficient prophylactic tools and immunological therapies against CVL.

Full text

Page 1

Higher Expression of CCL2, CCL4, CCL5, CCL21, and
CXCL8 Chemokines in the Skin Associated with Parasite
Density in Canine Visceral Leishmaniasis
Daniel Menezes-Souza1,2,3, Renata Guerra-Sa ´3,4, Cla ´udia Martins Carneiro1,2,5, Juliana Vitoriano-Souza1,
Rodolfo Cordeiro Giunchetti1,2,4, Andre ´a Teixeira-Carvalho6, Denise Silveira-Lemos7, Guilherme
Corre ˆa Oliveira8, Rodrigo Corre ˆa-Oliveira2, Alexandre Barbosa Reis1,2,5*
1Laborato ´rio de Imunopatologia, Nu ´cleo de Pesquisas em Cie ˆncias Biolo ´gicas, Universidade Federal de Ouro Preto, Ouro Preto, Minas Gerais, Brasil, 2Laborato ´rio de
Imunologia Celular e Molecular, Centro de Pesquisas Rene ´ Rachou, Fundac ¸a ˜o Oswaldo Cruz, Belo Horizonte, Minas Gerais, Brasil, 3Laborato ´rio de Bioquı ´mica e Biologia
Molecular, Nu ´cleo de Pesquisas em Cie ˆncias Biolo ´gicas, Universidade Federal de Ouro Preto, Ouro Preto, Minas Gerais, Brasil, 4Departamento de Cie ˆncias Biolo ´gicas,
Instituto de Cie ˆncias Exatas e Biolo ´gicas, Universidade Federal de Ouro Preto, Ouro Preto, Minas Gerais, Brasil, 5Departamento de Ana ´lises Clı ´nicas, Escola de Farma ´cia,
Universidade Federal de Ouro Preto, Ouro Preto, Minas Gerais, Brasil, 6Laborato ´rio de Biomarcadores de Diagno ´stico e Monitorac ¸a ˜o, Centro de Pesquisas Rene ´ Rachou,
Fundac ¸a ˜o Oswaldo Cruz, Belo Horizonte, Minas Gerais, Brasil, 7Laborato ´rio de Imunoparasitologia, Nu ´cleo de Pesquisas em Cie ˆncias Biolo ´gicas, Universidade Federal de
Ouro Preto, Ouro Preto, Minas Gerais, Brasil, 8Laborato ´rio de Parasitologia Celular e Molecular, Centro de Pesquisas Rene ´ Rachou, Fundac ¸a ˜o Oswaldo Cruz, Belo
Horizonte, Minas Gerais, Brasil
Abstract
Background: The immune response in the skin of dogs infected with Leishmania infantum is poorly understood, and limited
studies have described the immunopathological profile with regard to distinct levels of tissue parasitism and the clinical
progression of canine visceral leishmaniasis (CVL).
Methodology/Principal Findings: A detailed analysis of inflammatory cells (neutrophils, eosinophils, mast cells,
lymphocytes, and macrophages) as well as the expression of chemokines (CCL2, CCL4, CCL5, CCL13, CCL17, CCL21,
CCL24, and CXCL8) was carried out in dermis skin samples from 35 dogs that were naturally infected with L. infantum. The
analysis was based on real-time polymerase chain reaction (PCR) in the context of skin parasitism and the clinical status of
CVL. We demonstrated increased inflammatory infiltrate composed mainly of mononuclear cells in the skin of animals with
severe forms of CVL and high parasite density. Analysis of the inflammatory cell profile of the skin revealed an increase in
the number of macrophages and reductions in lymphocytes, eosinophils, and mast cells that correlated with clinical
progression of the disease. Additionally, enhanced parasite density was correlated with an increase in macrophages and
decreases in eosinophils and mast cells. The chemokine mRNA expression demonstrated that enhanced parasite density
was positively correlated with the expression of CCL2, CCL4, CCL5, CCL21, and CXCL8. In contrast, there was a negative
correlation between parasite density and CCL24 expression.
Conclusions/Significance: These findings represent an advance in the knowledge about skin inflammatory infiltrates in CVL
and the systemic consequences. Additionally, the findings may contribute to the design of new and more efficient
prophylactic tools and immunological therapies against CVL.
Citation: Menezes-Souza D, Guerra-Sa ´ R, Carneiro CM, Vitoriano-Souza J, Giunchetti RC, et al. (2012) Higher Expression of CCL2, CCL4, CCL5, CCL21, and CXCL8
Chemokines in the Skin Associated with Parasite Density in Canine Visceral Leishmaniasis. PLoS Negl Trop Dis 6(4): e1566. doi:10.1371/journal.pntd.0001566
Editor: Hechmi Louzir, Institut Pasteur de Tunis, Tunisia
Received July 18, 2011; Accepted January 29, 2012; Published April 10, 2012
Copyright: ? 2012 Menezes-Souza et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by Conselho Nacional de Desenvolvimento Cientifico e Tecnologico - CNPq, Fundacao de Amparo a Pesquisa do Estado de
Minas Gerais, Rede Mineira de Bioterismo - FAPEMIG. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of
the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: alexreis@nupeb.ufop.br
Introduction
Visceral leishmaniasis (VL), caused by Leishmania (Leishmania)
infantum [syn. Leishmania (Leishmania) chagasi], is endemic in over 88
countries in Europe and Latin America and is transmitted by the
bite of the femalesand fly(phlebotomine) [1]. The skinis considered
a key reservoir compartment for amastigotes in both asymptomatic
and symptomaticLeishmania-infected dogs, and the important role of
dogs in VL transmission in urban areas is supported by the high
parasite loads found in the skin of infected animals and their shared
habitat with humans [2–4]. Previous investigations have revealed
that symptomatic Leishmania-infected dogs exhibit an intense diffuse
dermal inflammatory infiltrate and a high parasitic burden in
comparison with their asymptomatic counterparts [4]. On this basis
it was proposed that the immunopathological changes in the skin
and the levels of cutaneous parasitism are directly related to the
clinical severity of the disease.
Several previous studies correlated immunopathological aspects
of canine visceral leishmaniasis (CVL) with tissue parasite load
and/or the clinical status of the disease [4–17]. The typical
www.plosntds.org1 April 2012 | Volume 6 | Issue 4 | e1566

Page 2

histopathological finding in tissues is a granulomatous inflamma-
tory reaction associated with the presence of Leishmania amastigotes
within macrophages [18]. In the skin of Leishmania infantum–
infected dogs, the histopathological alterations consist of variable
degrees of focal or diffuse inflammatory infiltrate in the dermis and
variable numbers of plasma cells, macrophages, lymphocytes, and
isolated neutrophils [19,20].
Furthermore, it has recently been demonstrated that parasite
density in the skin, bone marrow, and spleen compartments
increases according to the severity of the clinical manifestation of
CVL [6,14,16]. Calabrese et al. [21] evaluated histopathological
aspects of the skin in naturally infected dogs and showed that low
parasite load is associated with an intense inflammatory reaction
driven mainly by mast cells, indicating that these cells exert a role
in innate immunity and in the resistance against canine Leishmania
infection.
Recently, different aspects of the immune response in
Leishmania-infected dogs have been studied, particularly the profile
of cytokines in distinct compartments [5,9,12,17,22–24]. However,
the role of chemokines in disease progression or parasite burdens
of the visceralising species represents an important approach for
understanding immunopathology in CVL.
Chemokines are chemotactic factors that coordinate recruit-
ment of leukocytes that are involved in homeostasis as well as
innate and adaptive immune responses. In the context of
experimental or natural infection in CVL, an up-regulation of
the chemokines in the spleen has been described, although only
CXCL10 and CCL5 were markedly elevated in oligosymptomatic
dogs [24]. In addition, the augmented levels of chemokines
suggested an accumulation of infiltrating monocytes attracted by
CCL3 and CCL2. CD4+Th1 and CD8+cells also accumulated
and may have been recruited by CXCL10, with further expression
induced through IFN-c secretion [24].
Considering the importance of chemokines on the pattern of
CVL and the lack of studies on this topic, understanding the
chemokine profile during ongoing L. infantum infection in dogs is a
prerequisite for identifying the mechanisms for resistance or
susceptibility in this experimental model. In the present study, the
immunopathology of CVL was investigated by performing
detailed analyses of the RNA expression of different chemokines
(CCL2, CCL4, CCL5, CCL13, CCL17, CCL21, CCL24, and
CXCL8) and the occurrence of inflammatory cells (neutrophils,
eosinophils, mast cells, lymphocytes, and macrophages). We
focused on selected chemokines in order to characterize their role
in recruiting particular cell types to the inflammatory infiltrate in
skin from L. infantum–infected dogs. Thus, we found that the
chemokines CCL2, CCL4, CCL5, and CCL21 attract macro-
phages; CCL5 and CCL4 attract inflammatory lymphocytes,
particularly Th1-type cells; CCL24 attracts eosinophils; and
CXCL8 attracts neutrophils, monocytes, and lymphocytes. The
chemokine CCL17 helps to establish the inflammatory infiltrate, a
characteristic feature of various inflammatory skin conditions, by
attracting CCR4-bearing cells, which are especially polarized to
Th2-type cells and regulatory T cells [25]. This study was carried
out using the skin from 35 dogs that were naturally infected with L.
infantum.
Materials and Methods
Study population and clinical evaluation
The study was approved by the Committees of Ethics in Animal
Experimentation of the Universidade Federal de Ouro Preto
(protocol no. 083/2007) and of the Universidade Federal de
Minas Gerais (protocol no. 020/2007) and the City Council of
Belo Horizonte (protocol no. 001/2008). All procedures in this
study were according to the guidelines set by the Brazilian Animal
Experimental Collage (COBEA), Federal Law number 11794.
The study population comprised 51 adult dogs (aged between 2
and 6 years) of both sexes that had been captured by the Center of
Zoonosis Control in Belo Horizonte (Minas Gerais, Brazil), a
region with a high prevalence of CVL and human VL. The
animals were maintained under quarantine at the kennels of the
Instituto de Cie ˆncias Biolo ´gicas (Universidade Federal de Minas
Gerais) prior to tissue collection for 40 days and treated for
intestinal helminthic infections (Endal Plus; Schering-Plough
Coopers, Sa ˜o Paulo, SP, Brazil). We treated kennels with
pyrethroid insecticide monthly during the quarantine and
throughout the experiments. Experimental animals were catego-
rized on the basis of serological results from an indirect
immunofluorescence assay test, the ‘‘gold standard’’ immunolog-
ical test in Brazil for the diagnosis of CVL. Sixteen dogs with
negative immunofluorescence assay test results from serum
samples diluted 1:40 and negative results for Leishmania in tissue
smears (bone marrow, ear skin, spleen, liver, and popliteal lymph
node) were considered to be non-infected and were used as the
control group (CD, n=16). Thirty-five animals with positive
immunofluorescence assay titers $1:40 were considered CVL
positive and comprised the infected animal groups. The infected
animal groups were subdivided on the basis of the presence or
absence of signs of infection according to Mancianti et al. [25] as
follows: an asymptomatic group (AD, n=10), in which indicative
signs of the disease were absent; an oligosymptomatic group (OD,
n=10), in which a maximum of three clinical signs of the disease
were present, including opaque bristles, localized alopecia, and/or
moderate weight loss; and a symptomatic group (SD, n=15), in
which characteristic clinical signs of the disease were present,
including cutaneous lesions, onycogryphosis, opaque bristles,
severe loss of weight, apathy, and keratoconjunctivitis.
Sample collection and assessment of skin parasite load
Animals were euthanized with sodium thiopental (Abbott
Laboratories, Abbott Park, IL, USA; 30 mg/kg body weight)
Author Summary
Several previous studies correlated immunopathological
aspects of canine visceral leishmaniasis (CVL) with tissue
parasite load and/or the clinical status of the disease.
Recently, different aspects of the immune response in
Leishmania-infected dogs have been studied, particularly
the profile of cytokines in distinct compartments. Howev-
er, the role of chemokines in disease progression or
parasite burdens of the visceralising species represents an
important approach for understanding immunopathology
in CVL. We found an increase in inflammatory infiltrate,
which was mainly composed of mononuclear cells, in the
skin of animals presenting severe forms of CVL and high
parasite density. Our data also demonstrated that en-
hanced parasite density is positively correlated with the
expression of CCL2, CCL4, CCL5, CCL21, and CXCL8. In
contrast, there was a negative correlation between
parasite density and CCL24 expression. These findings
represent an advance in the knowledge of the involve-
ment of skin inflammatory infiltrates in CVL and the
systemic consequences and may contribute to developing
a rational strategy for the design of new and more efficient
prophylactic tools and immunological therapies against
CVL.
Skin Chemokines in Canine Visceral Leishmaniasis
www.plosntds.org2 April 2012 | Volume 6 | Issue 4 | e1566

Page 3

and samples of skin tissue were collected from ear areas without
lesions. A skin fragment from each group was used for tissue
imprints on microscopic slides coded for blinded analysis. The
samples were fixed in methanol, stained with Giemsa, and
examined under an optical microscope. Leishmania amastigote
stages were counted and parasite densities were expressed as
Leishman Donovan Units (LDU), corresponding to the number of
Leishmania amastigotes per 1000 nucleated cells per skin imprint as
described by Stauber [27], with some modifications according to
Reis et al. [7,8]. Parasite densities were categorized statistically
into tertiles as absent (LDU=0; CD group, n=16), low (LDU=1–
9; LP group, n=12), medium (LDU=10–130; MP group, n=11),
and high (LDU=131–7246; HP group, n=12).
Extraction of total RNA and synthesis of first strand
cDNAs
A second fragment of ear skin was stored at 280uC until
required for RNA analysis. Total RNA was extracted by
homogenizing approximately 20 mg of skin tissue with 1 mL of
TRIzol reagent (Invitrogen Brasil, Sa ˜o Paulo, SP, Brazil) in a
rotor stator. The lysate was incubated at room temperature for
10 min, mixed with chloroform (200 mL) by tube inversion, and
centrifuged at 12,0006g for 10 min at 4uC. The aqueous phase
was collected, and RNA extraction was done by using the SV
Total RNA Isolation System (Promega, Madison, WI, USA)
according tothemanufacturer’s
included a DNase treatment step. The efficiency of DNAse
treatment was evaluated by PCR amplification of the cDNA
reaction mix without the addition of the ThermoScript enzyme.
Finally, each quantitative PCR (q-PCR) run was performed with
two internal controls assessing both potential genomic DNA
contamination (no reverse transcriptase added) and purity of the
reagents used (no cDNA added). Strand cDNAs were synthesized
from 1.0 mg of total RNA using the ThermoScript RT-PCR
System (Invitrogen Brasil) with oligo-dT primers according to the
manufacturer’s instructions.
recommendations,which
Design of primers for gene evaluation
Primers were designed with the aid of Gene Runner version 3.05
(HastingSoftwareInc.2004)usingspecificcaninesequencesobtained
from GenBank (http://www.ncbi.nlm.nih.gov/genbank/). The se-
quences of the primers are listed in Table 1. The primers were
synthesized by Eurogentec (Southampton, UK) and reconstituted in
nuclease-free water.
Table 1. Sequences of primers used for quantification of mRNA expression by real-time PCRa.
Gene Primer sequence (59–39)Product length (bp) GenBank accession no. Reaction efficiency (%)R2
GAPDH115AB03824099.1 0.996
F TTCCACGGCACAGTCAAG
RACTCAGCACCAGCATCAC
CCL2 91U29653 96.30.979
FCCTGCTGCTATACACTCA
R GCTTCTTTGGGACACTTG
CCL476 AB18319495.9 0.981
F TCCTACTGCCTGCTGCTT
R GCTGGTCTCAAAGTAATCTGC
CCL5 136AB098562 98.7 0.991
FTTCTACACCAGCAGCAAG
R TTCTACACCAGCAGCAAG
CCL13 84AB16284997.6 0.987
F CCCTATTCACTTGCTGCTT
R AGTGGCTGCTGGTGATTC
CCL17 128AB05464295.40.967
FTCCAAGGCAAGTCCATCT
R GAGGTCTCCAAATGATCCA
CCL2160AB16443396.70.972
FAGTCTGGCAAGAAGGGAAAG
R GGGTCTGTGGCTGTTCAGT
CCL24 149AB162851.1 95.30.968
FCCTAAGGCAGGAGTGGTCTT
R AGGGCTTTGGTGCTCATTG
CXCL8 116 AF04871798.7 0.977
FACACTCCACACCTTTCCAT
RGGCACACCTCATTTCCATTG
aF: Forward primer, R: Reverse primer. GenBank accession number of the sequence used to design primers and their product length are shown, as well as each PCR
efficiency and R2.
doi:10.1371/journal.pntd.0001566.t001
Skin Chemokines in Canine Visceral Leishmaniasis
www.plosntds.org3 April 2012 | Volume 6 | Issue 4 | e1566

Page 4

Real-time PCR and cloning and sequencing of amplicons
q-PCR was performed on an ABI Prism 7000 DNA Sequence
Detection System using SYBR Green PCR Master Mix (PE
Applied Biosystems, Foster City, CA, USA), with 100 mM of each
primer and cDNA diluted to 1:5. The samples were incubated at
95uC for 10 min and then submitted to 40 cycles of 95uC for 15 s
and 60uC for 1 min, during which time fluorescence data were
collected. The efficiency of each pair of primers was evaluated by
serial dilution of cDNA according to the protocol developed by PE
Applied Biosystems. In order to evaluate gene expression of the
chemokines CCL2, CCL4, CCL5, CCL13, CCL17, CCL21,
CCL24, and CXCL8, three replicate analyses were performed,
and the amount of target RNA was normalized with respect to the
endogenous control (housekeeping) gene GAPDH. Data were
expressed according to the 22DDCtmethod using the mean value
of the DCt of the control group as the calibrator [26]. After
normalization, the expression levels of chemokines in the infected
groups were considered up-regulated or down-regulated compared
to expression levels in the control group. PCR products were
cloned with pGEM-T Easy Vector (Promega) and sequenced to
check specificity by using an ABI 3100 Automated Sequencer (PE
Applied Biosystems) and a Dye Terminator Kit.
Table 2 presents a summary of the different chemokines and
their biological effects during Leishmania infection in dogs, mice,
and humans. These data illustrate how recruitment of specific cells
might influence the pathogenesis of Leishmania infection.
Histological analysis
For standard histological examination (morphometric analysis
and leukocyte differential counting) sections were coded and
stained with hematoxylin and eosin and subsequently underwent
blinded analysis under an optical microscope (model CH3RF100,
Olympus Optical Co., Tokyo, Japan). The inflammatory cells
(neutrophils, eosinophils, macrophages, mast cells, and lympho-
cytes) that were recruited to the dermis were counted, and the
results are expressed in percentages. Cell types in the cellular
infiltrate in the dermis were quantified by using 20 random images
(total area=1.56106mm2) that adequately represented a slide.
Thus, the density and predominance of cells in the inflammatory
infiltrate and their distribution within the skin layers were assessed
Table 2. Chemokines in Leishmania spp. infection.
Model infection Chemokine Leishmania speciesBiological effect Ref.
Canine infection
Naturally infected CCL5
CXCL10
L. infantumIncrease levels in the spleen and
associated a high IFN-c expression
[24]
Experimentally infected
(in vivo)
CCL2
CCL3
CXCL10
L. infantumSuggest that occurs increased recruitment of
infiltrating monocytes attracted by CCL2 and CCL3,
as well as of CD4+TH1 and CD8+cells which could
have been recruited by CXCL10 and induced further
CXCL10 expression through IFN-c secretion
[24]
Human and murine infection
Naturally infected CCL7
CCL17
L. braziliensis Higher expression of CCL7 and CCL17 in lesions from
late localized cutaneous leishmaniasis (CL) and higher
frequency of CCL7 in difuse CL lesions suggesting a
preferential recruitment of regulatory T cells in the
late phase of the infection
[52]
Eotaxin
CXCL8
L. donovaniIncrease of eosinophil and neutrophil turnover and activity
in patients with VL relate to the reduced production and
availability of the chemokines Eotaxin and CXCL8
[54]
Experimentally infected
(in vitro)
CCL2 L. infantumBefore stimulated human macrophages experimentally
infected with L. infantum with CCL2, levels of nitric oxide
produced were similar to those obtained by stimulation
with IFN-c, which increased the ability of these cells to
eliminate the parasite
[34]
CCL2, 3L. infatum
L. donovani
Induce leishmanicidal ability in vitro in human
macrophages infected by L. infantum and can control
the growth and multiplication of intracellular L. donovani
via regulatory mechanisms mediated by nitric oxide
[35]
Experimentally infected
(in vivo)
CCL3
CCL4
CCL5
L. amazonensis Reductions in expression of these mediators
accompanied by reduced T-cell response in
susceptible mice
[33]
CCL19, 21 L. donovani In murine infection, CCL21 is important in the
marginal zone of the spleen for maintaining this cellular
structure and capturing the blood antigens and greater
susceptibility to infection due to the loss of dendritic
cell migration
[37–38]
CCL2 L. donovaniIn initial phase of infection, attract monocytic cells [53]
CXCL10 L. donovaniAttract lymphocytes and associated to
granuloma formation in liver
[53]
CCL2L. infantum Recruitment of monocytes in the spleen
and sustained parasite persistence
[55]
doi:10.1371/journal.pntd.0001566.t002
Skin Chemokines in Canine Visceral Leishmaniasis
www.plosntds.org4 April 2012 | Volume 6 | Issue 4 | e1566

Page 5

and registered quantitatively. The images displayed in the 406
objective were digitized through a Leica DM5000B microscope
with a coupled camera using the program Leica Application Suite
(version 2.4.0 R1, Leica Microsystems Ltd., Heerbrugg, Switzer-
land). For the analysis of images, Leica QWin V3 (Leica
Microsystems Ltd.) was used to count all cell nuclei, excluding
the pilose follicles, skin annexes, and epidermal cells.
Statistical analysis
Statistical analyses were performed using the GraphPad Prism
software package version 5.0 (GraphPad Software, San Diego, CA,
USA). Normality of the data was established using the Kolmogorov-
Smirnoff test. The Kruskal-Wallis test was used for comparative
studies between groups, followed by Dunn’s test for multiple
comparisons. Spearman’s rank correlation was also computed in
order to investigate relationships between the expression of
chemokine mRNAs with clinical forms and skin parasite density
as well as cell counts. In all cases, differences were considered
significant when the probabilities of equality (p values) were #0.05.
Results
Clinical progression in CVL was correlated with increased
parasite density and the presence of mononuclear cells
in the skin of dogs naturally infected by L. infantum
In order to investigate the relationship between clinical forms of
CVL and skin parasite density as well as cellular infiltrate,
correlation analyses were conducted with these parameters in L.
infantum–infected animals (n=35) (Fig. 1). The main histopatholog-
ical findings are shown in photomicrographs (Fig. 1A). Histopath-
ological examination of the skin showed no histological changes
within the CD group (Fig. 1A, panels 1 and 2). In the LP and AD
groups (Fig. 1A, panels 3 and 4), there was a mild inflammatory
infiltrate, composed mainly of mononuclear cells, while in the OD
and MP groups, this infiltration was mild to moderate, as shown in
Fig. 1A (panels 5 and 6). In panels 7 and 8 of Fig. 1A, which
represent sections of ear skin in the SD group, an intense cellular
infiltrate composed mainly of mononuclear cells was observed.
The intensity and predominance of cells in the inflammatory
infiltrate and their distribution within the skin layers were assessed
(Fig. 1B, 1C). Our results demonstrated a positive correlation
between cellularinfiltrate and
p=0.0004) (Fig. 1B) and skin parasite density (r=0.7352,
p,0.0001) (Fig. 1C). Significant increases in the inflammatory
infiltrate in the skin samples were observed in the AD and SD
groups as compared with CD animals (Fig. 1B). The HP group
had a significant increase in inflammatory infiltrate compared with
the CD and LP groups (Fig. 1C). Moreover, the inflammatory
infiltrate within the MP group was significantly increased as
compared with the CD group (Fig. 1C).
The results also indicated positive correlation among clinical
evolution of CVL and the increase of parasite density in the skin
(r=0.4409, p=0.0080) (Fig. 1D). Additionally, an increase in
parasite density (p,0.05) was detected in the skin of dogs showing
the maximum clinical score (SD) when compared with the AD
group (Fig. 1D).
clinicalstatus(r=0.5400,
Assessment of the inflammatory cell profile in the skin
revealed an increase in macrophages and reductions in
lymphocytes, eosinophils, and mast cells according to
the clinical progression of CVL
The study of skin tissue cellularity included an assessment of the
percentage of cell types (neutrophils, eosinophils, mast cells,
lymphocytes, and macrophages) present in the inflammatory
infiltrate in the skin of dogs that were naturally infected by L.
infantum and categorized by clinical status and dogs that were
uninfected (Fig. 2A). In this context, we observed a reduction in the
percentage of eosinophils in the SD group compared with the CD
group (p,0.05), and a negative correlation between this cell
population(r=20.4760,p=0.0059)andclinicalstatus.Additionally,
there was a decrease (p,0.05) in the percentage of mast cells in the
OD and SD groups when compared with the CD group. Similarly, a
negative correlation was observed in the percentage of mast cells
(r=20.6018, p=0.0002) compared with the clinical form of CVL.
For lymphocytes, we observed an increased (p,0.05) percentage in
the AD group in comparison with the SD group and control dogs.
Furthermore, we also observed an increase (p,0.05) in the OD
group as compared with the SD group. The analysis of correlation
between lymphocyte counts and clinical status showed a negative
correlation between the increase of lymphocytes versus the clinical
outcome in CVL (r=20.6283, p,0.0001) (Fig. 2A). Significant
increases (p,0.05) were observed in the OD and SD groups in the
population of macrophages in comparison to the CD group, and a
positive correlation wasobserved (r=0.5553, p,0.0010) between the
percentage of macrophages and degree of disease.
Enhanced skin parasite density was correlated with an
increase of macrophages and decreases of eosinophils
and mast cells in the skin of dogs naturally infected by L.
infantum
An assessment of cellular infiltrate in the skin of dogs naturally
infected by L. infantum and uninfected dogs was performed by
categorizing them according to skin parasite density (Fig. 2B).
Although neutrophil and lymphocyte subsets did not have
significant changes, a shift in the cell profiles related to the innate
immune response was observed. The percentage of eosinophils
decreased (p,0.05) in the MP and HP groups when compared with
the CD group. Associated with these observations, a negative
correlation between the percentage of eosinophils and skin parasite
density was found (r=20.3885, p=0.0255). The percentage of
mast cells was lower in the LP, MP, and HP groups when compared
with the CD group (p,0.05). Accordingly, a significant increase
(p,0.05) in the percentage of macrophages in the MP and HP
groups in comparison with the CD group was found. Furthermore,
a positive correlation between the percentage of macrophages and
skin parasite density (r=0.4163, p=0.0198) was observed.
Enhanced parasite density was positively correlated with higher
expression of chemokines CCL2, CCL4, CCL5, CCL21, and
CXCL8 and lesser expression of CCL24 in the skin of dogs
naturally infected by L. infantum. The involvement of chemokines
in recruiting cells to the skin and developing a protective response
against Leishmania infection was evaluated according to skin
parasitism. These results are described in Figure 3. In this study,
we also performed correlation analysis between the levels of
chemokine expression and the clinical status, but significant
differences did not exist between the groups (data not shown). The
mRNA expression of CCL2 was increased (5.8-fold; p,0.05) in
the HP group as compared with the LP group. Furthermore, the
correlation analysis showed that CCL2 was positively associated
with an increase of parasite load in the skin of these animals
(r=0.5329, p=0.0010). CCL4 was up-regulated in all groups in
relation to the CD group and highly expressed in the HP group in
comparison to the LP and MP groups (3.5-fold and 2.8-fold,
respectively;
p,0.05). Additionally,
(r=0.5774, p=0.0003) with an increase in skin parasite density
was detected. Similarly, CCL5 expression indicated a significant
apositive correlation
Skin Chemokines in Canine Visceral Leishmaniasis
www.plosntds.org5 April 2012 | Volume 6 | Issue 4 | e1566

Page 6

up-regulation occurred in all infected groups when compared to
CD, and increased levels were observed in the HP group in
comparison with the LP and MP groups (2.1-fold and 1.7-fold,
respectively; p,0.05). Moreover, a positive correlation could be
established between the expression of CCL5 and skin parasite
density (r=0.5480, p=0.0014).
CCL13 and CCL17 were down-regulated in all groups in
comparison to the CD group; however, significant differences were
not found between experimental groups. For the chemokine
CCL21, we observed increased expression in all groups compared
with the CD group, and high levels were found in the HP group
compared with the LP and MP groups (1.4-fold and 1.3-fold,
respectively; p,0.05). In addition, a positive correlation was
observed between CCL21 expression and parasite density
(r=0.6000, p=0.0004).
The expression of CCL24 was up-regulated in the LP and MP
groups and down-regulated in the HP group compared to the CD
group. In addition, higher CCL24 expression was observed in the
MP group when compared with the HP group (0.9-fold; p,0.05).
Furthermore, a negative correlation was observed between CCL24
expression and skin parasite density (r=20.3368, p=0.0479).
With regard to CXCL8, we observed an increase in the target
transcript levels in the LP and HP groups and down-regulation in
the MP group compared with CD. In addition, CXCL8
Figure 1. Histopathological and parasite density analyses of skin of dogs naturally infected with L. infantum. Animals were categorized
according to their clinical status into asymptomatic (AD, n=10), oligosymptomatic (OD, n=10), or symptomatic (SD, n=15) or categorized according
to skin parasite density into low (LP, n=12), medium (MP, n=11), or high (HP, n=12) parasite density. The control group is represented by CD
(n=16). Photomicrographs of cutaneous cellular infiltrates from dogs naturally inflected by L. infantum stained by hematoxylin and eosin (A).
Representative cellular infiltrates of study groups are depicted: Control dogs (1 and 2 ); AD or LP (3 and 4); OD or MP (5 and 6); SD or HP (7 and 8).
Left panels: Slides shown at 106magnification; bar, 100 mm. Right panels: Slides shown at 406magnification; bar, 25 mm. Correlation between
quantitative analysis of cutaneous cellular infiltrate with clinical status (B) or skin parasite density (C) are presented. Correlation between clinical
groups and skin parasite density is also presented (D). The results are expressed as the mean number of cells present in cutaneous cellular infiltrates
evaluated at 20 fields plus standard deviation. In (D), the results are expressed as the mean of the log number of skin parasite density plus standard
deviation. Significant differences (p,0.05) compared with CD and AD or LP groups are indicated by symbols * and #, respectively. Spearman’s
correlation indexes (r and p values) are shown on the graphs when applicable.
doi:10.1371/journal.pntd.0001566.g001
Skin Chemokines in Canine Visceral Leishmaniasis
www.plosntds.org6 April 2012 | Volume 6 | Issue 4 | e1566

Page 7

Skin Chemokines in Canine Visceral Leishmaniasis
www.plosntds.org7 April 2012 | Volume 6 | Issue 4 | e1566

Page 8

expression was significantly higher in the HP group compared
with the LP and MP groups (6.9-fold and 8.3-fold, respectively;
p,0.05). Positive correlation was observed between CXCL8
expression and skin parasite density (r=0.4180, p=0.0155).
Skin parasite density was most strongly correlated with
chemokines that induce macrophage migration during
CVL
In order to better identify the association between inflammatory
cells present in skin and chemokine levels, we performed additional
correlation analyses between distinct cell types and cutaneous
chemokine expression (Fig. 4). Interestingly, our results indicated
that macrophages were the cell type that was most likely to be
recruited by chemokines CCL2 (r=0.3514; p=0.0486), CCL4
(r=0.3600; p=0.0396), CCL5 (r=0.3485; p=0.0469), and CCL21
(r=0.3440; p=0.0499) (Fig. 4). Negative correlation was observed
between CCL21 levels and neutrophils (r=20.3562; p=0.0419).
Discussion
The analysis of chemokine expression in lymphoid compart-
ments is crucial for assessing central regulation and pathophysi-
ological processes, including traffic homeostasis, inflammation,
Figure 2. Cellular profile of the skin from dogs naturally infected by L. infantum. (A) Animals were categorized according to their clinical
status into asymptomatic (AD, n=10), oligosymptomatic (OD, n=10), or symptomatic (SD, n=15) or categorized according to skin parasite density
into low (LP, n=12), medium (MP, n=11), and high (HP, n=12) parasite density. The control groups are represented by CD (n=16). Relationship
between clinical forms and percentage of cells in the skin of dogs naturally infected with L. infantum (A). Relationship between skin parasite density
and percentage of cells in the skin of dogs naturally infected with L. infantum (B). The data are presented as boxplots. The box stretches from the
lower hinge (defined as the 25th percentile) to the upper hinge (the 75th percentile) and therefore contains the middle half of the score in the
distribution. The median is shown as a line across the box. Therefore, one fourth of the distribution is between this line and the bottom or the top of
the box. Significant differences (p,0.05) compared with CD and SD or HP are indicated by symbols * and D, respectively. Spearman’s correlation
indexes (r and p values) are shown on the graphs when applicable.
doi:10.1371/journal.pntd.0001566.g002
Figure 3. Skin parasite density and expression of chemokines in the skin from dogs with L. infantum. Animals were categorized
according to their skin parasite density into low (LP=gray circles), medium (MP=gray triangles), and high (HP=dark diamonds) parasite load. The
results are expressed as scattering of individual values and median of that group (bars) of log10of the relative copy number of mRNA for CCL2, CCL4,
CCL5, CCL13, CCL17, CCL21, CCL24, and CXCL8. Significant differences (p,0.05) compared with LP, MP, and HP are indicated by the symbols *, #, and
+, respectively. Spearman’s correlation indexes (r and p values) are shown on the graphs when applicable.
doi:10.1371/journal.pntd.0001566.g003
Skin Chemokines in Canine Visceral Leishmaniasis
www.plosntds.org8April 2012 | Volume 6 | Issue 4 | e1566

Page 9

and hematopoiesis [27,28]. In this context, few studies have
investigated the levels of chemokines in ongoing CVL. In one of
these studies, Strauss-Ayali et al. [24] evaluated the expression of
CCL2, CCL4, CCL5, and CXCL10 in the spleen of dogs
naturally or experimentally infected by L. infantum and found an
increase of CCL2 and CCL5 in the experimentally infected dogs.
Herein, increased levels of CCL2, CCL4, and CCL5 in dogs
with high parasitism were observed, and these chemokines were
positively correlated with parasite density. These results indicate a
preferential migration of macrophages into the skin, suggesting a
host strategy to control parasitism during ongoing CVL. It has
been proposed that in leishmaniasis, chemokines CCL2, CCL4,
and CCL5 generally play a role not only as chemotactic factors but
also as co-activators of macrophages and consequently have a part
in the elimination of parasites [29–32].
After stimulation with CCL2, human macrophages experimen-
tally infected with L. infantum produced levels of nitric oxide that
were similar to those obtained by stimulation with IFN-c, which
increased the ability of these cells to eliminate the parasite [33]. In
addition, CCL2 and CCL3may induce leishmanicidal ability in vitro
in human macrophages infected by L. infantum and can control the
growth and multiplication of intracellular L. donovani via regulatory
mechanisms mediated by nitric oxide [34]. In the present work, we
demonstrated an increase in the percentage of macrophages in dogs
with clinical signs (OD and SD) or with moderate to high parasitism
(MP and HP). There was also a positive correlation between the
percentage of macrophages and expression of CCL2, CCL4, and
CCL5. Previous data published by our group demonstrated a
decrease in absolute values of circulating monocytes as a hallmark
found in the symptomatic group and in the group with the higher
parasite load [6]. These data may suggest the recruitment of
monocytes to other tissues during active CVL, where they might
play an important role in immunological connections throughout
antigen presentation and parasite clearance. However, the presence
of macrophages in the skin infiltrates does not guarantee their
ongoing function since histological analysis of skin during CVL
described in this and other studies showed an intense cell infiltrate
composed of mononuclear cells in animals with high parasitism that
were clinically symptomatic [19]. The finding that expression of
macrophage chemoattractants was associated with parasite burden
contradicts previous in vitro data demonstrating that these
chemokines have a macrophage-activating protective effect. This
would suggest that the chemokines are recruiting immature or
unresponsive macrophages. Moreover, the levels of CXCL8
observed in HP animals, despite inducing macrophage recruitment,
seemed to favor the persistence of the parasite in the skin
compartment. In addition, high levels of macrophages in the skin
of dogs withactive CVL(OD and SD) and in dogs with MP and HP
density were demonstrated and highlighted the inability of these
cells to control parasitism.
Our study represents the first investigation on the involvement
of CCL21 in CVL. We also observed increased levels of CCL21 in
Figure 4. Correlation between parasite density (LDU) and cell-types presenting into skin from L. infantum infected dogs. The results
were expressed on graphs as scattering of individual values. Spearman correlation indexes (r) at p,0.05 are shown on graphs. Connecting lines
illustrated positive and negative correlation indexes.
doi:10.1371/journal.pntd.0001566.g004
Skin Chemokines in Canine Visceral Leishmaniasis
www.plosntds.org9April 2012 | Volume 6 | Issue 4 | e1566

Page 10

animals with high parasitism, independent of the positive
correlation between the chemokine and cutaneous parasitism. It
has been reported that CCL21 is an important chemokine
involved in recruiting antigen-presenting cells (APCs) to lymphoid
organs [35]. In murine infection by L. donovani, Ato et al. [36]
demonstrated that CCL21 is important in the marginal zone of the
spleen for maintaining the structure of its cellular composition and
capturing blood antigens during Leishmania infection. Moreover,
mice deficient for the gene encoding CCL21 have greater
susceptibility to infection when exposed to L. donovani due to the
loss of dendritic cell migration [37]. In this context, we hypothesize
that increased skin parasitism has the potential to stimulate the
expression of CCL21, resulting in the recruitment of APCs in the
skin from the lymphoid organs. However, it is possible that either
these cells, like macrophages, do not present a functional profile
favoring a Th1-immune response that would be effective against
Leishmania infection. Alternately, the increase of CCL21 may lead
to retention of APCs in the skin and reduce their migration to the
regional lymph node where antigens would be presented to T cells.
Several studies have reported the involvement of mast cells in
regulating immunity against various Leishmania species [38–40]. In
the present study, a decrease of this population was observed in the
skin of animals presenting severe clinical forms of the disease (OD
and SD group) and in all groups categorized according to parasite
density (LP, MP, and HP) when compared with the control group.
This finding could be related to this cell type being involved in
attempts to contain the intense skin parasite density, as described
in several studies that evaluated a murine model [41–43].
Calabrese et al. [21] described an intense inflammatory skin
reaction formed mainly by mast cells, indicating that these cells
might exert a role in innate immunity against L. infantum infection.
Our data regarding mast cells conflict with this possibility,
however. The discrepancy might be explained by L. infantum
infection causing a diverse range of clinical and histopathological
manifestations. Variations in host resistance may help to explain
the variations found in the skin parasite load in dogs. Moreover,
when dogs from different regions are compared, additional factors
must be considered, such as variations in weather conditions (e.g.,
Leishmania infection seems to occur chiefly in dry seasons).
In the present study, decreases in the eosinophil population and
CCL24 expression were observed that were related to the clinical
progression and skin parasite density. CCL24 is a specific agonist
for CCR3, attracting and activating eosinophils in parasitic
diseases [44]. Some authors have described a microbicidal
capability of eosinophils against L. donovani and L. major parasites
[45,46] and suggested this cell type could play an important role in
protection against Leishmania infection [47]. Moreover, Amusate-
gui et al. [48] reported that eosinophil counts were higher in dogs
that presented cutaneous signs, and they suggested that this finding
was associated with allergenic responses. More studies are
necessary to determine the role of eosinophils in the cutaneous
immune response in CVL.
The participation of neutrophils in addressing infection by
parasites of the genus Leishmania has been studied in recent years to
understand the mechanisms related to the innate immune
response [49–51]. We observed that higher CXCL8 levels existed
in dogs presenting high cutaneous parasitism. This chemokine
induces neutrophil chemotaxis, and the initial influx of neutrophils
seems to be beneficial for the survival of Leishmania in the infected
tissue [50]. Interestingly, it has been reported that the parasite
itself produces a protein with chemoattractant properties, called
Leishmania chemotactic factor, which promotes the migration of
neutrophils to the site of infection [49], thereby boosting the
phagocytosis of the parasite. Peters et al. [51] evaluated the events
that occur in the skin during the initial phase of the transmission of
L. major by sand flies and observed that a decrease in neutrophils at
the infection site is associated with the inability of parasites to
establish infection. This hypothesis is strongly supported by a
recently published study from our group that showed a mixed
cytokine profile during active CVL with predominantly higher
cutaneous levels of interleukin (IL)-10 and transforming growth
factor b1 apart from lower expression of IL-12. These findings
might represent a key condition that allows persistence of parasite
replication in the skin [17].
Herein, our data highlight the skin as an important organ in
CVL and suggest that increased levels of CCL2, CCL4, CCL5,
and CCL21 are associated with the immunopathogenesis of CVL.
Our data also suggest that the expression of these cytokines in skin
could be used as biomarkers for disease progression in dogs
naturally infected by L. infantum. Our findings represent an
advance in the knowledge of the involvement of skin inflammatory
infiltrates in CVL and the systemic consequences and may
contribute to developing a rational strategy for the design of new
and more efficient prophylactic tools and immunological therapies
against CVL.
Acknowledgments
The authors wish to express their appreciation of the hard work carried out
by the staff of the Fundac ¸a ˜o Nacional da Sau ´de during the execution of this
project. The authors are also grateful for the use of facilities at Centro de
Bioterismo (Universidade Federal de Minas Gerais), Universidade Federal
de Ouro Preto and Rede Mineira de Bioterismo (FAPEMIG), and for
support with the provision of experimental animals.
Author Contributions
Conceived and designed the experiments: RGS CMC RCG GCO ABR.
Performed the experiments: DMS RGS JVS DSL. Analyzed the data:
DMS CMC RCG ABR. Contributed reagents/materials/analysis tools:
RGS CMC ATC RCO ABR. Wrote the paper: DMS RGS RCG DSL
ABR.
References
1.Desjeux P (2004) Leishmaniasis: current situation and new perspectives. Comp
Immunol Microbiol Infect Dis 27: 305–318.
Tesh RB (1995) Control of zoonotic visceral leishmaniasis: is it time to change
strategies? Am J Trop Med Hyg 52: 287–292.
Abranches P, Silva-Pereira MC, Conceicao-Silva FM, Santos-Gomes GM,
Janz JG (1991) Canine leishmaniasis: pathological and ecological factors
influencing transmission of infection. J Parasitol 77: 557–561.
Giunchetti RC, Mayrink W, Genaro O, Carneiro CM, Correa-Oliveira R, et al.
(2006) Relationship between canine visceral leishmaniosis and the Leishmania
(Leishmania) chagasi burden in dermal inflammatory foci. J Comp Pathol 135:
100–107.
2.
3.
4.
5.Chamizo C, Moreno J, Alvar J (2005) Semi-quantitative analysis of cytokine
expression in asymptomatic canine leishmaniasis. Vet Immunol Immunopathol
103: 67–75.
Reis AB, Martins-Filho OA, Teixeira-Carvalho A, Carvalho MG, Mayrink W,
et al. (2006) Parasite density and impaired biochemical/hematological status are
associated with severe clinical aspects of canine visceral leishmaniasis. Res Vet
Sci 81: 68–75.
Reis AB, Teixeira-Carvalho A, Giunchetti RC, Guerra LL, Carvalho MG, et al.
(2006) Phenotypic features of circulating leucocytes as immunological markers
for clinical status and bone marrow parasite density in dogs naturally infected by
Leishmania chagasi. Clin Exp Immunol 146: 303–311.
6.
7.
Skin Chemokines in Canine Visceral Leishmaniasis
www.plosntds.org 10April 2012 | Volume 6 | Issue 4 | e1566

Page 11

8.Reis AB, Teixeira-Carvalho A, Vale AM, Marques MJ, Giunchetti RC, et al.
(2006) Isotype patterns of immunoglobulins: hallmarks for clinical status and
tissue parasite density in Brazilian dogs naturally infected by Leishmania
(Leishmania) chagasi. Vet Immunol Immunopathol 112: 102–116.
Lage RS, Oliveira GC, Busek SU, Guerra LL, Giunchetti RC, et al. (2007)
Analysis of the cytokine profile in spleen cells from dogs naturally infected by
Leishmania chagasi. Vet Immunol Immunopathol 115: 135–145.
10. Giunchetti RC, Martins-Filho OA, Carneiro CM, Mayrink W, Marques MJ,
et al. (2008) Histopathology, parasite density and cell phenotypes of the popliteal
lymph node in canine visceral leishmaniasis. Vet Immunol Immunopathol 121:
23–33.
11. Giunchetti RC, Mayrink W, Carneiro CM, Correa-Oliveira R, Martins-
Filho OA, et al. (2008) Histopathological and immunohistochemical investiga-
tions of the hepatic compartment associated with parasitism and serum
biochemical changes in canine visceral leishmaniasis. Res Vet Sci 84: 269–277.
12. Alves CF, de Amorim IF, Moura EP, Ribeiro RR, Michalick MS, et al. (2009)
Expression of IFN-gamma, TNF-alpha, IL-10 and TGF-beta in lymph nodes
associates with parasite load and clinical form of disease in dogs naturally
infected with Leishmania (Leishmania) chagasi. Vet Immunol Immunopathol
128: 349–358.
13. Carrillo E, Moreno J (2009) Cytokine profiles in canine visceral leishmaniasis.
Vet Immunol Immunopathol 128: 67–70.
14. Guerra LL, Teixeira-Carvalho A, Giunchetti RC, Martins-Filho OA, Reis AB,
et al. (2009) Evaluation of the influence of tissue parasite density on
hematological and phenotypic cellular parameters of circulating leukocytes
and splenocytes during ongoing canine visceral leishmaniasis. Parasitol Res 104:
611–622.
15. Manna L, Reale S, Vitale F, Gravino AE (2009) Evidence for a relationship
between Leishmania load and clinical manifestations. Res Vet Sci 87: 76–78.
16. Reis AB, Martins-Filho OA, Teixeira-Carvalho A, Giunchetti RC,
Carneiro CM, et al. (2009) Systemic and compartmentalized immune response
in canine visceral leishmaniasis. Vet Immunol Immunopathol 128: 87–95.
17. Menezes-Souza D, Correa-Oliveira R, Guerra-Sa R, Giunchetti RC, Teixeira-
Carvalho A, et al. (2011) Cytokine and transcription factor profiles in the skin of
dogs naturally infected by Leishmania (Leishmania) chagasi presenting distinct
cutaneous parasite density and clinical status. Vet Parasitol 177: 39–49.
18. Baneth G, Koutinas AF, Solano-Gallego L, Bourdeau P, Ferrer L (2008) Canine
leishmaniosis - new concepts and insights on an expanding zoonosis: part one.
Trends Parasitol 24: 324–330.
19. dos-Santos WL, David J, Badaro R, de-Freitas LA (2004) Association between
skin parasitism and a granulomatous inflammatory pattern in canine visceral
leishmaniosis. Parasitol Res 92: 89–94.
20. Solano-Gallego L, Fernandez-Bellon H, Morell P, Fondevila D, Alberola J, et al.
(2004) Histological and immunohistochemical study of clinically normal skin of
Leishmania infantum-infected dogs. J Comp Pathol 130: 7–12.
21. Calabrese KS, Cortada VM, Dorval ME, Souza Lima MA, Oshiro ET, et al.
(2010) Leishmania (Leishmania) infantum/chagasi: Histopathological aspects of
the skin in naturally infected dogs in two endemic areas. Exp Parasitol 124:
253–257.
22. Correa AP, Dossi AC, de Oliveira Vasconcelos R, Munari DP, de Lima VM
(2007) Evaluation of transformation growth factor beta1, interleukin-10, and
interferon-gamma in male symptomatic and asymptomatic dogs naturally
infected by Leishmania (Leishmania) chagasi. Vet Parasitol 143: 267–274.
23. Panaro MA, Brandonisio O, Cianciulli A, Cavallo P, Lacasella V, et al. (2009)
Cytokine expression in dogs with natural Leishmania infantum infection.
Parasitology 136: 823–831.
24. Strauss-Ayali D, Baneth G, Jaffe CL (2007) Splenic immune responses during
canine visceral leishmaniasis. Vet Res 38: 547–564.
25. Mancianti F, Gramiccia M, Gradoni L, Pieri S (1988) Studies on canine
leishmaniasis control. 1. Evolution of infection of different clinical forms of
canine leishmaniasis following antimonial treatment. Trans R Soc Trop Med
Hyg 82: 566–567.
26. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, et al. (2009) The MIQE
guidelines: minimum information for publication of quantitative real-time PCR
experiments. Clin Chem 55: 611–622.
27. Sallusto F, Mackay CR, Lanzavecchia A (2000) The role of chemokine receptors
in primary, effector, and memory immune responses. Annu Rev Immunol 18:
593–620.
28. Ono SJ, Nakamura T, Miyazaki D, Ohbayashi M, Dawson M, et al. (2003)
Chemokines: roles in leukocyte development, trafficking, and effector function.
J Allergy Clin Immunol 111: 1185–1199; quiz 1200.
29. Ritter U, Moll H, Laskay T, Brocker E, Velazco O, et al. (1996) Differential
expression of chemokines in patients with localized and diffuse cutaneous
American leishmaniasis. J Infect Dis 173: 699–709.
30. Muzio M, Bosisio D, Polentarutti N, D’Amico G, Stoppacciaro A, et al. (2000)
Differential expression and regulation of toll-like receptors (TLR) in human
leukocytes: selective expression of TLR3 in dendritic cells. J Immunol 164:
5998–6004.
9.
31. Dorner BG, Scheffold A, Rolph MS, Huser MB, Kaufmann SH, et al. (2002)
MIP-1alpha, MIP-1beta, RANTES, and ATAC/lymphotactin function together
with IFN-gamma as type 1 cytokines. Proc Natl Acad Sci U S A 99: 6181–6186.
32. Ji J, Sun J, Soong L (2003) Impaired expression of inflammatory cytokines and
chemokines at early stages of infection with Leishmania amazonensis. Infect
Immun 71: 4278–4288.
33. Brandonisio O, Panaro MA, Fumarola I, Sisto M, Leogrande D, et al. (2002)
Macrophage chemotactic protein-1 and macrophage inflammatory protein-1
alpha induce nitric oxide release and enhance parasite killing in Leishmania
infantum-infected human macrophages. Clin Exp Med 2: 125–129.
34. Bhattacharyya S, Ghosh S, Dasgupta B, Mazumder D, Roy S, et al. (2002)
Chemokine-induced leishmanicidal activity in murine macrophages via the
generation of nitric oxide. J Infect Dis 185: 1704–1708.
35. Marsland BJ, Battig P, Bauer M, Ruedl C, Lassing U, et al. (2005) CCL19 and
CCL21 induce a potent proinflammatory differentiation program in licensed
dendritic cells. Immunity 22: 493–505.
36. Ato M, Nakano H, Kakiuchi T, Kaye PM (2004) Localization of marginal zone
macrophages is regulated by C-C chemokine ligands 21/19. J Immunol 173:
4815–4820.
37. Ato M, Maroof A, Zubairi S, Nakano H, Kakiuchi T, et al. (2006) Loss of
dendritic cell migration and impaired resistance to Leishmania donovani
infection in mice deficient in CCL19 and CCL21. J Immunol 176: 5486–5493.
38. Katakura K, Saito S, Hamada A, Matsuda H, Watanabe N (1993) Cutaneous
leishmaniasis in mast cell-deficient W/Wv mice. Infect Immun 61: 2242–2244.
39. Wershil BK, Theodos CM, Galli SJ, Titus RG (1994) Mast cells augment lesion
size and persistence during experimental Leishmania major infection in the
mouse. J Immunol 152: 4563–4571.
40. Maurer M, Lopez Kostka S, Siebenhaar F, Moelle K, Metz M, et al. (2006) Skin
mast cells control T cell-dependent host defense in Leishmania major infections.
FASEB J 20: 2460–2467.
41. Gordon JR, Galli SJ (1994) Promotion of mouse fibroblast collagen gene
expression by mast cells stimulated via the Fc epsilon RI. Role for mast cell-
derived transforming growth factor beta and tumor necrosis factor alpha. J Exp
Med 180: 2027–2037.
42. MacDonald AJ, Thornton EM, Newlands GF, Galli SJ, Moqbel R, et al. (1996)
Rat bone marrow-derived mast cells co-cultured with 3T3 fibroblasts in the
absence of T-cell derived cytokines require stem cell factor for their survival and
maintain their mucosal mast cell-like phenotype. Immunology 88: 375–383.
43. Weber A, Knop J, Maurer M (2003) Pattern analysis of human cutaneous mast
cell populations by total body surface mapping. Br J Dermatol 148: 224–228.
44. Petkovic V, Moghini C, Paoletti S, Uguccioni M, Gerber B (2004) Eotaxin-3/
CCL26 is a natural antagonist for CC chemokine receptors 1 and 5. A human
chemokine with a regulatory role. J Biol Chem 279: 23357–23363.
45. Pearson RD, Uydess IL, Chapman SW, Steigbigel RT (1987) Interaction of
human eosinophils with Leishmania donovani. Ann Trop Med Parasitol 81:
735–739.
46. Oliveira SH, Fonseca SG, Romao PR, Ferreira SH, Cunha FQ (1997) Nitric
oxide mediates the microbicidal activity of eosinophils. Mem Inst Oswaldo Cruz
92 Suppl 2: 233–235.
47. Watanabe Y, Hamaguchi-Tsuru E, Morimoto N, Nishio Y, Yagyu K, et al.
(2004) IL-5-Induced Eosinophils Suppress the Growth of Leishmania amazo-
nensis In Vivo and Kill Promastigotes In Vitro in Response to Either IL-4 or
IFN-gamma. DNA Cell Biol 23: 412–418.
48. Amusategui I, Sainz A, Rodriguez F, Tesouro MA (2003) Distribution and
relationships between clinical and biopathological parameters in canine
leishmaniasis. Eur J Epidemiol 18: 147–156.
49. van Zandbergen G, Hermann N, Laufs H, Solbach W, Laskay T (2002)
Leishmania promastigotes release a granulocyte chemotactic factor and induce
interleukin-8 release but inhibit gamma interferon-inducible protein 10
production by neutrophil granulocytes. Infect Immun 70: 4177–4184.
50. van Zandbergen G, Klinger M, Mueller A, Dannenberg S, Gebert A, et al.
(2004) Cutting edge: neutrophil granulocyte serves as a vector for Leishmania
entry into macrophages. J Immunol 173: 6521–6525.
51. Peters NC, Egen JG, Secundino N, Debrabant A, Kimblin N, et al. (2008) In
vivo imaging reveals an essential role for neutrophils in leishmaniasis transmitted
by sand flies. Science 321: 970–974.
52. Campanelli AP, Brodskyn CI, Boaventura V, Silva C, Roselino AM, et al. (2010)
Chemokines and chemokine receptors coordinate the inflammatory immune
response in human cutaneous leishmaniasis. Human Immunology 71:
1220–1227.
53. Cotterell SE (1999) Leishmania donovani infection initiates T cell-independent
chemokine responses, which are subsequently amplified in a T cell-dependent
manner. European Journal of Immunology 29: 203–214.
54. Elshafie AI, A˚hlin E, Ha ˚kansson LD, Elghazali G, Safi SHE, et al. (2011)
Activity and turnover of eosinophil and neutrophil granulocytes are altered in
visceral leishmaniasis. International Journal for Parasitology 41: 463–469.
55. Rousseau D, Demartino S, Anjuere F, Ferrua B, Fragaki K, et al. (2001)
Sustained parasite burden in the spleen of Leishmania infantum-infected BALB/
c mice is accompanied by expression of MCP-1 transcripts and lack of protection
against challenge. European Cytokine Network 12: 340–347.
Skin Chemokines in Canine Visceral Leishmaniasis
www.plosntds.org11April 2012 | Volume 6 | Issue 4 | e1566