microRNA-145 in Barrett's oesophagus: regulating BMP4 signalling via GATA6.

Abstract

OBJECTIVE: Barrett's oesophagus (BE) is a metaplastic condition of the distal oesophagus which predisposes to oesophageal adenocarcinoma (EAC). It has been suggested that microRNAs (miRNAs) are involved in the process of development of BE and EAC; however, few functional miRNA data are available. The aim of the study was to perform a tissue-specific miRNA profile and, based on this, to examine the function of miRNA-145 in the oesophagus. DESIGN: miRNA expression profiling using microarray analysis in EAC, BE and normal squamous epithelium of the oesophagus (SQ) was performed and validated using real-time PCR in samples from 15 patients and in situ hybridisation in samples from 10 patients. The proliferative effect of miRNA-145 precursor transfection in the SQ (HET-1A) and BE cell line (BAR-T) was measured. Downstream targets of miRNA-145 were determined by analysing mRNA and protein expression from miRNA-145 transfected cells. RESULTS: Three unique miRNA expression profiles were found in tissue from EAC, BE and SQ, which showed that miRNA-145 was upregulated in BE compared with EAC and SQ. Overexpression of miRNA-145 in HET-1A and BAR-T cells reduced cell proliferation and inhibited GATA6, BMP4 and SOX9 mRNA expression. Furthermore, altered BMP4 signalling was observed in vitro on miRNA-145 overexpression. These effects were blocked when cells were co-transfected with a miRNA-145 specific inhibitor. Additionally, BMP4 incubation of HET-1A cells altered miRNA-145 and GATA6 expression over time. CONCLUSION: These results imply that miRNA-145 indirectly targets BMP4 via GATA6 and is potentially involved in the development of BE.

Full text

Page 1

ORIGINAL ARTICLE
microRNA-145 in Barrett’s oesophagus: regulating
BMP4 signalling via GATA6
Jantine W P M van Baal,1Romy E Verbeek,1Pauline Bus,1Matteo Fassan,2
Rhonda F Souza,3Massimo Rugge,2Fiebo J W ten Kate,4
Frank P Vleggaar,1Peter D Siersema1
ABSTRACT
Objective Barrett’s oesophagus (BE) is a metaplastic
condition of the distal oesophagus which predisposes to
oesophageal adenocarcinoma (EAC). It has been
suggested that microRNAs (miRNAs) are involved in
the process of development of BE and EAC; however,
few functional miRNA data are available. The aim of
the study was to perform a tissue-specific miRNA
profile and, based on this, to examine the function of
miRNA-145 in the oesophagus.
Design miRNA expression profiling using microarray
analysis in EAC, BE and normal squamous epithelium of
the oesophagus (SQ) was performed and validated using
real-time PCR in samples from 15 patients and in situ
hybridisation in samples from 10 patients. The
proliferative effect of miRNA-145 precursor transfection
in the SQ (HET-1A) and BE cell line (BAR-T) was
measured. Downstream targets of miRNA-145 were
determined by analysing mRNA and protein expression
from miRNA-145 transfected cells.
Results Three unique miRNA expression profiles were
found in tissue from EAC, BE and SQ, which showed that
miRNA-145 was upregulated in BE compared with EAC
and SQ. Overexpression of miRNA-145 in HET-1A and
BAR-T cells reduced cell proliferation and inhibited
GATA6, BMP4 and SOX9 mRNA expression.
Furthermore, altered BMP4 signalling was observed in
vitro on miRNA-145 overexpression. These effects were
blocked when cells were co-transfected with a miRNA-
145 specific inhibitor. Additionally, BMP4 incubation of
HET-1A cells altered miRNA-145 and GATA6 expression
over time.
Conclusion These results imply that miRNA-145
indirectly targets BMP4 via GATA6 and is potentially
involved in the development of BE.
INTRODUCTION
Barrett’s oesophagus (BE) is a metaplastic condition
of the distal oesophagus in which the normal
squamous epithelium of the distal oesophagus is
replaced by columnar epithelium, defined as an
incompletely differentiated
epithelium containing goblet cells.1e3BE is associ-
ated with an increased risk of developing oesopha-
geal adenocarcinoma (EAC), with an estimated
annual incidence of 0.5%.4e6Over the last decades
the incidence rates of BE and EAC have risen
dramatically in the Western world.7
studieshaveidentified
EAC-associated aberrantly expressed genes and
intestinaltypeof
Previous
BEhundredsofand
proteins.8e13The understanding of the regulatory
network(s) underlying this altered expression is,
however, far from complete.
MicroRNAs (miRNAs) have been shown to be
important by negatively influencing the protein
translation machinery. As such, miRNAs can affect
several cellular processes such as development,
apoptosis, cell growth, proliferation and differenti-
ation.14miRNAs are small non-coding RNAs of
about 22 nucleotides in length and are differentially
expressed in many cancer types.15 16Expression
profiles of miRNAs in various tissues have been
studied, and it has been shown that miRNAs are
differentially expressed and represent tissue-specific
‘signatures’.17Several studies have indicated that
abnormal miRNA expression is a hallmark for
tumour development, suggesting that miRNAs
may act as oncogenes and tumour suppressors.18 19
To date, limited data are available on miRNA
expression in BE or EAC.20e27We performed
miRNA expression analysis using the Exiqon V.10.1
<Additional materials are
published online only. To view
these files please visit the
journal online (http://dx.doi.org/
10.1136/gutjnl-2011-301061).
1Department of
Gastroenterology and
Hepatology, University Medical
Center Utrecht, Utrecht, The
Netherlands
2Department of Medical
Diagnostic Sciences and Special
Therapies, Surgical Pathology
and Cytopathology Unit,
University of Padova, Padova,
Italy
3Department of Medicine, UT
Southwestern Medical Center,
Dallas, Texas, USA
4Department of Pathology,
University Medical Center
Utrecht, Utrecht, The
Netherlands
Correspondence to
Jantine W P M van Baal,
Department of Gastroenterology
and Hepatology, F02.816,
University Medical Center
Utrecht, Heidelberglaan 100,
3508 GA Utrecht, The
Netherlands; j.w.p.m.
vanbaal-2@umcutrecht.nl
Revised 1 March 2012
Accepted 3 March 2012
Published Online First
13 April 2012
Significance of this study
What is already known on this subject?
< BMP4 is a key molecule in the development of
Barrett’s oesophagus (BE).
< BMP4 signallinginduces
expression.
< GATA6isableto
expression by activating the BMP4 promotor.
SOX9 mRNA
regulateBMP4 gene
What are the new findings?
< microRNA-145 inhibits GATA6, BMP4 and SOX9
mRNA expression.
< microRNA-145transfection
oesophagus epithelial cells and non-neoplastic
BE cells inhibits BMP4 protein expression and
alters BMP4 signalling over time.
< BMP4 signalling alters miRNA-145 and GATA6
expression.
insquamous
How might it impact on clinical practice in the
foreseeable future?
< This study demonstrates a role for microRNA-
145 in BE development by its effect on BMP4
expression. Future manipulation of the BMP4
pathway by inducing miRNA-145 may assist to
prevent BE development in patients at risk.
Oesophagus
664 Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061
group.bmj.com on April 4, 2013 - Published by gut.bmj.comDownloaded from

Page 2

miRNA microarray which exhibits >700 human miRNAs. The
results found by this microarray analysis were validated using
qRT-PCR in a larger patient population. As miRNA-145 was
found to be highly expressed in BE compared with EAC and
normal squamous epithelium of the oesophagus (SQ), we
determined the effect of miRNA-145 overexpression in a normal
squamous oesophageal cell line (HET-1A) and a non-neoplastic
Barrett’s epithelial cell line (BAR-T) and evaluated in more detail
the functional role of miRNA-145 and its potential role in the
development of BE.
MATERIALS AND METHODS
Biopsy specimens
Tissue samples were obtained during endoscopy of 15 patients
with known EAC in BE (14 men, mean age 69 years (range
47e86); table 1). No patient had undergone treatment with
radiation and/or chemotherapy before endoscopy. In addition,
tissue samples were obtained from nine patients with BE (seven
men, mean age 57 years (range 37e72)). The mean BE segment
was 5.1 cm (range 2e16 cm). All patients were on long-term
proton pump inhibitors in a dose of 40e80 mg daily to prevent
reflux oesophagitis. Details of the biopsy specimens are given in
the online supplement.
For in situ hybridisation (ISH), tissue samples were retrieved
from the Surgical Pathology Unit of the University of Padova
from 10 patients with EAC oesophagectomy (10 EAC, 10 BE and
10 SQ specimens; seven men; mean age 67 years (range 41e84);
table 1). No patient had undergone neoadjuvant therapy before
surgery. The ethical regulations of the Institute on research
conducted on human tissues were followed.
RNA isolation and miRNA microarray
Total RNAwas isolated using miRNeasy Minikit (Qiagen, Venlo,
The Netherlands). Spectrophotometry was performed with 1 ml
total RNA for quantitation on the Nanodrop (type ND-1000,
Wilmington, USA). RNA quality control was performed using
Agilent Bioanalyser 2100. All samples had an excellent 260/280
ratio, 260/230 ratio and RIN value.
The miRNA microarray including labelling, hybridisation,
scanning, normalisation and data analysis was performed by
Exiqon (Vedbaek, Denmark) and is described in the online
supplement.
Microarray statistical analysis
For the analysis, each miRNA signal was transformed to
logarithm base 2 (log2 ratios; Hy3/Hy5; sample/common
reference) and two-tailed t tests were conducted. Fold changes
were measured using mean ratios. miRNAs with a significant
value of #0.01 and fold change values of $2 were listed and
supposed to be differentially expressed between the different
tissues. Clustering and visualisation of differentially expressed
miRNAs was performed using MeV, TM4 Microarray Software
Suite.28 29
Adjustment for multiple testing was performed using
Bonferroni correction, with 293 miRNAs being used for the
statistical analysis. The Bonferroni corrected p value for these
miRNAs was p<1.71*E-04.
Quantitative reverse transcriptase PCR (qRT-PCR) of miRNAs
RT-PCR quantification of miRNA expression was carried out
using the TaqMan MicroRNA Assay kit according to the
manufacturer’s protocol (Applied Biosystems, Foster City,
California, USA). qRT-PCR was based on a stem-loop RT primer
design.30All RTand PCR reactions were performed on a thermal
cycler (iCycler iQ System, BioRad, Hercules, California, USA).
The relative levels of individual miRNAs with reference
to U6snRNA were calculated using the DCt method. All
experiments were done in duplicate and repeated.
Statistical analysis of miRNA expression levels was conducted
using GraphPad Prism Version 4.00, GraphPad software (San
Table 1
(EAC)
Characteristics of patients with oesophageal adenocarcinoma
NumberGender (M/F) Age (years)TNM stageArray/qRT-PCR/ISH
EAC1
EAC2
EAC3
EAC4
EAC5
EAC6
EAC7
EAC8
EAC9
EAC10
EAC11
EAC12
EAC13
EAC14
EAC15
EAC16
EAC17
EAC18
EAC19
EAC20
EAC21
EAC22
EAC23
EAC24
EAC25
M
M
M
M
M
M
M
M
F
M
M
M
M
M
M
M
M
M
M
M
M
M
F
F
F
60
73
57
74
86
71
69
73
77
64
47
61
83
69
67
72
71
41
69
59
84
66
76
64
70
T3N1Mx
T3N0Mx
T1N0Mx
T3N1Mx
T1N0Mx
T1N0Mx
T2N1Mx
T4N1M1a
T1N0Mx
T3N1Mx
T3N1M1a
T1N0Mx
T3N1Mx
T3N1M1a
T3N1Mx
T3N0Mx
T3N1M1a
T1N0Mx
T3N1Mx
T3N0Mx
T2N1Mx
T1N0Mx
T1N0Mx
T2N1Mx
T3N1Mx
Array and qRT-PCR
Array and qRT-PCR
Array and qRT-PCR
Array and qRT-PCR
qRT-PCR
qRT-PCR
qRT-PCR
qRT-PCR
qRT-PCR
qRT-PCR
qRT-PCR
qRT-PCR
qRT-PCR
qRT-PCR
qRT-PCR
ISH
ISH
ISH
ISH
ISH
ISH
ISH
ISH
ISH
ISH
qRT-PCR, quantitative reverse transcriptase PCR; ISH, in situ hybridisation.
Table 2
Antibodies used for western blot analyses
NameCompany
PCNA, PC10
BMP4
ID2, C-20
Phospho-Smad 1/5/8
Smad 1
Actin I-19, goat polyclonal
Santa Cruz Biotechnology, Santa Cruz, California, USA
R&D Systems, Minneapolis, Minnesota, USA
Santa Cruz Biotechnology
Cell Signaling, Boston, Massachusetts, USA
Cell Signaling
Santa Cruz Biotechnology
Table 3
Primer sequences
NameForward primerReverse primerProduct lengthAnnealing
GATA6
BMP4
SOX9
ID2
GCCAACTGTCACACCACAAC
TGAGCCTTTCCAGCAAGTTT
GACCAGTACCCGCACTT
ACTCGCATCCCACTATTGTC
TGGAGTCATGGGAATGGAAT
CTTCCCCGTCTCAGGTATCA
TTCACCGACTTCCTCCG
CGTCCATTCAACTTGTCCTCC
216 bp
179 bp
175 bp
288 bp
538C
57.58C
57.58C
608C
Primer sequences used for quantitative reverse transcriptase PCR with corresponding annealing temperature and PCR product lengths.
Oesophagus
Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061665
group.bmj.com on April 4, 2013 - Published by gut.bmj.com Downloaded from

Page 3

Diego, California, USA). Data are expressed as box plots.
Comparisons between the two groups were analysed using
two-tailed t tests.
ISH
ISH was performed using the GenPoint Catalyzed Signal
Amplification System (DakoCytomation, Carpinteria, Cali-
fornia, USA) according to the manufacturer’s protocol and as
described by Fassan et al.24The slides were pre-hybridised at
49e528C for 1 h with mRNA ISH buffer (Ambion) before
overnight incubation at 49e528C in buffer containing 59-biotin
labelled miR-145 miRCURY LNA detection probe (Exiqon) or the
scrambled negative control probe (Scramble-miR, Exiqon) at
a final concentration of 200 nM.
Cell culture
HET-1A cells were purchased from American Type Culture
Collection (Manassas, Virginia, USA) and grown in EPM2
medium (AthenaES, Baltimore, Maryland, USA) with 100 U/ml
penicillin (Invitrogen, Breda, The Netherlands) and 100 mg/ml
Table 4
Characteristics of microRNA microarray
TissueAccession code
EAC1
EAC2
EAC3
EAC4
BE1
BE2
BE3
BE4
SQ1
SQ2
SQ3
SQ4
GSM741654
GSM741655
GSM741656
GSM741657
GSM741658
GSM741659
GSM741660
GSM741661
GSM741662
GSM741663
GSM741664
GSM741665
Accession codes for the Gene Expression Omnibus website (http://www.
ncbi.nlm.nih.gov/geo/).
BE, Barrett’s oesophagus; EAC, oesophageal adenocarcinoma; SQ,
normal squamous oesophagus.
Figure 1
clustering analysis in oesophageal
adenocarcinoma (EAC), Barrett’s
oesophagus (BE) and normal squamous
oesophagus (SQ). (A) Venn diagram
showing the distribution of microRNA
expression of EAC, BE and SQ. The
specific miRNAs are shown in table 5.
(B) Clustering analysis indicating the
expression of microRNAs in tissue
samples from EAC, BE and SQ. All
microRNAs that were significantly
differentially expressed between the
various tissues and all microRNAs that
were more than twofold upregulated or
downregulated in a comparison the
tissues are shown.
MicroRNA microarray and
Oesophagus
666 Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061
group.bmj.com on April 4, 2013 - Published by gut.bmj.com Downloaded from

Page 4

streptomycin (Invitrogen) according to the provider’s instruc-
tions. Cells were incubated with 200 ng/ml recombinant human
BMP4 (R&D Systems, Minneapolis, Minnesota, USA). Three
independent experiments were performed in duplicate.
BAR-Tcells were kindly provided by Dr R F Souza and grown
in a special supplemented keratinocyte medium (KBM2; Lonza,
Basel, Switzerland) according to the method of Jaiswal et al.31
Transfection experiments
HET-1A and BAR-Tcells were transfected with pre-miR miRNA
precursors and control oligonucleotides (NC#1) using siPORT
NeoFX transfection agent (Ambion) in six-well plates following
the manufacturer’s instructions. miRNA precursors were diluted
in siPORT NeoFX in Opti MEM I (Invitrogen) and added to wells
containing EPM2 medium. Cell pellets were collected for cell
counting using a Coulter counter. All experiments were performed
at least three times in duplicate; one sample was used for total
RNA isolation and the other was used for western blot analysis.
Western blot analysis
Protein samples were extracted with cell lysis buffer (Cell
Signaling, Boston, Massachusetts, USA) containing 1% protease
inhibitor (Sigma, St Louis, Missouri, USA). Cell lysates were
centrifuged at maximum speed for 5 min at 48C. The pellet was
discarded and the protein concentration was measured with the
BCA protein assay kit (Pierce Chemical Co, Rockford, Illinois,
USA). Lysates were diluted 1:1 in protein sample buffer (100 mM
Tris pH 6.8, 2% b-mercaptoethanol, 4% SDS, 0.2% bromphenol
blue, 20% glycerol) and incubated at 958C for 5 min. Samples
were loaded onto SDS-PAGE and subsequently transferred onto
a PVDF membrane (Millipore, Amsterdam, The Netherlands).
The blots were blocked with Odyssey Blocking buffer (Westburg,
Leusden, The Netherlands) diluted 1:1 in phosphate buffered
saline (PBS) and washed with PBS before overnight incubation at
48C with primary antibody (table 2) in Odyssey Blocking buffer
diluted 1:1 in PBS supplemented with 0.1% Tween-20. After
washing, blots were incubated with Alexa Fluor680 conjugated
secondary antibody (Invitrogen). After a final wash, blots were
analysed using an Odyssey scanner (Westburg).
qRT-PCR of mRNAs
Total RNA was isolated using the RNeasy Mini kit (Qiagen).
cDNA from biopsies and cells was synthesised from 1 mg total
RNA using iScript cDNA synthesis kit (BioRad). The PCR
reactions were set up in a volume of 25 ml containing 5 ml diluted
cDNA, 12.5 ml 2xiQ SYBR Green Supermix (BioRad) and
300 nM forward and reverse primer each. The primers (table 3)
were mRNA specific to prevent signal information from
contaminating genomic DNA.
Three endogenous reference genes were measured: GAPDH
(Hs4333764F), b-actin (Hs4333762F) and b-2-microglobulin
(Hs4333766F; Applied Biosystems). Quantification was carried
out using 5 ml diluted cDNA, 12.5 ml 2xiQ Supermix (BioRad)
and 1.25 ml 20xAssay-on-demand gene expression mix.
All cDNA samples were analysed in duplicate. The relative
levels of individual mRNAs with reference to the geometric
mean of the three reference genes were calculated using the DCt
method.32
Statistical analysis of mRNA expression levels was conducted
using GraphPad Prism V.4.00. Data are expressed in box plots.
Comparisons between the two groups were analysed using
two-tailed t tests.
RESULTS
Microarray expression data
Three unique miRNA expression profiles from EAC, BE and SQ
were obtained. The complete miRNA expression profiles can be
found on the Gene Expression Omnibus website (http://www.
ncbi.nlm.nih.gov/geo/, accession code GSE29965) (table 4). A
Venn diagram (figure 1A) shows the distribution of the miRNAs
in EAC, BE and SQ. The diagram shows that three miRNAs
were EAC-specific, two were BE-specific and 11 were SQ-
specific. Comparing the various tissues, we found an overlap of
22 miRNAs when EAC and BE were compared with SQ. No
overlap was found between EAC and SQ compared with BE. The
comparison of BE and SQ with EAC indicated an overlap of four
miRNAs. The specific miRNAs of the Venn diagram are shown
in table 5.
Hierarchical clustering of miRNAs that were found to be more
than twofold upregulated or downregulated or significantly
Table 5
Venn diagram characteristics
SamplemicroRNA ID
EAChsa-miR-214
miRPlus_17952
hsa-miR-199a-5p
hsa-miR-451
hsa-miR-215
miRPlus_17957
hsa-miR-203
hsa-miR-205
hsa-miR-708
hsa-miR-210
hsa-miR-149
hsa-miR-193b
hsa-miR-452
hsa-miR-365
hsa-miR-193a-3p
hsa-miR-33a
hsa-miR-181a
hsa-miR-192
hsa-miR-194
hsa-miR-143
hsa-miR-145
hsa-miR-199a-3p
hsa-miR-223
hsa-miR-199b-3p
hsa-miR-25*
hsa-miR-192*
hsa-miR-144
hsa-miR-133b
hsa-miR-195
hsa-miR-338-3p
hsa-miR-497
hsa-miR-199b-5p
miRPLus_42487
hsa-miR-1
hsa-miR-143*
hsa-miR486-5p
hsa-miR-10a
hsa-miR-424
hsa-miR-148a
hsa-miR-196a
hsa-miR-31
hsa-miR-668
hsa-miR-31*
hsa-miR-378
BE
SQ
EAC and BE
BE and SQ
BE, Barrett’s oesophagus; EAC, oesophageal adenocarcinoma; SQ,
normal squamous oesophagus.
Oesophagus
Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061667
group.bmj.com on April 4, 2013 - Published by gut.bmj.com Downloaded from

Page 5

differentially expressed in a comparison of the different tissues
showed that EAC and BE clustered closer together with SQ
being clustered in a separate group (figure 1B).
Differential expression of miRNAs in EAC, BE and SQ
We first investigated miRNAs that were differentially expressed
in BE and SQ. Twenty-four miRNAs were more than twofold
upregulated in BE compared with SQ and 11 miRNAs were more
than twofold downregulated (see table 1A in online supple-
ment).SixteenmiRNAswere
expressed (p<0.001) in a comparison of BE with SQ, with nine
miRNAs being significantly upregulated and seven down-
regulated in BE compared with SQ (see table 1A in online
supplement). In particular, miRNA-215, 192, 194, 143 and 145
were more highly expressed in BE than in SQ whereas miRNA-
203, 205 and 33a were expressed more highly in SQ than in BE
(see table 1A in online supplement). Upon Bonferroni correction
(using p<1.71*E-04), five miRNAs were significantly differen-
tially expressed, while two miRNAs met the criteria when we
used a Bonferroni corrected p<6.61*E-05 (see table 1A in online
supplement).
Four miRNAs were found to be differentially expressed in
a comparison of EAC and BE; miRNA-214 and 199a-5p were
significantly differentially
more than twofold upregulated and miRNA-451 and 215 more
than twofold downregulated in EAC compared with BE (see
table 1B in online supplement).
Two miRNAs were significantly differentially expressed when
EAC was compared with SQ (p<0.001); miRNA-33a and 193a-
3p were significantly downregulated more than twofold in EAC
compared with SQ (see table 1C in online supplement). Twenty-
three miRNAs were more than twofold upregulated in EAC
compared with SQ and 15 miRNAs were more than twofold
downregulated (see table 1C in online supplement).
qRT-PCR and ISH of EAC, BE and SQ
We validated our microarray results by qRT-PCR using RNA
samples from EAC, BE and SQ biopsies from 15 patients with
EAC. qRT-PCR showed increased expression of miRNA-143,
145, 192, 194 and 215 in BE compared with SQ and EAC (figure
2A). In addition, expression of miRNA-143, 145, 192, 194 and
215 was increased in EAC compared with SQ (figure 2A).
miRNA-214 expression was increased in EAC compared with
BE and SQ (figure 2B). SQ showed increased expression of
miRNA-203 and 205 compared with BE and EAC (figure 2C).
We validated our results by qRT-PCR using RNA samples
from BE and SQ biopsies from nine patients with BE. qRT-PCR
Figure 2
PCR (qRT-PCR) of several microRNAs in
oesophageal adenocarcinoma (EAC), Barrett’s
osophagus (BE) and normal squamous
epithelium (SQ). Validation by qRT-PCR on RNA
from EAC, BE and SQ biopsies taken from
patients with EAC or BE and SQ biopsies taken
from patients with BE. (A) qRT-PCR showed
that miRNA-143, 145, 192, 194 and 215 were
significantly more highly expressed in BE than
in EAC and SQ. In addition, miRNA-143, 145,
192, 194 and 215 expression was expressed
significantly more highly in EAC than in SQ. (B)
miRNA-214 was expressed more highly in EAC
than in BE and SQ. (C) miRNA-203 and 205
were expressed significantly more highly in SQ
than in EAC and BE. (D) qRT-PCR showed
a significantly increased expression of miR-143,
145, 192, 194, 214 and 215 in BE compared
with SQ. (E) miRNA-203 and 205 were
significantly more highly expressed in SQ than
in BE. *p<0.05, **p<0.01, ***p<0.001 (two-
tailed t tests). Data were normalised using
U6snRNA. Values are median with 95% CI.
Quantitative reverse transcriptase
Oesophagus
668 Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061
group.bmj.com on April 4, 2013 - Published by gut.bmj.com Downloaded from

Page 6

analysis showed increased expression of miRNA-143, 145, 192,
194, 214 and 215 in BE compared with SQ (figure 2D). miRNA-
203 and 205 expression was significantly increased in SQ
compared with BE (figure 2E).
These results were further supported by ISH which showed
significant overexpression of miR-145 (grainy brown cyto-
plasmic staining) in BE compared with SQ and EAC (figure 3). In
particular, in all 10 SQ specimens, miR-145 was mainly
expressed at the basal cell layer. In the 10 EAC samples, miR-145
expression was heterogeneous and lower (four cases did not
show any miRNA-145 stain) than that observed in BE speci-
mens, in which a moderate/strong expression was observed in all
cases (figure 3).
miRNA-145 transfection in HET-1A and BAR-T cells
To elucidate the effect of miRNA-145 expression, HET-1A and
BAR-Tcells were transfected with miRNA-145. As a control, we
first determined miRNA-145 expression in untreated HET-1A
and BAR-Tcells by qRT-PCR, which showed a low miRNA-145
expression (median relative expression: HET-1A cells 0.002;
BAR-Tcells 0.005 vs BE biopsies 0.9; SQ biopsies 0.021).
At 48 h after transfection of HET-1A and BAR-T cells
with miRNA-145, the cell count of miRNA-145 transfected
HET-1A and BAR-Tcells was similar to that of cells transfected
with negative control oligonucleotides. At 72 and 96 h after
transfection, a significant decrease in cell count was observed
in HET-1A and BAR-T cells transfected with miRNA-145
compared with negative control oligonucleotide-transfected
HET-1A and BAR-T cells (figure 4A,B). The decrease in cell
count due to miRNA-145 transfection was blocked when
cells were co-transfected with a specific miRNA-145 inhibitor
(figure 4A,B).
To verify these results we analysed proliferating cell nuclear
antigen (PCNA) expression in these cells by western blotting
and found a decreased expression in cells transfected with
miRNA-145 compared with cells transfected with the negative
control (figure 4C). This effect was again blocked when cells
were co-transfected with a specific miRNA-145 inhibitor (figure
4C). These results indicate that proliferation is decreased by
miRNA-145 overexpression in oesophageal cells.
Genes targeted by aberrantly expressed miRNA-145
Using TargetScan, we identified potential target genes for
miRNA-145. Several genes were selected and their expression in
HET-1A cells was measured. Expression of mRNA of IGF-IR,
IRS-1 and TLR4 did not change upon miRNA-145 transfection
in HET-1A cells (data not shown); however, GATA6 showed
a significant decrease in mRNA expression when HET-1A and
BAR-T cells were transfected with miRNA-145 (figure 5A,D).
This was blocked when cells were co-transfected with a specific
miRNA-145 inhibitor, with GATA6 mRNA levels being compa-
rable to the expression level of HET-1A and BAR-T cells trans-
fected with a negative control. These results indicate that
miRNA-145 reduced GATA6 expression in HET-1A and BAR-T
cells.
We subsequently determined BMP4 and SOX9 mRNA
expression. Seventy-two and 96 h after miRNA-145 trans-
fection in HET-1A and BAR-T cells, a significant decrease in
BMP4 and SOX9 mRNA expression was found compared with
cells transfected with negative control (figure 5B,C,E,F). This
effect was blocked when cells were co-transfected with
a specific miRNA-145 inhibitor. In addition, we determined
BMP4 protein expression using western blot analysis. This
showed that BMP4 protein expression was decreased in HET-
1A and BAR-Tcells transfected with miRNA-145 72 h and 96 h
after transfection (figure 6A). This effect was again blocked
when cells were co-transfected with a specific miRNA-145
inhibitor. Subsequent western blot analysis determining the
BMP4 signalling pathway activation showed that SMAD 1/5/8
phosphorylation and ID2 protein expression were decreased
72 h after miRNA-145 transfection compared with cells that
were transfected with a negative control or co-transfected with
a specific miRNA-145 inhibitor (figure 6A). Smad 1 protein
expression was used for normalisation and showed a slight
Figure 3
hybridisation in tissue sections of
oesophageal adenocarcinoma (EAC),
Barrett’s osophagus (BE) and normal
squamous epithelium (SQ).
Representative photographs of miRNA-
145 expression by in situ hybridisation
analysis showed that miRNA-145 is
highly expressed in BE. In SQ
epithelium, miRNA-145 was expressed
mainly by the basal cell layer whereas
moderate/strong miRNA-145
expression was observed in the
epithelium in BE. In EAC tissue samples
miRNA-145 is heterogeneous and
expression was lower than in BE
specimens. The presence of miRNA-145
is shown by a grainy brown
cytoplasmic stain. Counterstain:
haematoxylin (original magnifications
203 and 403).
MicroRNA-145 in situ
Oesophagus
Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061669
group.bmj.com on April 4, 2013 - Published by gut.bmj.com Downloaded from

Page 7

Figure 4
neoplastic Barrett’s epithelial cells (BAR-T) transfected with microRNA-145 (miR-145) precursor showed a significant decrease in cell count 72 h and
96 h after transfection compared with cells transfected with the negative control (NC#1) or cells transfected with miRNA-145 together with the
specific inhibitor (miR-145&Inh). This effect was not seen 48 h after transfection. Values are mean 6 SEM from three independent experiments
performed in duplicate. (C) Western blot analysis of proliferating cell nuclear antigen (PCNA) expression in HET-1A and BAR-T cells which showed that
cells transfected with miRNA-145 (MiR-145) had decreased PCNA expression compared with cells transfected with the negative control (NC#1). This
effect was seen 72 h and 96 h after transfection and was blocked by transfecting the cells with miRNA-145 and a specific inhibitor (MiR-145&Inh).
Actin was used as a control.
MicroRNA-145 transfection in oesophageal epithelial and Barrett’s epithelial cells. (A) Oesophageal epithelial cells (HET-1A) and (B) non-
Oesophagus
670 Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061
group.bmj.com on April 4, 2013 - Published by gut.bmj.comDownloaded from

Page 8

decrease 72 h after miRNA-145 transfection. Taken together,
this indicates a decreased activation of the BMP4 signalling
pathway. Despite decreased BMP4 and GATA6 expression
levels, 96 h after miRNA-145 transfection the BMP4 signalling
pathway was activated. This was shown by the SMAD 1/5/8
phosphorylation and ID2 expression in HET-1A and BAR-Tcells
transfected with miRNA-145, which is comparable to cells
transfected with negative control or co-transfected with
a specific miRNA-145 inhibitor (figure 6A). Smad 1 protein
expression showed a similar expression pattern upon miRNA-
145 transfection. We confirmed this by performing qRT-PCR
analysis and found that ID2 mRNA expression was decreased
72 h after transfection of miRNA-145; however, 96 h after
transfection, ID2 mRNA expression was increased compared
with cells that were transfected with negative control or
transfectedwith miRNA-145
inhibitor (figure 6B,C).
Next, we attempted to determine the effect of miRNA-145
and GATA6 mRNA expression on BMP4 signalling in HET-1A
cells. HET-1A cells were incubated for various time intervals
with recombinant human BMP4 and miRNA-145 expression
was found to be decreased when HET-1A cells were incubated
with BMP4 for 20 min, 1, 2 and 5 h (figure 7A). HET-1A cells
incubated with BMP4 for 24 h showed a significantly increased
miRNA-145 expression. GATA6
increased upon BMP4 incubation for 20 min, 1, 2 and 5 h.
togetherwith thespecific
mRNAexpression was
HET-1A cells incubated with BMP4 for 24 h showed a decreased
GATA6 mRNA expression level (figure 7B). As a control for
BMP4 signal transduction pathway activation, we determined
ID2 mRNA expression upon BMP4 incubation in HET-1A cells
and found that ID2 was highly expressed (figure 7C).
DISCUSSION
In this study we found differential miRNA expression between
EAC, BE and SQ with specific miRNAs being highly expressed in
EAC, BE and SQ. We also studied the functional role of one of
these miRNAs (miRNA-145) which was found to be highly
expressed in BE (figures 2A,D and 3). miRNA-145 precursors
were transfected in the oesophageal HET-1A and BAR-Tcell lines
and a decrease in cell proliferation was found 72 and 96 h
after miRNA-145 transfection (figure 4). In addition, we showed
that miRNA-145 inhibits GATA6, BMP4 and SOX9 expression
(figure 5).
Several miRNAs that were found to be highly expressed in BE
were also expressed more highly in EAC than in SQ. The Venn
diagram showed an overlap of 22 miRNAs that were more than
twofold upregulated in EAC and BE compared with SQ (figure
1A and table 5). One of these miRNAs, miRNA-145, had
a mean6SEM expression in BE of 0.9660.15, in EAC of
0.4760.15 and in SQ of 0.0360.01 (qRT-PCR data). Together
with the clustering analysis, these results indicate that, on the
miRNA level, EAC and BE are more closely related to each other
Figure 5
mRNA expression in transfected
oesophageal epithelial cells (HET-1A)
and non-neoplastic Barrett’s epithelial
cells (BAR-T). HET-1A cells transfected
with miRNA-145 (miR-145) showed
a decrease in expression of (A) GATA6,
(B) BMP4 and (C) SOX9 compared with
cells transfected with the negative
control (NC#1) or those transfected
with miRNA-145 together with the
specific inhibitor (miR-145&Inh).
Transfection experiments using BAR-T
cells showed a similar decrease in
expression of (D) GATA6, (E) BMP4 and
(F) SOX9 when cells were transfected
with miRNA-145 (miR-145) compared
with cells transfected with negative
control (NC#1) or cells transfected
with miRNA-145 together with the
specific inhibitor (miR-145&Inh). These
effects were seen 72 h and 96 h after
transfection. *p<0.05, **p<0.01,
***p<0.001 (two-tailed t tests).
GAPDH and b2-microglobulin were used
for normalisation. Values are median
with 95% CI.
GATA6, BMP4 and SOX9
Oesophagus
Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061671
group.bmj.com on April 4, 2013 - Published by gut.bmj.comDownloaded from

Page 9

than to SQ (figure 1B). This has previously been shown at the
mRNA level, with the gene expression pattern of BE being more
associated with EAC than with SQ.33
In previous studies, several miRNAs have been identified in
EAC, BE and SQ.23e27One study analysed the miRNA expres-
sion profiles of EAC, BE and SQ cell lines.21In other studies,
tissue samples from EAC, BE and SQ were used for miRNA
expression profile analysis.20 23e25Feber et al used an Ambion
miRNA microarray that exhibited 328 human miRNAs.20The
obtained data were not confirmed by qRT-PCR. Using these
high throughput techniques as microarray analysis, it is strongly
recommended that follow-up studies are performed using addi-
tional techniques to confirm expression.34Several differentially
expressed miRNAs in their study were, however, also found in
our study; in particular, miRNA-203 and 205 were expressed
more highly in SQ tissue than in EAC and miRNA-192 and 194
were expressed more highly in EAC than in SQ. Yang et al
performed a miRNA microarray and qRT-PCR to analyse
miRNA expression profiles in BE tissue (with low-grade or high-
grade dysplasia) and in EAC tissue.22They used an Agilent
miRNA microarray exhibiting 470 human miRNAs and found
that miRNA-203, 205 and 210 were highly expressed in SQ,
which was also found in our study. In addition, they found that
miRNA-143, 145, 195, 199A, 199A*, 199B and 424 were more
highly expressed in high-grade dysplasia and EAC than in SQ.22
We confirmed the high expression levels of these miRNAs in
EAC and found that they were also highly expressed in BE
without dysplasia. In our study we used an Exiqon miRNA
microarray exhibiting more than 700 human miRNAs and
confirmed the expression of eight miRNAs in a larger patient
group. Moreover, we also identified other miRNAs that were
previously not known to be expressed in EAC or BE (eg, miRNA-
214 was found to be highly expressed in EAC and miRNA-215
was highly expressed in BE).
miRNA-145 expression has been reported to be down-
regulatedin differenttypes
cancer.35e37Like normal colon tissue, BE is a columnar type of
tissue also expressing miRNA-145. Moreover, in colon cancer,
decreased miRNA-145 expression levels have been reported.35e37
Our results show that miRNA-145 expression was increased in
EAC compared with SQ but decreased in EAC compared with
BE, the premalignant columnar type of tissue in the oesophagus.
Therefore, miRNA-145 may have a similar function in neoplastic
development in the colon and in Barrett’s epithelium. Previous
studies have suggested that miRNA-145 plays a role in the
differentiationprocesses but
functions.38e40We therefore decided to analyse miRNA-145
expression in EAC, BE and SQ tissues by ISH and to evaluate the
potential functional role of miRNA-145 during the development
of BE.
ofcancers includingcolon
also hastumour-suppressor
Figure 5
Continued
Oesophagus
672 Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061
group.bmj.com on April 4, 2013 - Published by gut.bmj.comDownloaded from

Page 10

GATA6 is one of the GATA proteins of transcription factors
which are critical during embryogenesis, regulating proliferation,
differentiation and gene expression in multiple organs.41
Compared with SQ, GATA6 expression was found to be
increased in BE and was even higher in EAC.42 43This finding
was confirmed in our study (data not shown). Recently, GATA6
was shown to be required for intestinal proliferation and
differentiation.44In addition, a direct downstream target for
GATA6, the BMP4 gene, was found. By activating the BMP4
promotor, GATA6 is able to regulate BMP4 gene expression.45In
previous studies, BMP4 and the BMP signal transduction
pathway were reported to be highly expressed and activated in
BE compared with SQ.8 9These studies also suggested that
BMP4 signalling was relevant for BE development.9In addition,
BMP4 signalling can induce SOX9 expression.46Based on these
and other studies, it is assumed that gastro-oesophageal reflux of
bile and acid triggers an inflammatory response, inducing
morphogens and enteroendocrine factors such as BMP4, CDX-2
and SOX9.46e48These factors are involved in the transition from
SQ to the columnar phenotype of BE.46e48Our study suggests
that miRNA-145 and GATA6 may well be involved in this
process, with miRNA-145 targeting BMP4 and subsequent
SOX9 expression via GATA6. Recently, Lin et al reported that
miRNA-145 expression was altered upon activation of the BMP
signal transduction pathway, suggesting a feedback from BMP
on miRNA-145 expression.49We therefore investigated the effect
of BMP4 incubation in HET-1A cells and found that miRNA-145
expression was decreased upon BMP4 incubation for 20 min, 1, 2
and 5 h while GATA6 mRNA expression was increased. BMP4
incubation for 24 h showed increased miRNA-145 expression
and GATA6 mRNA expression levels were back to base levels. It
is known that miRNAs can act as signalling balancers and
buffersdthat is, they are able to regulate the relative expression
levels to realise optimal signalling efficacy and to limit undesired
signalling fluctuations.50
Based on these findings, we
hypothesise that miRNA-145 functions as a balancer, reducing
51
Figure 6
and Barrett’s epithelial cells (BAR-T) transfected with miRNA-145 (miR-145) had decreased BMP4 protein expression compared with cells transfected
with the negative control (NC#1). This effect was seen 72 h and 96 h after transfection and was blocked when cells were transfected with miRNA-145
together with the specific inhibitor (MiR-145&Inh). ID2 protein expression and Smad 1/5/8 phosphorylation were decreased 72 h after miRNA-145
transfection compared with cells transfected with the negative control or cells co-transfected with miRNA-145 together with the specific inhibitor.
Ninety-six hours after transfection, ID2 protein expression and Smad 1/5/8 phosphorylation of cells transfected with miRNA-145 were comparable to
cells transfected with negative control or those transfected with miRNA-145 and the specific inhibitor. Smad 1 was used to normalise Smad 1/5/8
phosphorylation. Western blot analysis showed that Smad 1 expression levels were not changed on miRNA-145 transfection 96 h after transfection;
a slight decrease in Smad 1 expression was found 72 h after transfection. Actin was used as control. Quantitative reverse transcriptase PCR analysis
(qRT-PCR) showed that ID2 mRNA expression was decreased 72 h after HET-1A (B) and BAR-T (C) cells were transfected with miRNA-145 (miR-145)
compared with cells transfected with the negative control (NC#1). This effect was blocked when cells were transfected with miRNA-145 together
with the specific inhibitor (miR-145&Inh). Ninety-six hours after transfection, qRT-PCR analysis showed that ID2 mRNA expression was increased in
HET-1A and BAR-T cells transfected with miRNA-145 (miR-145) compared with cells transfected with the negative control (NC#1) or cells co-
transfected with the specific inhibitor (miR-145&Inh). *p<0.05, **p<0.01 (two-tailed t tests). GAPDH and b2-microglobulin were used for
normalisation. Values are median with 95% CI.
BMP4 expression and BMP4 signalling pathway activation. (A) Western blot analysis showed that oesophageal epithelial cells (HET-1A)
Oesophagus
Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061673
group.bmj.com on April 4, 2013 - Published by gut.bmj.comDownloaded from

Page 11

the absolute levels of GATA6 and BMP4. Nonetheless, GATA6
and BMP4 are still expressed, meaning that expression levels are
‘dampened’ by miRNA-145. miRNA-145 is involved in regu-
lating BMP4 expression via inhibition of GATA6, sustaining the
presence of a columnar epithelium. When BMP4 expression is
increased, miRNA-145 expression is altered, targeting BMP4
expression via GATA6, resulting in altered BMP4 signalling over
time. We believe that these molecules preserve an intestinal type
of tissue, preventing the development of EAC.
In summary, the identification of miRNAs exclusively
expressed in EAC, BE and SQ may have important clinical
implications as these may be useful as tissue markers. The
diagnostic and prognostic potential of these miRNAs needs to be
studied in larger patient cohorts. The present analysis also
provides other knowledge, particularly identifying miRNAs that
may be involved in the metaplastic and neoplastic process in the
oesophagus. In addition, this study suggests a role for miRNA-
145 in the development of BE by its effect on BMP4 protein
expression. Future manipulation of the BMP pathway by
targeting miRNA-145 may help to prevent the development of
BE in patients at risk and subsequently the progression towards
EAC. However, further work is needed to explore the possible
therapeutic role of miRNA-145.
Contributors JWPMB: study concept and design, analysis and interpretation of data,
statistical analysis, drafting of the manuscript. PB, REV, FJK: technical support. MF,
RHS, MR: technical and material support. FPV: material support. PDS: study
supervision, material support, critical revision.
Competing interests None.
Patient consent Obtained.
Ethics approval Ethical approval was obtained from the Medical Ethical Committees
of the UMC Utrecht, The Netherlands and University of Padova, Italy.
Provenance and peer review Not commissioned; externally peer reviewed.
Data sharing statement All authors have read the manuscript, agree to its
submission and are willing to share the data written in this manuscript.
REFERENCES
1.
Haggitt RC, Tryzelaar J, Ellis FH, et al. Adenocarcinoma complicating columnar
epithelium-lined (Barrett’s) esophagus. Am J Clin Pathol 1978;70:1e5.
2.
Spechler SJ, Zeroogian JM, Antonioli DA, et al. Prevalence of metaplasia at the
gastro-oesophageal junction. Lancet 1994;344:1533e6.
3.
Ransford RA, Jankowski JA. Genetic versus environmental interactions in the
oesophagitis-metaplasia-dysplasia-adenocarcinoma sequence (MCS) of Barrett’s
oesophagus. Acta Gastroenterol Belg 2000;63:18e21.
Shaheen NJ, Crosby MA, Bozymski EM, et al. Is there publication bias in
the reporting of cancer risk in Barrett’s esophagus? Gastroenterology
2000;119:333e8.
Drewitz DJ, Sampliner RE, Garewal HS. The incidence of adenocarcinoma in
Barrett’s esophagus: a prospective study of 170 patients followed for 4.8 years. Am J
Gastroenterol 1997;92:212e15.
Hameeteman W, Tytgat GN, Houthoff HJ, et al. Barrett’s esophagus: development
of dysplasia and adenocarcinoma. Gastroenterology 1989;96:1249e56.
van Soest EM, Dieleman JP, Siersema PD, et al. Increasing incidence of Barrett’s
oesophagus in the general population. Gut 2005;54:1062e6.
van Baal JW, Milano F, Rygiel AM, et al. A comparative analysis by SAGE of gene
expression profiles of Barrett’s esophagus, normal squamous esophagus, and gastric
cardia. Gastroenterology 2005;129:1274e81.
Milano F, van Baal JW, Buttar NS, et al. Bone morphogenetic protein 4 expressed in
esophagitis induces a columnar phenotype in esophageal squamous cells.
Gastroenterology 2007;132:2412e21.
van Baal JW, Diks SH, Wanders RJ, et al. Comparison of kinome profiles of
Barrett’s esophagus with normal squamous esophagus and normal gastric cardia.
Cancer Res 2006;66:11605e12.
Hao Y, Triadafilopoulos G, Sahbaie P, et al. Gene expression profiling reveals stromal
genes expressed in common between Barrett’s esophagus and adenocarcinoma.
Gastroenterology 2006;131:925e33.
Selaru FM, Zou T, Xu Y, et al. Global gene expression profiling in Barrett’s
esophagus and esophageal cancer: a comparative analysis using cDNA microarrays.
Oncogene 2002;21:475e8.
van Baal JW, Milana F, Rygiel AM, et al. A comparative analysis by SAGE of gene
expression profiles of esophageal adenocarcinoma and esophageal squamous cell
carcinoma. Cell Oncol 2008;30:63e75.
Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell
2004;116:281e97.
Ambros V. The functions of animal microRNAs. Nature 2004;431:350e5.
Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer
2006;6:857e66.
Wienholds E, Plasterk RH. MicroRNA function in animal development. FEBS Lett
2005;579:5911e22.
Esquela-Kerscher A, Slack FJ. Oncomirs - microRNAs with a role in cancer. Nat
Rev Cancer 2006;6:259e69.
Lu J, Getz G, Miska EA, et al. MicroRNA expression profiles classify human cancers.
Nature 2005;435:834e8.
Feber A, Xi L, Luketich JD, et al. MicroRNA expression profiles of esophageal
cancer. J Thorac Cardiovasc Surg 2008;135:255e60.
Kan T, Sato F, Ito T, et al. The miR-106b-25 polycistron, activated by genomic
amplification, functions as an oncogene by suppressing p21 and Bim.
Gastroenterology 2009;136:1689e700.
Yang H, Gu J, Wang KK, et al. MicroRNA expression signatures in Barrett’s
esophagus and esophageal adenocarcinoma. Clin Cancer Res 2009;15:5744e52.
Wijnhoven BP, Hussey DJ, Watson DI, et al. MicroRNA profiling of Barrett’s
oesophagus and oesophageal adenocarcinoma. Br J Surg 2010;97:853e61.
Fassan M, Volinia S, Palatini J, et al. MicroRNA expression profiling in human
Barrett’s carcinogenesis. Int J Cancer 2011;129:1661e70.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
Figure 7
PCR (qRT-PCR) analysis of miRNA-145 in HET-1A cells incubated with BMP4. miRNA-145 expression decreased upon BMP4 incubation in HET-1A
cells. This effect was seen after 20 min, 1 h, 2 h and 5 h incubation with BMP4. miRNA-145 expression was significantly increased in HET-1A cells
incubated with BMP4 for 24 h. (B) GATA6 qRT-PCR analysis of HET-1A cells incubated for 20 min, 1 h, 2 h and 5 h with BMP4 showed increased
GATA6 mRNA expression. GATA6 expression levels were decreased again when HET-1A cells were incubated with BMP4 for 24 h. (C). ID2 qRT-PCR
analysis of HET-1A cells incubated with BMP4 showed significantly increased ID2 mRNA expression. This effect was seen when HET-1A cells were
incubated with BMP4 for 20 min, 1 h, 2 h, 5 h and 24 h. miRNA data were normalised using U6snRNA, mRNA data were normalised using GAPDH and
b2-microglobulin. *p<0.05, **p<0.01, ***p<0.001 (two-tailed t tests). For statistical comparisons T¼0 was used. Values are mean 6 SEM from
three independent experiments performed in duplicate.
Effect of BMP4 signalling on miRNA-145, GATA6 and ID2 in oesophageal epithelial cells (HET-1A). (A) Quantitative reverse transcriptase
Oesophagus
674Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061
Funding PDS received unrestricted research grant support from AstraZeneca BV
and Janssen BV.
group.bmj.com on April 4, 2013 - Published by gut.bmj.comDownloaded from

Page 12

25.
Bansal A, Lee IH, Hong X, et al. Feasibility of MicroRNAs as biomarkers for Barrett’s
Esophagus progression: a pilot cross-sectional, phase 2 biomarker study. Am J
Gastroenterol 2011;106:1055e63.
Mathe EA, Nguyen GH, Bowman ED, et al. MicroRNA expression in squamous cell
carcinoma and adenocarcinoma of the esophagus: associations with survival. Clin
Cancer Res 2009;15:6192e200.
Kan T, Meltzer SJ. MicroRNAs in Barrett’s esophagus and esophageal
adenocarcinoma. Curr Opin Pharmacol 2009;9:727e32.
Saeed AI, Bhagabati NK, Braisted JC, et al. TM4 microarray software suite.
Methods Enzymol 2006;411:134e93.
Saeed AI, Sharov V, White J, et al. TM4: a free, open-source system for microarray
data management and analysis. Biotechniques 2003;34:374e8.
Chen C, Ridzon DA, Broomer AJ, et al. Real-time quantification of microRNAs by
stem-loop RT-PCR. Nucleic Acids Res 2005;33:e179.
Jaiswal KR, Morales CP, Feagins LA, et al. Characterization of telomerase-immortalized,
non-neoplastic, human Barrett’s cell line (BAR-T). Dis Esophagus 2007;20:256e64.
Vandesompele J, De Preter K, Pattyn F, et al. Accurate normalization of real-time
quantitative RT-PCR data by geometric averaging of multiple internal control genes.
Genome Biol 2002;3:RESEARCH0034.
Wang S, Zhan M, Yin J, et al. Transcriptional profiling suggests that Barrett’s
metaplasia is an early intermediate stage in esophageal adenocarcinogenesis.
Oncogene 2006;25:3346e56.
van Baal JW, Krishnadath KK. High throughput techniques for characterizing the
expression profile of Barrett’s esophagus. Dis Esophagus 2008;21:634e40.
Akao Y, Nakagawa Y, Naoe T. MicroRNA-143 and -145 in colon cancer. DNA Cell
Biol 2007;26:311e20.
Bandres E, Cubedo E, Agirre X, et al. Identification by Real-time PCR of 13 mature
microRNAs differentially expressed in colorectal cancer and non-tumoral tissues. Mol
Cancer 2006;5:29.
Michael MZ, O’ Connor SM, van Holst Pellekaan NG, et al. Reduced accumulation
of specific microRNAs in colorectal neoplasia. Mol Cancer Res 2003;1:882e91.
Gregersen LH, Jacobsen AB, Frankel LB, et al. MicroRNA-145 targets YES and
STAT1 in colon cancer cells. PLoS One 2010;5:e8836.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
Xu N, Papagiannakopoulos T, Pan G, et al. MicroRNA-145 regulates OCT4, SOX2,
and KLF4 and represses pluripotency in human embryonic stem cells. Cell
2009;137:647e58.
Cordes KR, Sheehy NT, White MP, et al. miR-145 and miR-143 regulate smooth
muscle cell fate and plasticity. Nature 2009;460:705e10.
Molkentin JD. The zinc finger-containing transcription factors GATA-4, -5, and -6.
Ubiquitously expressed regulators of tissue-specific gene expression. J Biol Chem
2000;275:38949e52.
Kimchi ET, Posner MC, Park JO, et al. Progression of Barrett’s metaplasia to
adenocarcinoma is associated with the suppression of the transcriptional programs
of epidermal differentiation. Cancer Res 2005;65:3146e54.
Haveri H, Westerholm-Ormio M, Lindfors K, et al. Transcription factors GATA-4 and
GATA-6 in normal and neoplastic human gastrointestinal mucosa. BMC Gastroenterol
2008;8:9.
Beuling E, Baffour-Awuah NY, Stapleton KA, et al. GATA factors regulate
proliferation, differentiation, and gene expression in small intestine of mature mice.
Gastroenterology 2011;140:1219e29.e1e2.
Nemer G, Nemer M. Transcriptional activation of BMP-4 and regulation of
mammalian organogenesis by GATA-4 and -6. Dev Biol 2003;254:131e48.
Wang DH, Clemons NJ, Miyashita T, et al. Aberrant epithelial-mesenchymal
Hedgehog signaling characterizes Barrett’s metaplasia. Gastroenterology
2010;138:1810e22.
Krishnadath KK. Novel findings in the pathogenesis of esophageal columnar
metaplasia or Barrett’s esophagus. Curr Opin Gastroenterol 2007;23:440e5.
di Pietro M, Fitzgerald RC. Barrett’s oesophagus: an ideal model to study cancer
genetics. Hum Genet 2009;126:233e46.
Lin EA, Kong L, Bai XH, et al. miR-199a, a bone morphogenic protein 2-responsive
microRNA, regulates chondrogenesis via direct targeting to Smad1. J Biol Chem
2009;284:11326e35.
Choi WY, Giraldez AJ, Schier AF. Target protectors reveal dampening and balancing
of nodal agonist and antagonist by miR-430. Science 2007;318:271e4.
Inui M, Martello G, Piccolo S. MicroRNA control of signal transduction. Nat Rev Mol
Cell Biol 2010;11:252e63.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
PAGE fraction trail=11.5
Oesophagus
Gut 2013;62:664–675. doi:10.1136/gutjnl-2011-301061675
group.bmj.com on April 4, 2013 - Published by gut.bmj.com Downloaded from

Page 13

doi: 10.1136/gutjnl-2011-301061
2013 62: 664-675 originally published online April 13, 2012Gut

Jantine W P M van Baal, Romy E Verbeek, Pauline Bus, et al.
regulating BMP4 signalling via GATA6
microRNA-145 in Barrett's oesophagus:

http://gut.bmj.com/content/62/5/664.full.html
Updated information and services can be found at:
These include:
References

http://gut.bmj.com/content/62/5/664.full.html#ref-list-1
This article cites 50 articles, 11 of which can be accessed free at:
service
Email alerting
the box at the top right corner of the online article.
Receive free email alerts when new articles cite this article. Sign up in
Collections
Topic
(264 articles) Oesophageal cancer
?

Articles on similar topics can be found in the following collections
Notes

http://group.bmj.com/group/rights-licensing/permissions
To request permissions go to:

http://journals.bmj.com/cgi/reprintform
To order reprints go to:

http://group.bmj.com/subscribe/
To subscribe to BMJ go to:
group.bmj.com on April 4, 2013 - Published by gut.bmj.com Downloaded from