NUP-1 Is a large coiled-coil nucleoskeletal protein in trypanosomes with lamin-like functions.

Abstract

A unifying feature of eukaryotic nuclear organization is genome segregation into transcriptionally active euchromatin and transcriptionally repressed heterochromatin. In metazoa, lamin proteins preserve nuclear integrity and higher order heterochromatin organization at the nuclear periphery, but no non-metazoan lamin orthologues have been identified, despite the likely presence of nucleoskeletal elements in many lineages. This suggests a metazoan-specific origin for lamins, and therefore that distinct protein elements must compose the nucleoskeleton in other lineages. The trypanosomatids are highly divergent organisms and possess well-documented but remarkably distinct mechanisms for control of gene expression, including polycistronic transcription and trans-splicing. NUP-1 is a large protein localizing to the nuclear periphery of Trypanosoma brucei and a candidate nucleoskeletal component. We sought to determine if NUP-1 mediates heterochromatin organization and gene regulation at the nuclear periphery by examining the influence of NUP-1 knockdown on morphology, chromatin positioning, and transcription. We demonstrate that NUP-1 is essential and part of a stable network at the inner face of the trypanosome nuclear envelope, since knockdown cells have abnormally shaped nuclei with compromised structural integrity. NUP-1 knockdown also disrupts organization of nuclear pore complexes and chromosomes. Most significantly, we find that NUP-1 is required to maintain the silenced state of developmentally regulated genes at the nuclear periphery; NUP-1 knockdown results in highly specific mis-regulation of telomere-proximal silenced variant surface glycoprotein (VSG) expression sites and procyclin loci, indicating a disruption to normal chromatin organization essential to life-cycle progression. Further, NUP-1 depletion leads to increased VSG switching and therefore appears to have a role in control of antigenic variation. Thus, analogous to vertebrate lamins, NUP-1 is a major component of the nucleoskeleton with key roles in organization of the nuclear periphery, heterochromatin, and epigenetic control of developmentally regulated loci.

Full text

Page 1

NUP-1 Is a Large Coiled-Coil Nucleoskeletal Protein in
Trypanosomes with Lamin-Like Functions
Kelly N. DuBois1, Sam Alsford2, Jennifer M. Holden1, Johanna Buisson3, Michal Swiderski4, Jean-
Mathieu Bart5, Alexander V. Ratushny6,7, Yakun Wan6¤, Philippe Bastin3, J. David Barry4,
Miguel Navarro5, David Horn2, John D. Aitchison6,7, Michael P. Rout8, Mark C. Field1*
1Department of Pathology, University of Cambridge, Cambridge, United Kingdom, 2London School of Hygiene & Tropical Medicine, London, United Kingdom,
3Trypanosome Cell Biology Unit, Pasteur Institute and Centre National de la Recherche Scientifique, Paris, France, 4Wellcome Trust Center for Molecular Parasitology,
University of Glasgow, Glasgow, United Kingdom, 5Instituto de Parasitologı ´a y Biomedicina Lo ´pez-Neyra, Consejo Superior de Investigaciones Cientificas, Granada, Spain,
6The Institute for Systems Biology, Seattle, Washington, United States of America, 7Seattle Biomedical Research Institute, Seattle, Washington, United States of America,
8The Rockefeller University, New York, New York, United States of America
Abstract
A unifying feature of eukaryotic nuclear organization is genome segregation into transcriptionally active euchromatin and
transcriptionally repressed heterochromatin. In metazoa, lamin proteins preserve nuclear integrity and higher order
heterochromatin organization at the nuclear periphery, but no non-metazoan lamin orthologues have been identified,
despite the likely presence of nucleoskeletal elements in many lineages. This suggests a metazoan-specific origin for lamins,
and therefore that distinct protein elements must compose the nucleoskeleton in other lineages. The trypanosomatids are
highly divergent organisms and possess well-documented but remarkably distinct mechanisms for control of gene
expression, including polycistronic transcription and trans-splicing. NUP-1 is a large protein localizing to the nuclear
periphery of Trypanosoma brucei and a candidate nucleoskeletal component. We sought to determine if NUP-1 mediates
heterochromatin organization and gene regulation at the nuclear periphery by examining the influence of NUP-1
knockdown on morphology, chromatin positioning, and transcription. We demonstrate that NUP-1 is essential and part of a
stable network at the inner face of the trypanosome nuclear envelope, since knockdown cells have abnormally shaped
nuclei with compromised structural integrity. NUP-1 knockdown also disrupts organization of nuclear pore complexes and
chromosomes. Most significantly, we find that NUP-1 is required to maintain the silenced state of developmentally
regulated genes at the nuclear periphery; NUP-1 knockdown results in highly specific mis-regulation of telomere-proximal
silenced variant surface glycoprotein (VSG) expression sites and procyclin loci, indicating a disruption to normal chromatin
organization essential to life-cycle progression. Further, NUP-1 depletion leads to increased VSG switching and therefore
appears to have a role in control of antigenic variation. Thus, analogous to vertebrate lamins, NUP-1 is a major component
of the nucleoskeleton with key roles in organization of the nuclear periphery, heterochromatin, and epigenetic control of
developmentally regulated loci.
Citation: DuBois KN, Alsford S, Holden JM, Buisson J, Swiderski M, et al. (2012) NUP-1 Is a Large Coiled-Coil Nucleoskeletal Protein in Trypanosomes with Lamin-
Like Functions. PLoS Biol 10(3): e1001287. doi:10.1371/journal.pbio.1001287
Academic Editor: Tom Misteli, National Cancer Institute, United States of America
Received October 25, 2011; Accepted February 7, 2012; Published March 27, 2012
Copyright: ? 2012 DuBois et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was funded by the Wellcome Trust (grant numbers 082813, 093010, and 055558) to MCF, MPR, DH, and JDB; and the US National Institutes of
Health (grant number P50 GM076547 to JDA and U54 RR022220 to JDA and MPR). MN and JMB were supported by MICINN grant (SAF2009-07587). The Wellcome
Trust Centre for Molecular Parasitology is supported by core funding from the Wellcome Trust (grant number 085349). The funders had no role in study design,
data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
Abbreviations: BSF, bloodstream form; ES, expression site; FISH, fluorescence in situ hybridization; NE, nuclear envelope; NPC, nuclear pore complex; NPT,
neomycin phosphotransferase; PCF, procyclic form; PLK, polo-like kinase; VSG, variant surface glycoprotein
* E-mail: mcf34@cam.ac.uk
¤ Current address: The Key Laboratory of Developmental Genes and Human Disease, Ministry of Education, Institute of Life Science, Southeast University, Nanjing,
China
Introduction
Eukaryotic genomes are primarily organized as linear chromo-
somes and further segregated into transcriptionally active
euchromatin and repressed heterochromatin [1–3]. In metazoa
such chromatin organization requires the coiled-coil lamins,
intermediate filament proteins that form a stable meshwork
between the nuclear envelope (NE) and nuclear matrix, physically
associating with peripheral heterochromatin [2,4,5]. Lamins
directly participate in nuclear pore complex (NPC) positioning,
maintenance of nuclear structure, spindle assembly, and control of
developmental gene expression programs [6–9]. Lamins also
function in positioning of the nucleus within the cell, and nuclear
reassembly following mitotic NE vesiculation in open mitosis [10–
13]. In humans, aberrant lamin protein structure or expression
can lead to irregular nuclei and inappropriate gene expression,
manifesting as pathological laminopathies, including progeria and
muscular dystrophies [14]. Remarkably, no lamin orthologues had
PLoS Biology | www.plosbiology.org1March 2012 | Volume 10 | Issue 3 | e1001287

Page 2

been identified in non-metazoa [15]. Moreover in yeasts, lamins
and a major nucleoskeleton are clearly absent, despite the presence
of apparent heterochromatin [16]. Together, this implies that the
lamin-dependent mechanisms of heterochromatin organization in
metazoan cells are a lineage-specific feature, and have evolved
relatively recently, following the split between the animals and
fungi [17].
Nevertheless, structures morphologically resembling nuclear
peripheral heterochromatin and a lamina have been described in
several divergent eukaryotic lineages, but their molecular basis has
remained elusive [18–20]. For plants, for example, equivocal
evidence is suggestive of the presence of a lamina-like nucleoske-
letal structure (discussed in [21]). Further, heterochromatin is also
tethered to the nuclear envelope of plants, and at least one
candidate nucleoskeletal protein, NMP-1, has been identified.
NMP-1 is a 36 kDa predominantly alpha-helical protein that
associates with the nuclear matrix, but remains functionally
uncharacterized, and is also likely plant specific [22].
Trypanosomatids are highly divergent organisms, whose origins
may even lie close to the Eukaryotic root. Their mode of
transcriptional control is highly unusual and, for the most part,
independent of conventional promoter control, relying instead on
polycistronic transcription and trans-splicing. Trypanosomes have
structures reminiscent of a peripheral nucleoskeleton, while they
also possess prominent heterochromatin-like material at the
nuclear periphery that is implicated in control of gene expression
[23]. The African trypanosome T. brucei is an obligate parasite
living primarily in the blood, lymphatics, and cerebrospinal fluid
when in the mammalian host (bloodstream form; BSF) and in the
midgut and salivary glands in the Tsetse fly (procyclic form; PCF).
The very different environments encountered by the parasite
between these two hosts demand rapid and complex transcrip-
tional changes. Further, the trypanosome cell cycle is highly
coordinated, with precisely ordered division of organelles and
suborganelles [24] and nuclear DNA elements. In trypanosomes
these consist of 11 pairs of conventional megabase chromosomes
harbouring the majority of protein coding genes plus dozens of
unusual lower molecular weight minichromosomes containing
mainly VSG genes. These two classes of chromosome segregate
during mitosis with differential kinetics, location, and possibly also
mechanism [25].
The BSF has a sophisticated system for immune evasion based
on antigenic variation via expression at high copy number of a
single variant surface glycoprotein (VSG). Periodic switching of the
active VSG gene prevents elimination of the entire parasite
population by allowing a subpopulation to escape the host
immune response. VSG expression is tightly controlled to ensure
monoallelic expression and takes place exclusively from telomere-
proximal expression sites (ESs). An ES is present at many of the
megabase chromosome telomeric regions. Further, VSG is
developmentally regulated; the procyclic stage expresses only a
second dominant surface protein, named procyclin. In contrast to
higher eukaryotes, with largely promoter-controlled gene systems,
trypanosome megabase chromosomes are organized into extensive
polycistronic units, and mRNA levels are chiefly regulated by post-
transcriptional mechanisms [26,27]. However, trypanosomatids
do possess chromatin subcompartments implicated in the control
of gene expression. In T. brucei, electron dense heterochromatin
encompassing telomeric regions is largely restricted to the nuclear
periphery. Critically, in BSFs an RNA polymerase I–containing
extranucleolar expression site body, located within the nuclear
interior, provides an environment permissive for VSG transcription
[28–31]. As telomeres carry multiple repressed VSG genes,
expression site translocation between peripheral heterochromatin
and the expression site body likely mediates antigenic variation
[29], which therefore depends on chromatin organization and
involves epigenetic mechanisms.
While several chromatin-remodelling and histone-modifying
enzymes that act at telomeric regions have been described, no
nucleoskeletal components acting specifically on trypanosome
chromatin organization, with functions analogous to metazoan
lamins, are known [32–34]. However, one candidate is NUP-1, a
large coiled-coil protein that coenriches with the nuclear envelope
and appears to be a component of fibrous material subtending the
inner NE. We sought to determine if NUP-1 functions in
heterochromatin organization and gene regulation at the nuclear
periphery in T. brucei, which would have implications for the
evolutionary origins of such mechanisms [23]. Using multiple
approaches, we show that NUP-1 has several functions that are
clearly analogous to those of metazoan lamins, including
mediation of nuclear structural integrity, epigenetic chromatin
organization, and maintenance of developmentally regulated gene
expression. We propose that such mechanisms are likely
widespread amongst eukaryotes, and hence an ancient and
fundamental feature of gene control, rather than a lineage-specific
aspect of metazoan cells.
Results
NUP-1 Is a Coiled-Coil Protein
NUP-1 is a large protein (pI 5.07, MW.400 kDa) associated
with the nuclear periphery [23,35] that was identified as a major
component of the T. brucei NE proteome [36]. As predicted by
both COILS and CCHMM_PROF, NUP-1 is almost exclusively
coiled-coil with a central region of 17 near-perfect repeats of 144
amino acids (Figure 1A) [37,38]. No trans-membrane helices were
predicted. Moreover, the N- and C-terminal regions are also
predicted to be predominantly alpha-helical and extended (.90%
confidence, http://www.sbg.bio.ic.ac.uk/phyre2/); given that the
rise per residue is ,1.5 A˚, this predicts that were the structure fully
Author Summary
Eukaryotes—fungi, plants, animals, and many unicellular
organisms—are defined by the presence of a cell nucleus
that contains the chromosomes and is enveloped by a
lipid membrane lined on the inner face with a protein
network called the lamina. Among other functions, the
lamina serves as an anchorage site for the ends of
chromosomes. In multicellular animals (metazoa), the
lamina comprises a few related proteins called lamins,
which are very important for many functions related to the
nucleus; abnormal lamins result in multiple nuclear defects
and diseases, including inappropriate gene expression and
premature aging. Until now, however, lamins had been
found only in metazoa; no protein of equivalent function
had been identified in plants, fungi, or unicellular
organisms. Here, we describe a protein from African
trypanosomes—the single-cell parasites that cause sleep-
ing sickness—that fulfils many lamin-like roles, including
maintaining nuclear structure and organizing the chromo-
somes of this organism. We show that this protein, which
we call NUP-1 for nuclear periphery protein-1, is vital for
the antigenic variation mechanisms that allow the parasite
to escape the host immune response. We propose that
NUP-1 is a lamin analogue that performs similar functions
in trypanosomes to those of authentic lamins in metazoa.
These findings, we believe, have important implications for
understanding the evolution of the nucleus.
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org2 March 2012 | Volume 10 | Issue 3 | e1001287

Page 3

extended, the NUP-1 monomer would extend nearly to 400 nm,
which is ,25% of the diameter of the trypanosome nucleus.
A single NUP-1 syntenic orthologue was present in each
trypanosomatid genome examined (Figure 1, Table S1), each
exhibiting the same structure as NUP-1 but varying in size and
number of repeats; the repeats within each NUP-1 orthologue are
nearly identical but diverge significantly between species. Further,
NUP-1 orthologues in Trypanosoma species diverge significantly
from those in Leishmania (Figure 1, Table S2). So far, BLAST has
failed to identify sequences with significant similarity to NUP-1 in
Phytomonas, Bodo saltans (a free-living kinetoplastid), or Euglena
gracilis.
NUP-1 Localizes to the Nuclear Periphery within a Stable
Lattice
NUP-1 mRNA is expressed at similar levels in BSF and PCF T.
brucei, indicating a role throughout the life cycle (Figure S1). We
established the location of NUP-1 by C-terminal genomic tagging
of one allele with GFP in PCF cells followed by confocal
microscopy. Fluorescence was observed at the nuclear periphery,
and taken together with previous immunoEM, subcellular
fractionation, and monoclonal antibody studies, indicates that
NUP-1 is localized to a net-like structure at the nuclear periphery.
The location described here has a more net-like distribution
compared to the original description, which suggested a punctate
nuclear rim localization, and was interpreted as a potential
nucleoporin (Figures 2 and 3, Movies S1, S2, S3, and S4) [23,35].
A similar pattern was seen in BSF cells with rabbit polyclonal
antibodies raised to the NUP-1 repeat (Figure 2A, Movie S4),
demonstrating that the GFP tag did not affect NUP-1 localization
and confirming that the network is likely a more accurate view of
NUP-1 distribution and not the puncta seen earlier [35]. We note
that the vertex length (i.e., the distance between strongly stained
puncta and apparent fibres or fibrils) is somewhat variable, but is
similar to the 400 nm of the putative extended NUP-1 protein.
While we are unclear as to how many NUP-1 molecules contribute
to these structures, this, together with data below (Figure 3),
suggests that the protein is highly extended (Figure 2D). It is also
unclear at this time if NUP-1 is the sole component of the network
or if other proteins contribute. Regardless, these data suggest that
NUP-1 is a bona fide component of the nucleoskeletal network and,
moreover, that the location is highly distinct from the punctate
staining that we have reported previously for over 20 NPC
proteins [23,36]. We propose referring to NUP-1 as nuclear
peripheral protein 1 to help differentiate it from nucleoporins.
To determine if NUP-1 was stably associated with the nuclear
periphery, we used fluorescence recovery after photobleaching
(FRAP). After bleaching, no significant fluorescence recovery was
seen during 150 s (Figure 2B, Movie S5), while fluorescence
recovery was observed almost immediately with NLS-tagged GFP
(unpublished data). This suggests that NUP-1 is part of a
comparatively immobile network at the nuclear periphery in
interphase and that rapid exchange of NUP-1 subunits does not
occur.
Architecture of NUP-1 During the Mitotic Cell Cycle
In trypanosomes nuclear mitosis is preceded by division of the
kinetoplast, the mitochondrial DNA, while cytokinesis lags behind
mitosis by a considerable period. This allows early steps in mitosis
to be conveniently detected in mounts of log-phase parasites, and
also for post-mitotic nuclei to be analysed within the mother cell
prior to cell division. Overall the NUP-1-containing network
remained in place at all stages of mitosis (Figure 2A). An extension
of the NUP-1 network was also clearly present within the midbody
between nuclei in anaphase, which suggests that the NUP-1
network retains intimate contact with the nuclear envelope of the
midbody. Note that at late anaphase the midbody becomes
depleted of DNA, which has accumulated at the distal poles of the
daughter nuclei, so that the midbody is no longer stained
significantly with DAPI at this stage.
Despite the maintenance of a clear NUP-1 presence at the
nuclear envelope throughout mitosis, significantly less NUP-1 was
Figure 1. NUP-1 is a large coiled coil protein identified in T. brucei and restricted to trypanosomatids. A single NUP-1 orthologue is
present in each trypanosomatid genome. Bars represent N- and C-terminal domains, cylinders a-helical repeats. Numbers above domains denote the
number of amino acid residues predicted in each domain. Repeat number and length and total protein length in amino acids (aa) are also indicated.
doi:10.1371/journal.pbio.1001287.g001
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org3 March 2012 | Volume 10 | Issue 3 | e1001287

Page 4

present in the proximal compared to distal portions of each
daughter nucleus (Figure 2C). This rearrangement may contribute
to mechanical weakening of the NE to facilitate nuclear fission and
strengthening of the distal regions where the spindle is attached.
We also found that the overall distance between these NUP-1
puncta increased in mitotic cells compared to interphase, which
further suggests remodelling of the network in a cell-cycle-
dependent manner (Figure 2D). It is also likely significant that
the distance between NUP-1 punctate structures is of the order of
400 nm (Figure 2A and D), suggesting that there is a highly
organized assembly of the NUP-1 protein in the trypanosome
nucleoskeleton.
We also frequently observed a small spot of NUP-1 between
post-mitotic nuclei, apparently unassociated with DNA as detected
by DAPI (Figure S1, Movie S4). To determine if this was a
genuine extranuclear localization, we compared the location of
NUP-1 with NLS-tagged GFP, used to mark the nucleoplasm.
This revealed that the NUP-1 spot localized to the residual
midbody connection between daughter nuclei at terminal mitotic
stages as it also contained GFP (Figure S1D,E). This suggests that
a nucleus-derived fragment remains between the daughter nuclei
following mitosis, which does not contain significant amounts of
DNA; this is presumably a result of the fission mechanism, perhaps
analogous to generation of an aerosol when water drops from a
faucet. The presence of nucleoplasmic-targeted GFP suggests that
this structure, which is only seen in post-mitotic cells and therefore
probably rapidly degraded, is unlikely to be stably associated with
a cytoplasmic structure (e.g., an MTOC).
Arrangement of NUP-1 Protein within the Network and
Nuclear Targeting Signal
To test whether NUP-1 is distributed throughout the nucleos-
keletal network, we stained cells expressing NUP-1-GFP with
antibodies against both the C-terminal GFP tag and the repeat
region. Given an optical resolution of ,200 nm, we reasoned that
if NUP-1 were predominantly globular, then complete overlap
between the two signals would be observed, while if NUP-1 were
predominantly elongated, and given a total overall length for the
Figure 2. NUP-1 localizes to a stable network around the periphery of the nucleus. (A) Fixed PCF cells expressing NUP-1-GFP (white) or BSF
cells probed with an anti-NUP-1 antibody (white) were imaged by confocal microscopy. Shown are optical sections of the edge and centre of nuclei
taken from image series along the z-axis. DAPI was used to visualize the DNA (blue). Bar: 2 mm. Arrowheads at right panel indicate two putative
puncta (i.e., foci of NUP-1 reactivity from which linear regions of NUP-1 reactivity emanate). See also Movies S1A–D. (B) FRAP of NUP-1-GFP. After
bleaching a portion of the nucleus, no fluorescence recovery was observed during 150 s. See also Movie S5. (C) Top: Cells were probed with an anti-
NUP-1 antibody (red) and FISH for telomeres (green). DAPI was used to visualize DNA. Nuclei of dividing cells were sectioned into proximal and distal
halves for analysis based on the position of telomeres. Bar: 2 mm. Bottom: Fluorescence intensity in confocal nuclear sections of 21 dividing nuclei
was recorded for NUP-1, telomeres, and DAPI and plotted as a fraction of the total fluorescence in each nucleus. Means and standard deviations (SD)
are shown. The Student’s paired t test was used to determine the p value of the fluorescence difference in the proximal compared to the distal half of
the nucleus. NS, not significant. (D) Distance between NUP-1 puncta was measured using Metamorph software in cells that were in interphase (1K1N)
or early or late mitotic (2K1N). Diagram at top illustrates the measurements taken, essentially of the inter-puncta distance (red). A total of 300 cells
were analysed, and the statistical significance calculated using a Student’s paired t test (p.0.01).
doi:10.1371/journal.pbio.1001287.g002
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org4 March 2012 | Volume 10 | Issue 3 | e1001287

Page 5

fully extended protein of ,400 nm, then there would be partial
separation of the two signals (Figure 3A). While there was clearly
substantial overlap between the spatial distribution of the repeat
and C-terminal stains, partial separation was indeed observed
(Figure 3B), with the most likely interpretation that NUP-1 is
predominantly extended. To confirm the specificity of the co-stain
with anti-GFP and anti-repeat antibodies, we also stained cells
expressing NUP98-GFP, a nucleoporin, with the NUP-1 anti-
repeat antibody (Figure 3B), which demonstrated no cross-
reactivity. By contrast, when the GFP epitope was part of a
smaller and more compacted FG-repeat-containing nucleoporin,
TbNUP89 (Figure 3C), there was clear coincidence between the
GFP-stain and that obtained from a cross-reacting antibody to
vertebrate NUP107 [36]. These data suggest that at least some
NUP-1 polypeptides have an extended conformation, but
substantially more data are required to fully understand the
architecture of the NUP-1 network.
NUP-1 has a predicted C-terminal nuclear localization signal
(residues 3633–3643 of 3647) (http://cubic.bioc.columbia.edu/
services/predictNLS/). We tested if this sequence was functional
by eliminating residues 3633–3647 by fusing GFP in situ to the
NUP-1 ORF upstream of the putative nuclear localization signal.
This resulted in nuclear localization being disrupted, and which
was restored by adding back the nuclear localization signal to the
in situ construct, indicating that the region 3633–3647 is necessary
and sufficient for nuclear targeting (Figure S1). A more extensive
truncation, deleting the C-terminal domain but adding a nuclear
localization signal at the new C-terminus, correctly targeted NUP-
1 to the nucleus, and the localization of this truncation appeared
indistinguishable from the full-length protein. This suggests that
the C-terminal domain is not essential for incorporation of NUP-1
into the nucleoskeletal network.
NUP-1 Is Necessary for Maintenance of Specific Aspects
of the Nuclear Architecture
We used RNAi-mediated knockdown to suppress expression of
NUP-1 mRNA in BSF and PCF trypanosomes. 24 h (BSF) or 48 h
(PCF) after induction of dsRNA, NUP-1 mRNA abundance
decreased by ,35%, corresponding to the onset of proliferative
defects (Figure 4A, Figure S2A). By 24 h post-induction NUP-1
protein levels in BSF cells were depleted by ,75% (Figure 4B) at
which time gross alterations to the localization of the DNA as
stained by DAPI were observed, including nuclear enlargement,
abnormal extensions (blebbing), and irregular boundaries (exam-
ples in Figure 4C, quantitated in Figure 4D). These resemble the
morphological changes observed in numerous laminopathies [8,9].
Figure 3. NUP-1 is arranged in an extended conformation. (A) Top: Schematic showing NUP-1 in either a compact (left) or an extended (right)
conformation. Repeats are shown in red, and the GFP-tagged C-terminal domain is in green. The untagged N-terminus is white. Predicted staining
patterns for each conformer are shown below the schematics. Lower: Cells expressing NUP-1-GFP were probed with anti-GFP (green) and anti-NUP-1
repeat region antibody (red) and imaged by confocal microscopy. A montage of 15 confocal z-stack slices through the nucleus of a single
trypanosome is shown. There is clear discrimination between the red and green channels, consistent with an extended conformation. (B) Top: Cells
expressing NUP-1-GFP were probed with an anti-GFP (green) antibody and a secondary antibody that was immunoabsorbed to eliminate cross-
species reactivity and anti-NUP-1 repeat region antibody (red) and imaged by confocal microscopy. Shown is a central slice across the z-axis. DAPI
was used to visualise DNA. Bar: 2 mm for all panels. In independent stains using either the anti-GFP or repeat region antibodies alone, it was clear that
there was no cross-reactivity (unpublished data). Lower: Cells expressing TbNup98-GFP were probed with anti-GFP (green) and anti-NUP-1 repeat
region antibody (red) and imaged by confocal microscopy. Shown is the central slice along the z-axis, also demonstrating clear separation of the
nuclear pore complex from the NUP-1 repeat staining. (C) Cells expressing TbNup89-GFP were probed with anti-GFP (green) and an anti-FG repeat
antibody (red) to visualize the NPCs and imaged by confocal microscopy. There is clear high correspondence between the red and green stains,
consistent with previous data [36].
doi:10.1371/journal.pbio.1001287.g003
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org5 March 2012 | Volume 10 | Issue 3 | e1001287

Page 6

We used BSF cells for subsequent analyses except where specified.
Residual NUP-1 at 24 h post-induction was collapsed in patches
rather than evenly distributed around the nuclear periphery,
suggesting compromised organization (Figure 4E).
NUP-1 knockdown led to a decreased proportion of interphase
cells (1K1N) and increased proportion of cells entering mitosis/
cytokinesis (2K1N, 2K2N) and atypical cells with abnormal nuclei
and atypical copy numbers of nuclei or kinetoplasts (Figure S2C
‘‘other’’). A peak of blebbing structures was followed by a peak of
DNA presenting a diffuse boundary (Figure 4D), suggesting that
blebbing might allow DNA to spill out of the nuclear remnant. As
blebbing was initially observable in mitotic cells, we suggest that
NUP-1 depletion results in loss of structural integrity during
mitosis and consequent failure to complete mitosis. Interestingly,
some distorted nuclei retained the ability to form a spindle as
demonstrated by the presence of an intranuclear gamma-tubulin
(KMX) rhomboid in a similar proportion of mitotic cells as seen
with uninduced cells. This suggests that NUP-1 is unlikely to play a
direct role in spindle formation (Figure S2C). Overall, these data
indicate a loss of the normal morphology and hence organization
of the nucleus upon NUP-1 depletion, which included abnormal
midbody organisation in NUP-1 depleted cells that achieved late
mitosis. We suggest that failure to complete mitosis is due to
rupture of the nuclear envelope (example; left hand procyclic cell
Figure 4C).
By transmission electron microscopy, many knockdown cells
had irregular and asymmetric nuclei (Figure 5A–C). Significantly
the ER, Golgi, flagellum, and kinetoplast appeared unperturbed,
indicating specific nuclear defects (unpublished data). We observed
portions of the NE that lost sharp definition, likely due to NE
crenelation (multiple small invaginations; 43% of cells, n=28).
Such a feature is much less frequently observed in wild type cells
(16% of cells, n=25) (Figure 4E, arrowhead). Some 18% of cells
(n=35; 0% in wild type, n=25) exhibited quasi-arrays of circular
structures that have the same diameter as NPCs (Figure 5D);
clustered NPC arrays are also seen with metazoan lamin defects
[39,40]. To verify the roles of NUP-1 in NPC spacing, and also to
provide verification that the NPCs had clustered as suggested by
EM, we in situ tagged the trypanosome FG-repeat nucleoporin
TbNup98 with GFP [36], and monitored the positioning of this
Figure 4. NUP-1 is necessary for cell growth and maintenance of nuclear architecture. NUP-1 RNAi was induced in both BSF and PCF cells.
(A, B) NUP-1 mRNA was depleted by ,30% as measured by qRT-PCR normalized to b-tubulin, corresponding to a ,75% decrease in NUP-1 protein
after 24 h of RNAi induction. Western bands were quantified, normalized to BIP levels, and represented as bar graphs. Error bars are the result of two
experimental replicates. (C) IFA using DAPI to visualize DNA (blue). Nuclei of control cells were ovoid with well-defined boundaries, and induced cells
exhibited nuclei with diffuse boundaries (i.e., rather than the DAPI nuclear signal being sharply demarcated, the signal gradually decreases with
distance from the nuclear centre), and abnormal protrusions (blebs) in both BSF (left panel) and PCF (right panel) cells are seen. Bar: 5 mm. (D) Nuclei
with abnormal extensions (blebbing) and with diffuse boundaries were examined over a time course of NUP-1 RNAi induction in BSF cells. 200 cells
were scored for each time point. Percentage of nuclei with blebbing or diffuse phenotypes is shown, with the remainder of cells demonstrating a
normal phenotype. Initially an increase in cells with bleb nuclei (black) was observed, followed by a decrease in bleb nuclei and an increase in cells
with diffuse nuclei (gray). Note that these features are present at less than 1% in an uninduced population. Bar: 2 mm. (E) NUP-1 knockdown BSF cells
were probed with an anti-NUP-1 antibody (white). DAPI is used to visualize DNA (blue). Shown are serial sections along the z-axis. Bar: 2 mm.
doi:10.1371/journal.pbio.1001287.g004
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org6 March 2012 | Volume 10 | Issue 3 | e1001287

Page 7

protein following NUP-1 depletion. In uninduced cells TbNup98-
GFP was observed as regularly spaced puncta surrounding the
nucleus (Figure 5F), consistent with our earlier observations and
with TbNup98 being a bona fide nucleoporin [36]. In NUP-1
downregulated cells TbNup98-GFP clustered in patches at the
nuclear periphery (Figure 5F, Movie S6). We conclude that NUP-
Figure 5. Nuclear morphology and NPC positioning are dependent on NUP-1. (A) Control cell nucleus. (B–C) Nuclear morphology
disruption in NUP-1 RNAi cells, with nuclei producing asymmetric extensions and/or invaginations. (D) NPC arrays (black arrow) are visible. (E) Areas of
the nuclear envelope appeared ill-defined (black arrowhead). Bar: 200 nm. (F) TbNUP98-GFP (white) was used as a marker of the NPC and in control
cells displayed as puncta around the nuclear periphery (top panel). In NUP-1 RNAi cells, NPCs clustered in distinct regions of the nuclear periphery
(bottom panels, serial images along the z-axis). DAPI was used to visualize DNA (blue). Bar: 2 mm.
doi:10.1371/journal.pbio.1001287.g005
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org7 March 2012 | Volume 10 | Issue 3 | e1001287

Page 8

1 is required to correctly position and space NPCs at the nuclear
envelope, a function performed by lamins in metazoans.
NUP-1 Is Required for Chromosome Organization
Given the clear role in maintaining nuclear architecture we
asked if NUP-1 functions in chromatin organization. T. brucei
contains 22 chromosomes of ,1.1–6 Mbp referred to as megabase
chromosomes, and several intermediate-sized chromosomes of
,150–400 kbp. These chromosomes collectively carry the house-
keeping genes, VSG basic copy genes, and ,20 subtelomeric VSG
expression sites [41,42]. Additionally, there are ,100 minichro-
mosomes that contain simple sequence repeats and non-tran-
scribed VSG genes [43–45].
We performed fluorescence in situ hybridization (FISH) with a
telomere probe recognizing all chromosomes. We observed NUP-
1 partially juxtaposed with telomeres throughout the cell cycle,
suggesting some coordination in their movements (Figure 6A).
Following NUP-1 RNAi, however, telomeres became clustered
and some became located within the nuclear blebs (Figure 6B,
arrows). To discriminate between megabase and minichromo-
somes, we simultaneously used FISH probes specific to megabase
and minichromosomal telomeres and a minichromosome-specific
probe. In uninduced cells, although most of the telomere and
minichromosome FISH signals colocalize, some of the megabase
chromosome telomeres (those that hybridized exclusively with the
telomere probe) were further from the nuclear centre than
minichromosomes (which hybridize with both probes) when
aligned for nuclear division, as previously reported (Figure 6C,
control) [35,45]. In NUP-1 knockdown cells, megabase telomeres
were the predominant telomere FISH signal in the nuclear blebs,
where the minichromosome FISH probe was absent (Figure 6C,
arrows); the majority of the telomere FISH signal, however,
colocalized with the minichromosome FISH probe in the body of
the nucleus (Figure 6C, yellow). Therefore, NUP-1 depletion had a
more prominent impact on megabase telomere chromosome
positioning than on the minichromosomes.
NUP-1 Regulates Gene Expression at Telomere-Proximal
Regions
As NUP-1 appears to interact with chromatin, based on the
location of the NUP-1 protein within a nucleoskeletal network at
the nuclear periphery and telomere and NPC positional effects
observed by knockdown, we asked if NUP-1 influences telomere-
proximal gene transcription. We used several complementary
assays to address this issue.
Expression of MVSG genes, a specific subset of VSG genes, is
restricted to metacyclic stage T. brucei (the life stage present in the
tsetse fly salivary gland and injected into a host), and these genes
are transcriptionally silent in procyclics [46,47]. The MVSG
position, directly upstream of the telomeres, makes them an
excellent model to investigate positional effects at subtelomeric
sites. Hence, we first induced NUP-1 RNAi in the MVSG 1.22
eGFP PCF reporter cell line (Figure 7A). RNA level derived from
two metacyclic VSG genes and also the eGFP transgene integrated
into an MVSG locus was monitored by qRT-PCR. NUP-1
knockdown led to a notably (8- to 22-fold) increased abundance
of all three MVSG locus mRNAs (Figure 7B). To discriminate
between non-specific MVSG induction and NUP-1-dependent
effects, we individually silenced three unrelated but essential genes:
polo-like kinase (PLK) [48], F0–F1 ATPase associated factor
(ATPaseAF) [49], and clathrin [50]. RNAi against each resulted in
very severe proliferative and/or morphological defects (Figure
S3A) but no significant increase to MVSG transcription (Figure 7B),
confirming the specificity of the NUP-1 knockdown effect on
misregulation of MVSG expression.
Next we asked if NUP-1 regulates gene expression in BSF T.
brucei using a microarray to assess global gene expression changes
(GEO accession GSE26256) [51]. Of 8,110 genes represented,
relative expression levels of 62 genes were upregulated greater
than 2-fold, a standard stringent cutoff for significance in
microarray experiments (l.40 cutoff, corresponding to an
estimated false discovery rate of 4.9361024) and demonstrated
specific and not global transcriptional changes (Figure 8A, Figure
S3B, Table S3). The upregulated gene cohort contained procyclin
and VSG genes together with a number of small or repetitive
ORFs; significantly no other developmentally regulated or
housekeeping ORFs were found. No genes exhibited significant
downregulation within these parameters.
Seven upregulated genes were procyclins or procyclin-associated genes
(p value=3.54610212), residing at two unlinked RNA polymerase
I (PolI)–transcribed loci (Figure 8A, Figure S3B, Table S3) [52]. As
procyclin is the developmentally regulated protein coat expressed
exclusively in PCF cells, derepression in BSF T. brucei suggests
NUP-1-dependent life-cycle-specific silencing of the procyclin
locus [53]. The upregulation of transcription at the procyclin locus
was verified by qRT-PCR specific for the two major forms of
procyclin, EP and GPEET (Figure 8B). Though GPEET was not
identified on the microarray, possibly due to the stringent cutoff,
by qRT-PCR, it was also detected as upregulated.
Most significantly, 26 derepressed genes were annotated as
VSGs (p value=2.03610225) (Figure 8A, Figure S3B, Table S3).
African trypanosomes achieve expression of a single VSG gene,
and thus antigenic variation, by silencing all but one VSG coding
sequence present in expression sites and by selective incorpora-
tion of a single VSG gene within the expression site body
[29,30,52,54]. VSG genes not located in an expression site are
transcriptionally silent. As oligonucleotides specific for expression
site VSGs were not present on the microarray, the VSGs identified
by the microarray could correspond to basic copy VSGs.
However, the VSG family is highly homologous and 50% of the
VSGs identified by the microarray were strongly homologous to
one of the 13 (of an estimated 15) sequenced T. brucei expression
site VSGs (unpublished data) [42]. To further investigate if
expression site VSGs were misregulated by NUP-1 RNAi and if
cross-hybridization with expression site VSGs could account for
the derepressed VSGs, we performed qRT-PCR for four
expression site VSGs. A highly significant increase in VSG mRNA
was observed (Figure 8B). Amplified products were sequenced
and aligned with the most homologous microarray oligonucleo-
tide. Expression site VSG sequences from NUP-1 RNAi cells were
identical to the published sequences, and large regions of identity
were also present between the oligonucleotides and the amplified
products (Figure S3C). Though we cannot rule out increased
transcriptional activity from basic copy VSGs upon NUP-1
knockdown, we do detect mRNA from misregulated expression
site VSGs and therefore can conclude that NUP-1 participates in
maintaining the inactive transcriptional status at the expression
sites in BSF T. brucei.
NUP-1 Depletion Derepresses the Entire BSF Expression
Site
The expression site comprises a PolI promoter driving a
polycistronic transcription unit, at the distal end of which resides
the VSG gene. The VSG gene is proximal to the telomere, and in
the case of VSG 2, the entire locus is ,60 kb [55]. We asked if
misregulation associated with NUP-1 knockdown was restricted to
expression site VSG transcripts or if the entire expression site was
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org8March 2012 | Volume 10 | Issue 3 | e1001287

Page 9

affected. We knocked down NUP-1 in cells containing a GFP-
neomycin phosphotransferase (NPT) reporter close to the VSG 2
expression site promoter (Figure 9A). Using qRT-PCR the
transcriptional levels of the reporter and the VSG were found to
increase upon NUP-1 knockdown, although changes in protein
levels were not detected by Western blot (Figure S4). This suggests
Figure 6. Chromatin organization is dependent on NUP-1. (A) Cells were probed with an anti-NUP-1 antibody (red) and FISH for telomeres
(green). DAPI was used to visualize DNA (blue). NUP-1 and telomeres are in close contact throughout the cell cycle. (B) Telomeres (green) were
observed in nuclear blebs (white arrows). An anti-NOG-1 antibody (red) was used to visualize the nucleolus and DAPI for DNA (blue). (C) FISH for
telomeres (green) and minichromosomes (red). Telomeres marked by only green fluorescence are megabase chromosomes. In control cells, (top
panel) megabase chromosomes did not condense as far towards the centre of a dividing nucleus as the minichromosomes (white arrow heads). In
NUP-1 depleted cells, megabase chromosomes co-localized with nuclear blebs (white arrows). DAPI was used to visualize DNA (blue). Bar: 2 mm for all
panels.
doi:10.1371/journal.pbio.1001287.g006
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org9 March 2012 | Volume 10 | Issue 3 | e1001287

Page 10

a role for NUP-1-mediated control of expression levels across the
entire expression site (Figure 9A). To investigate a NUP-1 role in
transcriptional control of all telomeric gene sequences, we depleted
NUP-1 in cells containing a NPT reporter upstream of a de novo
telomere, under control of a PolI transcribed ribosomal DNA
promoter (Figure 9B) [56]. Though VSG expression increased,
confirming the earlier result, NPT mRNA expression decreased
during the experiment (Figure 9B). Significantly, NUP-1 knock-
down also decreased the expression of the active VSG (VSG 2;
Figure 9B); the mechanism behind this is presently unclear but
may be related to an increased switch frequency (i.e., that a
proportion of cells have switched away from expression of VSG 2;
see below). As a control for specificity, we also monitored the effect
of knockdown of an NPC protein (TbNup98) and analysed the
effect on transcriptional misregulation at subtelomeric regions and
also the effect on telomere positioning throughout the cell cycle.
No major effect was observed for any of these assays (Figure S5),
confirming that the effects seen with NUP-1 knockdown are
specific and not the result of generic nuclear insult. Therefore,
NUP-1 depletion does not induce an increase in transcriptional
levels of all telomeric transcripts and demonstrates a specific role
for NUP-1 in the transcriptional regulation of developmentally
regulated expression site–associated sequences.
VSG Expression Site Regulation Is Affected by NUP-1
Knockdown
The frequency of VSG switching in the Lister 427 cell line is
naturally extremely low, with ,0.1% of cells having switched
away from the predominant VSG2. Hence, we used immunoflu-
orescence to determine if the transcriptional decrease in the
expressed VSG and increase in mRNA from the previously silent
expression site VSGs coincides with protein production and surface
antigen switching. NUP-1 depleted cells were analyzed using
antibodies against the expressed VSG (VSG2) and an alternate
VSG located in a normally silent expression site (VSG 6). A
significant, nearly 10-fold increase in the frequency of cells
expressing VSG 6 on their surface following NUP-1 depletion was
found (Figure 10A). Double positive cells (i.e., cells that expressed
both VSG 2 and VSG 6) were also detected at increased
frequency, and as expected due to the slow turnover of the original
VSG 2 following initiation of expression of VSG 6. We also
observed an increased frequency of cells negative for both VSG 2
and VSG 6 suggesting random switching away from VSG 2 to
VSGs other than VSG 6 (unpublished data). These data suggest
that NUP-1 depletion not only leads to misregulation of the VSG at
the mRNA level, but that this encompasses an increase in the
frequency of antigenic switching.
Figure 7. NUP-1 depletion causes misregulation of metacyclic VSG (MVSG) genes in PCF cells. (A) eGFP reporter modification of the
telomeric MVSG 1.22 locus in PCF cells. P, promoter; BSD, blasticidinRgene; Pol I, RNA polymerase l. (B) NUP-1 RNAi induction causes time-dependent
increase in MVSG and eGFP expression. All values are fold expression compared to uninduced cells determined by qRT-PCR and normalized to b-
tubulin. Clathrin, PLK, and ATPaseAF; RNA was isolated after manifestation of the proliferative/morphological phenotype.
doi:10.1371/journal.pbio.1001287.g007
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org 10March 2012 | Volume 10 | Issue 3 | e1001287

Page 11

Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org 11 March 2012 | Volume 10 | Issue 3 | e1001287

Page 12

Figure 8. NUP-1 depletion causes increased expression of developmentally regulated genes in BSF cells. (A) Heatmap for microarray
following NUP-1 knockdown in BSF cells. Of 8,110 genes, 62 were increased in relative expression greater than 2-fold. Yellow and blue represent
upregulation and downregulation, respectively, and black no expression change. Gene accession numbers/annotation are given for the upregulated
genes. (B) qRT-PCR quantitation of the expression of EP and GPEET procyclin genes (left panel), selected ES VSG genes (middle panel), and
housekeeping genes (right panel) during NUP-1 RNAi. The expression level in control cells was set to one, and y-axis is the relative expression
compared to control cells, normalized to b-tubulin.
doi:10.1371/journal.pbio.1001287.g008
Figure 9. Depletion of NUP-1 derepresses the entire expression site, but not all telomeric genes. (A) Top: NUP-1 RNAi was induced in
cells with a GFP:NPT reporter downstream of the repressed VSG 2 expression site promoter. Bottom: Expression of VSG 2 and the reporter increased as
determined by qRT-PCR normalized to Rab11. (B) Top: NUP-1 RNAi was induced in a cell line with NPT reporter ,2 kb upstream of a de novo
telomere. Bottom: Expression site VSG gene expression increased but NPT expression did not as determined by qRT-PCR normalized to Rab11.
Expression of VSG 2, the active VSG in this cell line, decreased.
doi:10.1371/journal.pbio.1001287.g009
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org12March 2012 | Volume 10 | Issue 3 | e1001287

Page 13

This increase in antigenic switching, together with a role in
telomeric positioning, may suggest that NUP-1 plays a role in
regulating expression site positioning at the nuclear periphery and
thus might affect the frequency of translocation of inactive ESs into
the nuclear interior and subsequent insertion into the expression site
body. The expression site VSG promoter is rapidly repositioned to
the nuclear periphery upon developmental differentiation from BSF
to PCF, a life stage where no VSGs are expressed [57]. To investigate
this issue, NUP-1 was knocked down in BSF cells where the active
expressionsitepromoterhasbeentaggedwithGFP-LacI,asamarker
for the expression site body. These cells were then induced to
differentiate into PFs. The active VSG-expression site promoter
relocated to the nuclear envelope early during differentiation (5 h) in
63% of control cell nuclei, as expected (Figure 10B). Statistical
analysis of the GFP-LacI position in cells depleted for NUP-1
indicated that only 16%63.2% of the nuclei displayed the GFP-LacI
spot at the nuclear periphery (Figure 10B). As efficient incorporation
of the previously active VSG expression site into the peripheral region
of the nucleus is disrupted in the NUP-1 knockdown, these data
suggest that developmental silencing of the active expression site at
the nuclear periphery requires NUP-1 function, consistent with a role
for NUP-1 in peripheral chromatin organization.
Figure 10. NUP-1 knockdown leads to increased VSG switching and represses differentiation-induced expression site
repositioning. (A) Top: Cells were probed with antibodies against the active VSG 2 (red) and an alternate VSG 6 (green) following 96 h of NUP-
1 RNAi induction. Cells switched from expressing VSG 2 to VSG 6 (white arrow), expressed neither VSG 2 nor VSG 6 (white arrowhead), or expressed
both (not shown). Bar: 10 mm. Bottom: Quantitation of increased VSG switching in NUP-1 knockdown cells. Graph represents average and standard
deviation of three independent NUP-1 RNAi lines (n=1,000 cells). (B) NUP-1 depletion represses differentiation-induced repositioning of the active
expression site to the nuclear periphery. Left: Representative images of maximum intensity projections of 3-D data sets of the GFP-LacI tagged active
expression site (green) in wild type cells or NUP-1 RNAi cells (induced for 24 h) after induction of differentiation. Bar: 1 mm. Right: Statistical analysis of
the expression site position. The active expression site rapidly repositions to the nuclear periphery in wild type cells. Repositioning is significantly
inhibited in NUP-1 RNAi cells. Graph represents the average of three replicate experiments.
doi:10.1371/journal.pbio.1001287.g010
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org 13March 2012 | Volume 10 | Issue 3 | e1001287

Page 14

Discussion
While structures that resemble the nucleoskeletal metazoan
lamina and heterochromatin are recognized in many eukaryotic
lineages, the lamin proteins themselves are clearly restricted to the
metazoa [7,15], and no lamina components have been unequiv-
ocally identified to date in any non-metazoan organism. This,
together with a very clear absence of lamins and a morpholgical
lamina from S. cerevisiae and other yeasts, suggests that the lamina
arose during differentiation of the metazoan lineage [17]. This
distinction implies that the mechanisms for organization of
peripheral heterochromatin are substantially divergent throughout
the Eukaryota and, more significantly, that the mechanisms
understood as present in Metazoa are modern and lineage-specific.
An alternate model, that the nuclear lamina is an ancient feature
of eukaryotes but has been lost in yeasts, is also possible, especially
as it is clear that S. cerevisiae has experienced other significant
secondary losses. Resolving this issue requires the identification
and molecular and functional characterization of a nucleoskeletal
structure from a non-metazoan lineage. Here we describe the
location and function of one such nucleoskeletal structure from
trypanosomes, which are members of the Excavata supergroup,
and in evolutionary terms are extremely distant from the Metazoa
and also undergo a closed mitosis, probably the dominant form of
mitosis in an evolutionary context.
NUP-1 Forms a Network in the Trypanosome Nucleus
NUP-1 is a predominantly coiled-coil protein that localizes to a
lattice-like network at the nuclear periphery. As initially charac-
terised, NUP-1 was suggested to be located as puncta at the nuclear
envelope and was proposed to be a nucleoporin (hence the name
NUP-1) [35]. By contrast, our earlier work suggested that NUP-1
was associated with fibrillar material on the inner nuclear envelope,
which was depleted from regions of the envelope subtending the
NPC [23]. Here, for the first time, using in situ GFP tagging and
high-resolution microscopy, we have revealed that NUP-1 is in fact
associated with a network, reminiscent of the lamin nucleoskeleton.
We find that several aspects of nuclear organization are extremely
sensitive to decreased expression of NUP-1, extending to prolifer-
ative defects, structural abnormalities, and NPC clustering; all of
these are analogous to phenotypes observed when lamin expression
or functions are perturbed. Most significantly, NUP-1 organizes
trypanosome chromatin and is required for controlling develop-
mentally regulated and telomere-proximal gene expression, as are
lamins. NUP-1 knockdown leads to misregulation of multiple
expression site VSGs, the procyclin loci, and MVSGs, all developmen-
tally regulated genes. It is possible that NUP-1 interacts even more
extensively with chromatin, with subtle changes below our current
detection level. NUP-1 and lamins do, however, demonstrate
unique functional aspects: first, as trypanosomes undergo closed
mitosis, NUP-1 can have no role in post-mitotic nuclear envelope
reformation, but may act in mitotic scission, and second, NUP-1
does not, from presently available data, appear to participate in
spindle formation. Taken together, these data argue strongly that
NUP-1 is a component of a nucleoskeletal cage within the
trypanosome nucleus that supports many functions equivalent to
the lamin network of metazoan cells.
NUP-1 Plays a Role in Telomeric Silencing
The role of NUP-1 in silencing developmentally regulated genes
may also provide insights into the process of antigenic variation in
trypanosomes. Of the changes to gene expression during life cycle
progression in trypanosomes, a major feature is the switch between
the dominant surface antigens VSG and procyclin. There are over
1,000 VSG coding sequences in the trypanosome genome, of which
only ,20 occur in the subtelomeric expression sites. Monoallelic
expression is achieved by only one expression site being active, in a
transcriptionally permissive expression site body environment. This
level of selective expression requires a tremendous degree of
epigenetic control. While the expression site body partially explains
how a single expression site is active, other regulatory mechanisms
must constrain the inactive expression sites, securing them against
both expression site body entry and spontaneous transcription. This
control breaks down on disruption of NUP-1 expression. Following
NUP-1 knockdown, megabase chromosome telomeres reposition,
multiple expression site VSGs become active, and the frequency of
VSG coat switching increases. Additionally, the active expression
site promoter fails to migrate to the nuclear periphery upon
differentiation, suggesting a role for NUP-1 in sequestering and
silencing inactive expression sites. As NUP-1 also silences MVSG
genes in PCF cells, it is likely associated with the formation and
maintenance of a repressive heterochromatin environment, paral-
leling lamin functions [58,59]. Modulations to the NUP-1 network,
involving NUP-1 phosphorylation sites for example, may be a
mechanism to release sequestered VSG genes to initiate a VSG
switch, which is clearly under epigenetic control as trypanosomes
rapidly, but reversibly, reduce switch frequency in culture [60].
Overall, our work shows that this mechanism contributes to the
extreme level of developmental control of VSG and procyclin,
where expression between life stages varies by several orders of
magnitude [61]. Significantly, misregulation of VSG and procyclin
genes on NUP-1 knockdown is not as extreme, being induced only
up to ,10-fold. This likely requires translocation to an RNA PolI-
rich nuclear subdomain (i.e., the expression site body and the
nucleolus for VSG and procyclin, respectively).
Evolution of NUP-1, Lamins, and Nuclear Architecture
The identification here of a component of a nucleoskeletal
network in a non-metazoan organism indicates that such structures
are not lineage restricted. Taken together with the presence of
peripheral heterochromatin and fibrous nucleoskeletons being
identifiable in taxa from many lineages, this suggests that the
mechanisms for epigenetic control and the tight regulation of
specific gene cohorts at the nuclear periphery are likely both a
generalfeatureofeukaryotesand anancientone.Thisisparticularly
significant as the mechanisms for controlling the expression of
individual mRNAs are highly divergent. For example, in contrast to
Metazoa, trypanosomes lack promoter control for the vast majority
of genes. Hence, epigenetic control by a peripheral nucleoskeleton,
which is entirely absent from prokaryotes, may be among the most
fundamental and ancient mechanisms for eukaryotic gene regula-
tion. The question arises as to whether the functional commonality
between NUP-1 and lamins has arisen via convergent or divergent
evolution. At molecular weights of ,450 kDa and ,60 kDa,
respectively, these proteins are far from obvious orthologues, while
significant sequence relationships are restricted to Metazoa for
lamins [15] and trypanosomatids for NUP-1. NUP-1 is apparently
absent from the free-living kinetoplastid Bodo saltans, and the distant
relationships between the Leishmania and trypanosome NUP-1
orthologues indicates a great deal of evolutionary plasticity even
between more closely related species; African trypanosomes are
highly tolerant of perfect repeats, which may explain the extreme
expansion of the T. brucei form. Conservation of NPCs, nuclear
envelope, and heterochromatin clearly argues for a common origin
for nuclear organization mechanisms, but many NPC components
cannot be identified based on sequence between distant taxa
[17,36,62], suggesting that overall architecture is more important
than primary structure.
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org14 March 2012 | Volume 10 | Issue 3 | e1001287

Page 15

A convergent evolution model would imply that coiled-coil
proteins organizing peripheral chromatin arose independently in the
major eukaryotic lineages, and potentially that the last eukaryotic
commonancestor lackedsuchafeature.Indeed,as lamins areabsent
from yeast, the understandable hypothesis was that this represented
the ancestral state [16]. By contrast a divergent evolution model
argues that ancestral coiled-coil proteins diverged into lamins, NUP-
1, and presumably similar proteins throughout the eukaryotes (e.g.,
NMP-1 in plants, with secondary losses in specific lineages such as
yeasts). This latter scenario is clearly the most parsimonious when
taking the present data into consideration and is in agreement with
recent large-scale studies of the evolution of coiled-coil proteins and
other protein domains [63–65]. Taken together we favour the
divergent scenario where the nuclear skeleton evolved along with the
nuclear envelope and NPC in the earliest eukaryotes; however, we
acknowledge that this issue remains far from settled and will require
identification of nucleoskeletal components in additional eukaryotic
supergroups for further clarification. A recent report indicates that
the Metazoan exclusivity of lamins is incorrect, and a clear highly
divergent lamin ortholog is present in Dictyostelium [79]. This finding
has profound implications, strongly suggesting that the fungi have
lost an ancestral lamin, rather than metazoa acquiring lamins
following separation from the common ancestor with fungi.
Finally, as nucleoskeletal heterochromatin organization appears
crucial for silencing developmentally regulated genes, we speculate
that the likely presence of such a system in the last eukaryotic
common ancestor implies that this organism had a complex
multiple-stage life cycle, requiring nucleoskeletal silencing at the
nuclear periphery; this may go some way to explaining the
surprising cellular complexity of LECA based on multiple
reconstructions. Improved proteomic techniques may lead to
identification of lamina components in additional eukaryotic
lineages and help to clarify the likely structures within an ancestral
nuclear skeleton and the fundamental and conserved processes
governing heterochromatin remodelling.
Materials and Methods
Cell Culture
BSF Trypanosoma brucei brucei MITat 1.2 (M221 strain) and PCF
T. b. brucei MITat 1.2 (Lister 427) or T. brucei EATRO 795 (MVSG
studies) were grown as previously described [66–68]. Single
marker BSF (SMB) and PTT PCF lines were used for expression
of tetracycline-inducible constructs [67]. Expression of plasmid
constructs was maintained using antibiotic selection at the
following concentrations: G418 and hygromycin B at 1 mg/ml
and phleomycin at 0.1 mg/ml for BSF, G418 at 15 mg/ml,
hygromycin B at 25 mg/ml, and phleomycin at 5 mg/ml for PCF.
In Situ Tagging
ORFs were tagged using the pMOTag4G and pMOTag4H
vectors [69] as templates. The following primers were used: NUP-
1F: ACAAACACAGCGACAGGTACGGCAAGTCATGGAC-
ATACGTAGCACAAGGAAAAGGTCTCGTTCAGCCAATG-
CGGTCTCGGGTACCGGGCCCCCCCTCGAG; NUP-1R: TC-
TAGGTGCATGTGTAGATGAACTGCACACTTTATGCA-
CTAATAACAGGTTTGAAGTACTTACCTGGCATCTCC-
TGGCGGCCGCTCTAGAACTAGTGGAT; Tb927.4.2070F:
GAGCTGAGAAAGTGTAATGACTTAGTTATAAAGAGAC-
TAGAGGATGAGGTTAAAGCTCTTCGTGAAGAACTGCG-
TGGAAATGAGGCGGGTACCGGGCCCCCCCTCGAG;
927.4.2070R: CCAATAGAAAAAAATGTAAGTAGCAATAA-
TACGTATTTAAAAATGTCAAAATTGTCAGCAACAAAG-
ATGCTTACACGAACAGAAAAAAAAAGATGGCGGCCG-
Tb
CTCTAGAACTAGTGGAT; Tb927.7.3330F: CGCTCTGTT-
GAGGAAGGTGAAGACGATGAGGACGAGGGCGACGCA-
ACCGGTTGCCCAACAACGCATTTGGGAGGGCCATGG-
GCGCACCATGGTACCGGGCCCCCCCTCGAG; Tb927.7.
3330R: CAAAAATATTCGTTACATTAGACATCATTCATC-
GACTGTAACCTAGGTAGTGTATGAGATACCGTATCAA-
TTACACACTGAGTGTCATGGCGGCCGCTCTAGAACT-
AGTGGAT; TB92733180F: TGGGAATGCTTCAGCAAGT-
GGTGAAAAGAACAATGCTCCACGGAATCCCTTCTCAT-
TTGGTGCCTCTTCTGGGAATGCTGGTACCGGGCCCC-
CCCTCGAG; TB92733180R: ACTAAAGAAGGGTAGAAAA-
CAAAGAAAACACCAAATAAGGTACCTGACGCAGCGGC-
AACACCACGTCGACTTGCTGGCGGCCGCTCTAGAAC-
TAGTGGAT.
For truncation in situ tagging, the following primers were used:
NUP-1noNLSF: GGTGAGCTTGTCCGTTGAGTCATCACA-
TCATTCCAGAATCACTGAACAAACACAGCGACAGGTA-
CGGCAAGTCATGGACGGTACCGGGCCCCCCCTCGAG;
NUP-1noNLSR: GTTTGAAGTACTTACCTGGCATCTCCT-
CACGAGACCGCATTGGCTGAACGAGACCTTTTCCTT-
GTGCTACGTATTGGCGGCCGCTCTAGAACTAGTGGA-
T; TbNUP1NrepeatsTagF: CCGTACAGCAAAGGAGAAGC-
TGGAGAGGAGTGTTGAGGAAATATCTTTTTTAAAAG-
ATGAAGTTTTGGTTAGTAATCGTATACGTAGCACAAG-
GAAAAGGTCTCGTTCAGCCGGTACCGGGCCCCCCCT-
CGAG; TbNUP1NrepeatsTagR:
CAGCACCATCACTATCCCCCACTTTACCATTCAAAGA-
AGAAACACTATCCACAAGCAATGGCGGCCGCTCTAG-
AACTAGTGGAT; TbNUP1noNLSplusNLSTagF: GGTGAG-
CTTGTCCGTTGAGTCATCACATCATTCCAGAATCACT-
GAACAAACACAGCGACAGGTACGGCAAGTCATGGAC-
ATACGTAGCACAAGGAAAAGGTCTCGTTCAGCCGGTA-
CCGGGCCCCCCCTCGAG.
Linear PCR products were purified by ethanol precipitation.
Electroporation was performed with 10–25 mg of DNA using a
Bio-Rad Gene Pulser II (1.5 kV and 25 mF). Positive clones were
assayed for correct insertion and expression using PCR and/or
Western blotting.
TCAACATCTGCACCAA-
Immunofluorescence Analysis
For microscopy, cells were fixed with 3% paraformaldehyde (v/
v) for 1 h on ice (PCF) or 15 min at room temperature (BSF) and
allowed to settle onto poly-L-lysine coated slides (VWR Interna-
tional) at room temperature. For permeablization, cells were
incubated with 0.1% Triton X-100 for 10 min in PBS. Slides were
blocked in 20% FBS (Sigma) in PBS for 1 h. Cells were incubated
with primary antibody in 20% FBS/PBS for 1 h followed by three
5-min washes in PBS. Cells were incubated with secondary
antibody in 20% FBS/PBS followed by three 5-min washes in
PBS. Slides were mounted with Vectashield mounting medium
plus DAPI (Vectashield Laboratories). Antibodies were used at the
following concentrations: rabbit anti-GFP 1:3,000, goat anti-rabbit
IgG Alexa Fluor 488 (Molecular Probes) 1:1,000, mouse anti-HA
(Santa Cruz Biotechnology Inc.) 1:1,000, goat anti-mouse IgG
Alexa Fluor 568 (Molecular Probes) 1:1,000, polyclonal rabbit
anti-NUP-1 (produced by Covalab against the NUP-1 peptide
NH2-CLNAAGVRVRTSQSDKD-COOH) 1:750, and rabbit
anti-TbNog1 629L (gift from M. Parsons) 1:700. VSG antibodies
and visualization were performed as previously described [70]. For
combination immunofluorescence and FISH, samples were
processed for immunofluorescence as above and post-fixed in
3% paraformaldehyde for 1 h and then processed for FISH as
described below.
Nucleoskeletal Functions in Trypanosomes
PLoS Biology | www.plosbiology.org15 March 2012 | Volume 10 | Issue 3 | e1001287