Transcriptional regulator PerA influences biofilm-associated, platelet binding, and metabolic gene expression in Enterococcus faecalis.

Abstract

Enterococcus faecalis is an opportunistic pathogen and a leading cause of nosocomial infections, traits facilitated by the ability to quickly acquire and transfer virulence determinants. A 150 kb pathogenicity island (PAI) comprised of genes contributing to virulence is found in many enterococcal isolates and is known to undergo horizontal transfer. We have shown that the PAI-encoded transcriptional regulator PerA contributes to pathogenicity in the mouse peritonitis infection model. In this study, we used whole-genome microarrays to determine the PerA regulon. The PerA regulon is extensive, as transcriptional analysis showed 151 differentially regulated genes. Our findings reveal that PerA coordinately regulates genes important for metabolism, amino acid degradation, and pathogenicity. Further transcriptional analysis revealed that PerA is influenced by bicarbonate. Additionally, PerA influences the ability of E. faecalis to bind to human platelets. Our results suggest that PerA is a global transcriptional regulator that coordinately regulates genes responsible for enterococcal pathogenicity.

Full text

Page 1

Transcriptional Regulator PerA Influences Biofilm-
Associated, Platelet Binding, and Metabolic Gene
Expression in Enterococcus faecalis
Scott M. Maddox1, Phillip S. Coburn2, Nathan Shankar2*, Tyrrell Conway1
1Advanced Center for Genome Technology, University of Oklahoma, Norman, Oklahoma, United States of America, 2Department of Pharmaceutical Sciences, The
University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma, United States of America
Abstract
Enterococcus faecalis is an opportunistic pathogen and a leading cause of nosocomial infections, traits facilitated by the
ability to quickly acquire and transfer virulence determinants. A 150 kb pathogenicity island (PAI) comprised of genes
contributing to virulence is found in many enterococcal isolates and is known to undergo horizontal transfer. We have
shown that the PAI-encoded transcriptional regulator PerA contributes to pathogenicity in the mouse peritonitis infection
model. In this study, we used whole-genome microarrays to determine the PerA regulon. The PerA regulon is extensive, as
transcriptional analysis showed 151 differentially regulated genes. Our findings reveal that PerA coordinately regulates
genes important for metabolism, amino acid degradation, and pathogenicity. Further transcriptional analysis revealed that
PerA is influenced by bicarbonate. Additionally, PerA influences the ability of E. faecalis to bind to human platelets. Our
results suggest that PerA is a global transcriptional regulator that coordinately regulates genes responsible for enterococcal
pathogenicity.
Citation: Maddox SM, Coburn PS, Shankar N, Conway T (2012) Transcriptional Regulator PerA Influences Biofilm-Associated, Platelet Binding, and Metabolic Gene
Expression in Enterococcus faecalis. PLoS ONE 7(4): e34398. doi:10.1371/journal.pone.0034398
Editor: Michael Chaussee, University of South Dakota, United States of America
Received November 28, 2011; Accepted February 27, 2012; Published April 4, 2012
Copyright: ? 2012 Maddox et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by grants AI48945 and GM095370 from the National Institutes of Health (nih.gov). The funders had no role in study design,
data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: nathan-shankar@ouhsc.edu
Introduction
As a commensal member of the intestinal microbiota, the
enterococci play an important role in establishing a healthy GI
tract and typically coexist in the host as a relatively small, yet
stable, population. Alternatively if the delicately balanced host/
commensal relationship is disrupted, if specific environmental cues
are detected, or if virulence traits are acquired, enterococci can act
as opportunist pathogens capable of multiple-site infections,
including infections of the heart, urinary tract, and bloodstream
[1,2,3]. In an effort to better understand the differences between
commensal and pathogenic enterococci, studies of pathogenic
enterococci increasingly seek to discover which traits promote
virulence, how these traits are inherited and what mechanisms are
used to coordinately regulate these traits to achieve pathogenicity.
While the enterococci have been known as infective agents for
more than 100 years [4], the majority of information regarding the
acquisition and deployment of virulence traits has been gathered
in the last few decades [5,6,7]. As a result of these studies, we have
a clearer picture of how the enterococci successfully transition
from a commensal to a pathogen. At the heart of this transition is
enterococcal promiscuity: the ease and frequency with which
many strains acquire and transmit mobile genetic elements
harboring loci that contribute to pathogenesis. In addition to
being intrinsically resistant to a broad range of antimicrobial
agents, enterococci have evolved resistance to many antibiotics by
acquiring plasmids or transposons comprised of genes that confer
resistance. Developing antibiotic resistance has increased the
pathogenic potential of the enterococci, as is evident by these
organisms becoming the leading cause of surgical site infections,
the second leading cause of bloodstream infections and the third
leading cause of nosocomial urinary tract infections [8]. Further-
more, antibiotic resistant strains are more likely to contain mobile
genetic elements that may harbor virulence traits [9]. Especially
problematic are strains that acquire both antibiotic resistance and
virulence traits, as the concurrence of these factors is correlated
with strains capable of producing infection outbreaks on a global
scale [10].
Facilitating the spread of virulence traits in a particularly
efficient manner are pathogenicity islands (PAI). PAI’s are
characterized as clusters of genes encoding proteins with roles
involving transfer functions, virulence, stress survival, and
transcriptional regulation [11]. Furthermore these mobile genetic
elements can be distinguished from the native chromosome by a
significantly different G+C content [11]. While first discovered in
pathogenic Escherichia coli [12,13], these mobile genetic elements
are disseminated throughout many bacterial genera [11]. A
153 kb PAI consisting of 129 open reading frames was discovered
in Enterococcus faecalis MMH594 and shown to disperse to many E.
faecalis strains of various origins [10,14,15]. This PAI contains
many loci with roles in virulence, including esp (encodes
enterococcal surface protein), cytolysin toxin, and aggregation
substance, as well as factors potentially involved in horizontal
transfer and gastrointestinal tract colonization [14]. Esp is
PLoS ONE | www.plosone.org1April 2012 | Volume 7 | Issue 4 | e34398

Page 2

enriched among infection-derived isolates and has been shown to
increase in vitro biofilm formation [16,17]. The eight genes
comprising the cytolysin operon (cylR1, cylR2, cylLL, cylLS, cylMBAI)
form a two-peptide lytic toxin [18,19]. Cytolysin toxin is effective
against both prokaryotic and eukaryotic cells [20,21], and
contributes to mortality in various pathogenic models of infection
[22,23,24]. A pheromone-inducible aggregation substance (AS)
can also be found in many enterococcal strains. AS promotes
aggregation and conjugation [25,26], increases enterococcal
adherence to and uptake in eukaryotic cells [27,28] and increases
bacterial survival inside the macrophage [29].
Frequently, PAI’s contain genes encoding transcriptional
regulators with various regulatory schemes, and the E. faecalis
PAI is no exception [11,14]. The E. faecalis PAI encodes an AraC-
type regulator, named PerA (for pathogenicity island-encoded
regulator) [14,30]. PerA is enriched among clinical E. faecalis
isolates and lies adjacent to the aforementioned PAI-encoded
virulence traits, which suggests PerA-dependent regulation of these
genes [14]. Through mutational analysis, we have previously
shown that PerA influences biofilm formation in a medium-specific
manner and contributes to virulence in a mouse peritonitis model
[30]. Additionally, the PerA-deficient strain was significantly
attenuated during macrophage survival, further supporting the
role of PerA as an important regulator of E. faecalis pathogenesis
[30].
Prompted by the observation that PerA coordinates E. faecalis
virulence in the mouse peritonitis infection model, we sought to
identify the genes that are regulated directly or indirectly by PerA.
We used Affymetrix GeneChip microarrays to experimentally
define the PerA regulon throughout exponential growth, upon
transition into stationary phase and during stationary phase
persistence. Our results suggest that PerA primarily regulates
genes located outside of the PAI in a growth phase-dependent
manner. These PerA-regulated genes are located throughout the
E. faecalis chromosome and include loci responsible for amino acid
metabolism, biofilm formation and phage-associated genes
putatively involved in platelet binding. Further experimentation
revealed that PerA influences the ability of E. faecalis to bind
human platelets and respond to the presence of bicarbonate.
Taken together with our previous findings [30], we interpret these
results to mean that PerA acts as a global transcriptional regulator
to coordinately regulate genes responsible for enterococcal
pathogenicity.
Results
Overview of microarray data
PerA is an AraC-type transcriptional regulator that contributes
to pathogenesis in E. faecalis [30]. To define the PerA regulon,
transcriptional profiling was performed on E. faecalis E99 and an
isogenic DperA mutant strain (designated DBS01) using RNA
extracted from both strains at time points corresponding to mid-
exponential,late-exponential,
600 nm,0.05, 0.5, and 1.0, respectively). The RNA was
reverse-transcribed and subsequently hybridized to E. faecalis
V583 genome microarrays. All array data shown are expressed as
ratios (DBS01 : E99) and considered to be significant if gene
expression was induced or repressed in the mutant strain greater
than twofold. The PerA regulon is extensive, as transcriptional
analysis revealed 151 genes differentially regulated.twofold
(log2=1) in DBS01 (Table S1). Of these 151 genes, 98 were up-
regulated and 53 were down-regulated. Nearly one-third (46 of
151) of the differentially regulated genes have unknown function,
20 are involved in metabolic functions, and 19 encode transport-
andstationaryphase(O.D.
related genes. Of the 98 up-regulated genes, 19 are up-regulated in
mid-exponential phase only, 6 are up-regulated in late-exponential
phase only, and 57 are up-regulated only in stationary phase
(Figs. 1A and 1B). Of the 53 down-regulated genes 10 are down-
regulated only in mid-exponential phase, 11 are down-regulated
only in late-exponential phase, and 27 are down-regulated only in
stationary phase (Fig. 1A). These data suggest that while PerA is
primarily a negative regulator, it can also act as a dual regulator, as
a positive influence on gene expression is also noted (Figs. 1A and
1B). Additionally, the PerA target genes show a high degree of
growth-phase dependent regulation, with the highest degree of
influence occurring in stationary phase (Figs. 1A and 1B). Finally,
we verified expression of perA in E99 using quantitative reverse
transcription PCR (qRT-PCR) and found that expression of perA
was maximal during stationary phase (data not shown); a finding
that reflects the high degree of PerA regulation at this time point.
DBS01 shows altered expression of PAI-related genes
The 153 kb PAI carries virulence determinants (including
cytolysin, Esp, and aggregation substance) adjacent to perA
[14,30]. The proximity of the perA gene to genes with ascribed
roles in virulence is suggestive of PerA regulation of PAI genes. In
DBS01, 5 PAI genes were differentially regulated in any of the
time points studied (Figs. 1B and 2). During mid-exponential
growth the EF0579 gene was induced (Fig. 1B). This locus encodes
a putative TetR-family protein with unknown function in E.
faecalis. Four genes encoding hypothetical proteins (EF0488,
EF0531, EF0532, EF0533) were down-regulated between 2 and
4 fold in DBS01 at late-exponential phase (Fig. 1B). In stationary
phase the EF0579 gene was again induced, while the EF0488 gene
was no longer differentially regulated (Fig. 1B). The microarrays
used in this study were developed using the strain V583 sequenced
genome. V583 is missing portions of the cytolysin operon, nsr and
gls24-like genes, and the entire esp gene due to a spontaneous 17 kb
deletion within the PAI [14]. Therefore, qRT-PCR was used to
determine the expression of these PAI genes found in strain E99
but absent in V583. qRT-PCR revealed no differential regulation
of these genes in DBS01 at any time point tested (data not shown).
The differential regulation of PAI hypothetical genes, but not
genes with previously ascribed roles in virulence, may indicate
PerA-dependent control of genes with an unknown function in
enterococcal pathogenicity; however this possibility remains to be
studied.
The transcription of many housekeeping genes is altered
in DBS01
AraC-type regulators are known to control a variety of cellular
processes, including metabolism and other housekeeping functions
[31]. We mined the transcriptome to determine if any house-
keeping genes were regulated by PerA, and found a number of
genes differentially expressed in DBS01. A number of genes
involved in basic cellular metabolism were down-regulated in
DBS01, including galK, rbsK (EF2961) and rbsD (EF2960) (Fig. 1B).
galK encodes for galactokinase, while rbsK and rbsD encode for
ribokinase and a ribose transporter, respectively, and are
potentially required for transport and metabolism of galactose
and ribose. Many housekeeping genes are induced in DBS01,
including genes encoding ribosomal proteins (rplQ, rpsP, rpsD
[EF3070], rpmB [EF3116] and rpmH [EF3333]) and pyrimidine
nucleotide biosynthetic genes (purA, EF0014) (Fig. 1B). Lastly,
putative peptide ATP-binding cassette (ABC) transporters were
significantly induced in DBS01. While poorly studied in E. faecalis,
these peptide transporters generally provide nutrients to bacteria
in the form of amino acids or short peptides [32,33]
The PerA Regulon in Enterococcus faecalis
PLoS ONE | www.plosone.org 2April 2012 | Volume 7 | Issue 4 | e34398

Page 3

PerA regulates biofilm-related genes in E99
E. faecalis E99 is a urinary-tract isolate possessing a high biofilm
phenotype [34]. Recently a ubiquitous enterococcal locus was
characterized and named ebp [35]. The ebpABC operon encodes
the enterococcal biofilm-associated pilus and contributes to
endocarditis, urinary tract infections (UTI), and biofilm formation
[35,36]. The EbpABC proteins are polymerized through the
activity of Bps (formerly, SrtC), and together are required for
maximal biofilm production in E. faecalis [35]. EbpR acts as a
transcriptional activator of ebpABC and positively influences
biofilm formation [37]. As previously shown, the PerA regulator
influences E99 biofilm formation in a medium-dependent manner
[30]. To determine if PerA regulates ebpABC and bps gene
expression, we compared the transcriptome of DBS01 to E99
Figure 1. Comparisons of microarray results for E99 and DBS01. Control RNA was extracted from E99 and used to normalize the test RNA
extracted from DBS01 (DBS01 : E99). All data presented here are shown as fold change in gene expression (test : control). (A) Upper diagram: Venn
diagram comparing significantly up-regulated genes (.2 fold) in DBS01 during mid-exponential, late-exponential and stationary phase. Lower
diagram: Venn diagram comparing significantly down-regulated genes (.2 fold) in DBS01 during mid-exponential, late-exponential, and stationary
phase. (B) Hierarchically-clustered heat map of all genes differentially regulated.twofold between DBS01 and E99.
doi:10.1371/journal.pone.0034398.g001
The PerA Regulon in Enterococcus faecalis
PLoS ONE | www.plosone.org3April 2012 | Volume 7 | Issue 4 | e34398

Page 4

during mid-exponential, late-exponential, and stationary phase. In
DBS01, the ebpABC operon and associated bps gene was induced
between 4 and 8-fold during mid-exponential and stationary
phases (average operon induction=6.2-fold) (Fig. 3). The
transition from mid-exponential to late-exponential growth was
concomitant with an increase in expression of the ebpABC operon
(average operon induction=8.8-fold) (Fig. 3). Induction of the
ebpABC and bps genes was confirmed by using qRT-PCR (Table 2).
The high degree of ebpABC up-regulation shown here, as well as
the increase in biofilm formation previously shown in DBS01 [30],
suggests that PerA may act as a repressor of the ebpABC operon
and associated bps gene in E99.
Next we sought to examine if PerA regulates other biofilm-
related genes found in E99, including esp, the bee locus, and
fsrABCD operon. esp encodes for enterococcal surface protein, a
high-molecular weight protein that has been shown to enhance
biofilm formation [16,38]. The bee locus is a unique five-gene
system that contributes to the high biofilm phenotype found in
E99 [34]. The microarrays used for this experiment were derived
from the E. faecalis V583 sequenced genome. V583 is missing the
esp gene due to a 17 kb PAI deletion [14], and does not contain the
conjugative plasmid harboring the bee locus (unpublished results).
Therefore it was impossible to examine gene expression of these by
using microarrays. qRT-PCR was used to determine possible
changes in gene expression for the esp and bee loci. When
comparing DBS01 and E99 using qRT-PCR, no significant
differential regulation of the esp or bee loci in any of the three
growth phases tested was observed (data not shown).
The fsr system, encoded by the fsrABCD operon, is similar to the
agrABCD operon found in Staphylococcus aureus [39]. Through the
production of gelatinase-biosynthesis activating pheromone, fsr
activates two genes encoding a gelatinase (gelE) and a serine
protease (sprE) resulting in biofilm formation [39,40,41,42,43].
Though little is known about the fsr or gelE-sprE loci in E99,
approximately 60% of E. faecalis clinical isolates produce gelatinase
[44]. We searched the microarray data and found no differentially
regulated genes in either the fsr or gelE-sprE loci in DBS01. Taken
together these data suggest that PerA may act to repress the
ebpABC operon and associated sortase while having little to no
influence on the expression of the esp, bee or fsr loci under the
conditions tested.
perA and ebpABC respond to the presence of bicarbonate
in E99
Using b-gal assays and qRT-PCR, Bourgogne et al. have
recently shown that E. faecalis OG1RF ebpABC expression increases
when grown in sodium bicarbonate in an ebpR-dependent manner
[45]. Our data suggest that PerA acts as a repressor of the ebpABC
locus (Figs. 1B and 3). Furthermore, AraC-type regulators are
known to respond to bicarbonate, including RegA in Citrobacter
rodentium and ToxT in Vibrio cholerae [46,47]. Given that OG1RF
lacks the E. faecalis PAI, including perA, we were curious to
determine the effects of bicarbonate on ebpABC expression in E99.
To do this we analyzed the transcriptome of E99 grown in THB
supplemented with 100 mM sodium bicarbonate. When com-
pared to E99 grown in THB, perA expression was down-regulated
in the presence of bicarbonate while ebpR (the activator of ebpABC)
was moderately induced (Fig. 4). Furthermore, the average ebpABC
expression increased approximately 7-fold (ebpA=8.0, ebpB=7.7,
ebpC=4.9), with the biofilm and pilus-associated sortase (bps) being
induced 4-fold (Fig. 4).
We reasoned that if PerA represses the ebpABC locus, a down-
regulation of perA in the presence of bicarbonate would cause a
response similar to that seen in DBS01 (DperA). When comparing
the transcriptome of E99 grown in THB supplemented with
100 mM sodium bicarbonate to DBS01 grown in THB, similar
trends in perA, ebpR-ebpABC and bps gene expression are observed
(Fig. 4). These results suggest that perA is down-regulated in the
presence of bicarbonate, concomitant with an induction of the
ebpR-ebpABC and bps loci.
Effect of the perA mutation on expression of ADI
pathway
The arginine deiminase (ADI) system is used by many
microorganisms to generate ATP via arginine fermentation [48].
Genes comprising the ADI pathway in E. faecalis are arranged as
the arcABCRD operon (ArcA, arginine deiminase, ArcB, ornithine
carbamolytransferase; ArcC, carbamate kinase; ArcR, Crp/Fnr
regulator, ArcD arginine/ornithine antiporter), and are known to
be transcribed in the presence of arginine [49]. The ADI operon
has a complex regulatory scheme with binding sites for two
arginine-sensitive regulators (ArgR1 and ArgR2), a catabolite
control protein (CcpA), as well as a protein involved in E. faecalis
pathogenicity (Ers) [49,50]. The regulatory roles of ArgR1 and
ArgR2 remain unclear, however multiple Arg boxes can be found
Figure 2. All genes differently regulated in DBS01 mapped
onto the E. faecalis chromosome. The outer ring displays those
genes differentially regulated during mid-exponential phase. The
middle ring displays those genes differentially regulated during late-
exponential phase. The inner ring displays those genes differentially
regulated during stationary phase. The innermost circle displays the
location relative to position zero in millions of base pairs of the E.
faecalis V583 genome. The locations of the arginine deiminase (ADI)
and enterococcal biofilm-associated pilus (Ebp) operons, the E. faecalis
pathogenicity island (PAI), and a phage related element are indicated.
doi:10.1371/journal.pone.0034398.g002
The PerA Regulon in Enterococcus faecalis
PLoS ONE | www.plosone.org4April 2012 | Volume 7 | Issue 4 | e34398

Page 5

upstream of the ADI operon and data suggests that ArgR2 may
act as an arginine-specific signal transducer [49]. Furthermore,
expression of argR1 and argR2 increases in the presence of arginine
and is absent in glucose containing medium [49]. In DBS01 the
arcABCRD operon is highly up-regulated in all time points tested
(Fig. 3). On average, the arcABCRD operon is induced 7.6-fold
during mid-exponential growth and plateaus upon entrance into
late exponential phase induced 11-fold. The average expression of
the arcABCRD genes is up-regulated 3-fold during stationary phase.
This pattern of ADI pathway regulation is similar to that
previously observed in E. faecalis. Bourgogne et al. found that the
enterococcal FsrB transcriptional regulator negatively influences
arcABC expression during transition from exponential to stationary
phase; though it is unclear if this regulation is direct or indirect
[51]. Riboulet-Bisson et al. have shown that the Ers regulator
activates arcABC expression by binding upstream of the arcA gene
[50]. For unknown reasons and in contrast to this study, arcRD
gene expression was not differentially regulated by FsrB or Ers
[50,51]. In DBS01 argR1 gene expression was induced at all time
points tested (Fig. 3) while the argR2 gene was not differentially
regulated (data not shown). The argR1 and arcABCRD genes
account for 60% (6 out of 10) of the genes up-regulated in all time
points tested (Figs. 1A and 3), suggesting the PerA regulator may
act as a repressor of arginine catabolism in E. faecalis.
PerA regulates a putative temperate bacteriophage in
E99
Temperate bacteriophages are disseminated throughout many
gram-positive bacteria, including E. faecalis. The E. faecalis V583
sequenced genome contains seven regions arising from integrated
phages [52]. Though the role of these phages in E. faecalis
virulence has yet to be discovered, each of these mobile elements
contains homologs of virulence determinants from Streptococcus mitis
phage SM1 [52,53]. We mined the microarray data for each of
these putative phage-related genes, and found a cluster of genes
similar to phage 04 in V583 that was differentially regulated in
DBS01 (Figs. 2 and 5). This element spans ef1985–ef2043 and
Figure 3. Plots comparing the log2expression ratios of the arginine deiminase (ADI) and enterococcal biofilm associated pilus
(Ebp) operons in DBS01.
doi:10.1371/journal.pone.0034398.g003
Table 1. qRT-PCR primers used in this study.
PrimerSequence (59 - 39)
arcA-F AAGCCAATATTCGCAGCGAA
arcA-R AATGCCTGCAATCGCTTTTT
arcB-FTTTGACGGGATTGAGTTCCG
arcB-R TGCCATTGATCCGTTAAACCA
arcC-F ATGATGCTAGCGCACATGCA
arcC-RGCCATGTGAAACAATCAACCG
arcR-FTCCGAGAATCGGACTGTTTCA
arcR-R AACGCTCAAACAGTTTAACTGGC
ebpA-F ACCGCGGATGAAAGCTATCA
ebpA-RCCAGGAACTGCTAATTCACGG
ebpB-F CGTACAGGCGGCAAGTCTTT
ebpB-RAGGTATTCCCCCGCTTGATT
ebpC-F GAATTTTACGAGCAACGAGCG
ebpC-RTCGGTGGTTCCTTGAGCAAC
bps-F CATTTCAGGCCATCGTGGTC
bps-RGCGTCTTCCCATTGACTTCG
16S-FAGCCGGAATCGCTAGTAATCG
16S-RTCGGGTGTTACAAACTCTCGTG
doi:10.1371/journal.pone.0034398.t001
Table 2. Members of the PerA regulon confirmed by qRT-
PCR.
Fold-Change*
Gene Product 0.050.51.0
ebpAvon Willebrand factor7.8 (0.07)30.0 (0.05)21.1 (0.02)
ebpB Cell wall surface protein 14.0 (0.03) 30.0 (0.03)19.7 (0.02)
ebpC Cell wall surface protein 14.0 (0.1)27.9 (0.06) 19.7 (0.1)
bps Sortase2.6 (0.05) 2.8 (0.06)2.0 (0.01)
arcA Arginine deiminase30.0 (0.03)274.4 (0.1) 9.8 (0.03)
arcB Ornithine carbamoyltransferase 24.3 (0.01)181.0 (0.3) 13.9 (0.04)
arcCCarbamate kinase 8.0 (0.1)73.5 (0.2)19.7 (0.05)
arcR Transcriptional regulator Crp/Fnr 4.3 (0.1)64.0 (0.1) 18.4 (0.08)
*Change in DBS01 gene expression (DBS01 : E99) at OD600=0.05, 0.5 and 1.0.
Experiments were repeated twice, with 3 replicates for each gene per assay.
Mean values shown (standard error in parenthesis).
doi:10.1371/journal.pone.0034398.t002
The PerA Regulon in Enterococcus faecalis
PLoS ONE | www.plosone.org5 April 2012 | Volume 7 | Issue 4 | e34398

Page 6

contains putative replication, integration and virulence functions.
The majority of genes on the phage display either no change or
non-significant induction or repression in DBS01 throughout all
growth phases. However a group of genes show significant growth
phase-independent repression in DBS01, including homologs of
pblA, pblB and a gene encoding a putative lysin (Fig. 5). PblA and
PblB mediate bacterial attachment to platelets in S. mitis [54]. The
lysin protein serves a dual purpose: permeablizing the bacterial cell
wall, thus permitting release of PblA and PblB, and binding to
platelets through interaction with fibrinogen and fibrinogen
receptors [55,56]. E. faecalis is known to aggregate human
platelets, yet the molecular mechanisms coordinating this process
have not been discovered [57]. The repression of pblA, pblB and
lysin in DBS01 suggests that PerA influences the expression of
genes putatively involved in platelet binding and cell wall
permeability residing on a temperature bacteriophage in E99.
PerA influences the binding to human platelets
PerA differentially regulates two distinct loci potentially
important in bacterial attachment to human platelets. First are
the putative pblA, pblB and lysin genes residing on a temperate
bacteriophage. Next is the Ebp pilus, which has recently been
shown to mediate bacterial attachment to human platelets [58].
Given that genes potentially involved in platelet binding were both
induced and repressed in DBS01 (the ebp and phage-related loci,
respectively), we sought to determine if DBS01 showed an altered
ability to bind human platelets. To assess this we compared the
ability of E99 and DBS01 to adhere to human platelets
immobilized in microtiter plates. As shown in Fig. 6, DBS01
binds human platelets significantly (P,0.0005, unpaired t-test)
better than the E99 wild-type strain. DBS01 bound platelets
approximately 5-fold better than E99. When DBS01 contained a
plasmid-encoded copy of perA (pGT101), platelet-binding abilities
were restored to the wild-type levels (Fig. 6). These results suggest
that the inactivation of perA increases platelet binding in DBS01,
possibly through the derepression of the ebpABC locus.
Discussion
The perA gene is located on the E. faecalis PAI, adjacent to loci
with ascribed roles in virulence and genes with putative metabolic
functions [14]. Given its location, it was our hypothesis that the
primary function of PerA was to regulate the expression of PAI
genes in E. faecalis. However, transcriptional analysis revealed that
in DBS01 only 5 PAI genes of unknown function were altered in
gene expression during the time course study. To our surprise the
overwhelming majority of genes differentially regulated in the
DperA mutant were chromosomally located yet not residing within
the PAI. McBride et al. [10] have recently suggested that the
enterococcal PAI is comprised of clusters of genes that likely
undergo horizontal transfer as modules. Additionally, portions of
the enterococcal PAI have been shown to conjugatively transfer
both in vitro and in vivo [15]. These findings raise the possibility that
PerA is able to transfer to strains lacking the PAI and subsequently
exert alien control of native genes. In this scenario, the acquisition
of the transcriptional regulator PerA could effect a rapid
physiological change in the recipient. In Salmonella, HilD, a
transcriptional regulator encoded on the Salmonella pathogenicity
island SPI-1, has been shown to regulate genes on the evolutionary
distinct SPI-2 pathogenicity island [59]. Furthermore, E. coli strain
K12 genes can be regulated by Ler, a regulator located on the
locus for enterocyte effacement (LEE) pathogenicity island of
strain O157:H7 [60]. Our data suggest that PerA may have the
ability to control native chromosomal genes upon entry into a
recipient; however, the ability of PerA to transfer into an
enterococcal strain lacking the PAI and regulate native genes
remains to be tested.
Biofilm formation is often a key component of bacterial
pathogenesis [61,62,63]. Though not necessarily a virulence trait,
as biofilms are also produced by many avirulent bacteria, biofilms
contribute to pathogenicity by increasing resistance to antibiotics
and environmental stresses [64]. In E. faecalis, biofilms are
correlated with infective endocarditis [37] and urinary tract
infections [36], and promote bacterial survival inside phagocytes
Figure 4. perA, ebpR-ebpABC and bps gene expression in E99 grown in THB supplemented with 100 mM sodium bicarbonate (dark
bars) or DBS01 grown in THB (light bars). Microarray assays were performed twice. The values shown are mean expression intensities (mean 6
SD) of biological replicates. Fold changes in gene expression were calculated by comparing E99 grown in THB to E99 grown in THB+100 mM sodium
bicarbonate and by comparing DBS01 grown in THB to E99 grown in THB.
doi:10.1371/journal.pone.0034398.g004
The PerA Regulon in Enterococcus faecalis
PLoS ONE | www.plosone.org6 April 2012 | Volume 7 | Issue 4 | e34398

Page 7

[65]. PerA has been shown to influence biofilm formation in a
medium specific manner, as a perA-deficient strain designated
DBS01 produced more biofilm than the WT strain E99 [30].
Transcriptional profiling revealed that the enterococcal biofilm
associated pilus (ebp) locus, a ubiquitous determinant important for
biofilm production [35], was up-regulated in DBS01. This makes
possible the interesting scenario where the PAI-residing perA could
transfer to recipient strains and influence biofilm formation
through regulation of the ebp locus.
Expression of the ebp genes is controlled through multiple
transcriptional regulators. In addition to the PerA-dependent
repression of the ebp operon (Figs. 1B and 3), these genes are
activated through the action of EbpR [37]. More recently Gao et
al. have shown that expression of the ebp locus in E. faecalis
OG1RF is influenced by rnjB, a gene encoding RNase J2 [66].
OG1RF strains deficient in RNase J2 expression have reduced
ebpABC transcript levels and fail to produce Ebp pili, however the
regulatory mechanism responsible for these observations is
currently unknown [66]. Though poorly studied in E. faecalis,
Figure 6. Platelet binding activity of E99 and DBS01. The values shown are percent of wild-type (E99) binding (mean 6 SD). Differences in
platelet binding efficiencies were determined using an unpaired t-test (P=0.05). Platelet binding assays were performed in triplicate and each
experiment was repeated thrice (n=9).
doi:10.1371/journal.pone.0034398.g006
Figure 5. Map of E. faecalis V583 phage 04. The putative proteins were compiled using the annotated V583 sequence. The direction of
transcription is shown in blue (reverse) and red (forward). Heat maps of expression ratios (fold change) for DBS01 are shown for mid-exponential (O.D.
600=0.05), late-exponential (O.D. 600=0.5) and stationary phase (O.D. 600=1.0).
doi:10.1371/journal.pone.0034398.g005
The PerA Regulon in Enterococcus faecalis
PLoS ONE | www.plosone.org7April 2012 | Volume 7 | Issue 4 | e34398

Page 8

RNase J1 and J2 are highly conserved proteins encoded by rnjA
and rnjB, respectively [66,67]. In B. subtilis, the RNase J1 and J2
enzymes form heterotetramer complexes and are typically
involved in mRNA processing, stability and turnover [68,69].
We do not know if E99 possesses rnjA and rnjB, however these
genes appear to be ubiquitous as every E. faecalis sequenced
genome contain these loci [66]. Furthermore, we do not know how
PerA, EbpR, and RNase J1 and J2 are structured within the
regulatory network controlling Ebp pilus formation. It is possible
that RNase J1 and J2 function independently of either PerA or
EbpR. This would account for the absence of Ebp pili in EbpR
containing strains grown in pilus-inducing conditions [66].
E. faecalis is known to aggregate platelets [57] a phenotype
mediated, at least in part, by the Ebp pilus [58]. When comparing
the ability of DBS01 and E99 to bind human platelets, DBS01 was
found to adhere to platelets significantly (,5 fold) better than E99
(Fig. 6). This ability to bind platelets is frequently implicated in
promoting infective endocarditis [70,71]. When the heart valves
become damaged, platelet aggregation on the damaged tissue can
serve as binding foci for circulating bacteria. In animal studies,
these vegetations cause the further accumulation of platelets and
bacteria onto the infected surface, a condition that may lead to
heart failure or death [72].
PerA influenced the expression of a number of genes involved in
amino acid metabolism. The majority of these genes comprise the
ADI pathway (arcABCRD) in E. faecalis. The ADI pathway is used
by E. faecalis to produce ATP via arginine fermentation [73,74].
Expression of arcABCRD is tightly controlled as the ADI promoter
region contains multiple binding sites for transcriptional regulators
and catabolite repression elements [49]. Riboulet-Bisson et al. [50]
recently identified an Ers (enterococcal regulator of survival)
binding site upstream of the arcA gene, and suggested an activator
role for this protein. In the current work, microarray analysis
revealed that the ADI pathway is highly induced in DBS01, which
is suggestive of PerA repression of these genes. Of interest is the
increase in arcABCRD gene expression concomitant with the
induction of the ebp locus in DBS01 (Fig. 3). During an infection, it
is possible that these coordinately PerA-regulated genes perform a
related function. In the presence of host proteins or amino acids,
the de-repression of the arcABCRD operon would permit the
transport and degradation of liberated arginine. In this scenario
arginine fermentation may provide energy for biofilm formation
during pathogenesis. The biofilms could then serve to increase
bacterial persistence inside the host and further the invasion of
nutrient-rich host tissue. Furthermore, the PerA regulon comprises
genes encoding a putative peptide ABC transport system (Fig. 2).
These peptide transport systems provide nutrients to the cell by
internalizing amino acids and short peptides, and are often critical
for the survival of auxotrophic lactic acid bacteria [32]. Zhu et al.
[62] found that clinical isolates of Staphylococcus aureus selectively
extracted arginine from growth media during biofilm formation.
Chaussee et al. [75] found that in Streptococcus pyogenes the
expression of virulence factors is coordinately regulated with
amino acid catabolism. In this work, we show that PerA regulates
genes involved in amino acid catabolism and biofilm formation,
which further suggests a regulatory, if not functional, correlation
between amino acid degradation and biofilm formation. While
intriguing, the correlation between arginine metabolism and
biofilm formation in E. faecalis remains to be studied.
Bicarbonate production is important for maintaining pH
homeostasis in the small intestine, as it neutralizes acid in the
intestinal lumen and prevents damage to the adherent mucus layer
[76,77]. Many pathogens use the presence of bicarbonate as an
environmental signal to coordinate the expression of virulence
traits and frequently AraC-type regulators are involved [46,47,78].
Bourgogne et al. have shown that the transcription of the E. faecalis
OG1RF ebp locus is enhanced in the presence of bicarbonate, yet
the regulatory cascade linking bicarbonate to ebp expression is
unclear. In E99, PerA appears to be a repressor of ebpABC
expression (Figs. 1B and 3). In the presence of bicarbonate perA
was down-regulated concomitant with an induction of ebpR-
ebpABC and bps expression (Fig. 4). This suggests that in E99, PerA
may be part of the regulatory cascade controlling ebp expression in
response to bicarbonate whereby the production of bicarbonate in
the intestine causes a down-regulation of perA, which leads to the
production of the Ebp pilus. In this scenario, the sensing of
environmental bicarbonate ultimately stimulates the production of
an adhesin that could aid in colonization of the intestine.
From our data we are unable to determine if PerA directly
responds to bicarbonate or if it is influenced by other regulatory
mechanisms that either detect bicarbonate or are influenced by the
slight change in pH introduced by bicarbonate addition. AraC-
type regulators are comprised of a conserved C-terminal DNA-
binding domain and a N-terminal domain important for ligand
binding. Comparisons of the PerA sequence to other AraC-type
regulators that are known to detect bicarbonate (C. rodentium RegA
and V. cholerae ToxT) reveal that PerA exhibits C-terminus
similarity, yet virtually no N-terminus sequence similarity exists
(data not shown). Furthermore, we have previously shown that the
PerA N-terminus contains no similarities with other AraC-type
regulators [30]. It is possible that PerA senses bicarbonate using a
unique bicarbonate-binding motif, however it is also possible that
other regulators that sense bicarbonate may control perA
expression. In regards to the latter possibility, E. coli MarA and
SoxS are AraC-type regulators known to regulate transcription
without directly detecting a ligand [79,80].
PerA also appears to influence the expression of a number of
housekeeping genes. Perhaps most notably is the down-regulation
of genes in DBS01 involved in the basic metabolism of the cell,
concomitant with an induction of genes responsible for biofilm
formation and attachment to host cells (Fig. 1B). It is possible that
at the site of infection E99 uses PerA as a global dual-regulator to
orchestrate the down-regulation of many housekeeping genes non-
essential to pathogenicity while inducing genes responsible for
colonization and infection of the host.
We have previously shown that PerA contributes to E. faecalis
survival in the macrophage [30]. However, finding the PerA-
regulated genes that coordinate macrophage survival using our
current strategy has, thus far, proven inconclusive. We are keen to
realize the harsh phagosomal environment encountered by E.
faecalis during phagocytosis is almost certainly drastically different
than the conditions in this study. Though studies seeking to
determine the E. faecalis intracellular survival strategy have
increased our understanding of the challenges faced upon
phagocytosis, the whole-genome transcriptional response used by
E. faecalis during macrophage survival has yet to be revealed. This
information would not only yield a better understanding of the
phagosomal landscape during E. faecalis infection, but it would also
illuminate the E. faecalis macrophage survival strategy. During
intracellular survival, it is possible that basal (or perhaps enhanced)
expression of perA influences the transcription of hypothetical
function genes, thus impacting persistence within the macrophage.
In the current study we used whole-genome E. faecalis V583
microarrays to determine the PerA regulon in E99. Though we
used qRT-PCR to interrogate PAI genes in E99 that are missing
from V583, we realize there could be other genes present in E99
yet absent from the V583 microarray. E99 contains a large,
conjugative plasmid (pBEE99) comprised of genes that confer a
The PerA Regulon in Enterococcus faecalis
PLoS ONE | www.plosone.org8 April 2012 | Volume 7 | Issue 4 | e34398

Page 9

high biofilm phenotype and increased ultraviolet radiation
resistance [81]. Additionally pBEE99 contains genes putatively
encoding an aggregation substance and a two-component
bacteriocin [81]. Under the conditions tested PerA did not
regulate either the PAI genes or the bee locus. However, the
expression of the remaining pBEE99 genes in DBS01 remains to
be determined. Furthermore, since the E99 genome has yet to be
sequenced, this strain could possess unknown loci that are
potentially regulated by PerA and contribute to virulence.
In conclusion, our data suggests that PerA is a global
transcriptional regulator that coordinately controls genes impor-
tant for pathogenicity. We can now propose a mechanism of how
E99 achieves pathogenicity by using PerA as part of a regulatory
network controlling expression of virulence genes. When appro-
priate environmental signals are sensed (quite possibly the
presence of bicarbonate), the cell quickly and efficiently creates a
rapid physiological change by down-regulating one gene: perA. In
response to the environmental signal, the reduced levels of PerA
would alleviate repression of genes important for biofilm formation
and colonization of host tissues. Concurrently, metabolic and
substrate transport pathways critical for cell nutrition are induced
while unnecessary housekeeping genes are repressed, thus ensuring
the cell has the proper nutrients for pathogenicity.
Materials and Methods
Bacterial strains, media, and reagents
The strains used in this study were E. faecalis E99 [34] and an
isogenic DperA::ermR mutant (DBS01) [30]. The mutant DBS01
was complemented in trans as previously described [30]. The
strains were routinely cultured in Todd-Hewitt broth (THB)
containing 1% glucose or THB+1% glucose supplemented with
100 mM sodium bicarbonate when appropriate. Antibiotics used
for selection included kanamycin (25 mg/ml) and erythromycin
(50 mg/ml) (Sigma Chemical, St. Louis, MO). Growth was
monitored as absorbance at 600 nm using a Beckman-Coulter
DU800 spectrophotometer.
RNA isolation and Microarray analysis
RNA extraction and microarray analysis proceeded as previ-
ously described [82] with a few modifications. Briefly, strains E99
and DBS01 were grown at 37uC overnight in THB+1% glucose in
appropriate antibiotics. The bacteria were diluted 1:10,000 into
fresh, pre-warmed medium and incubated at 37uC. At predeter-
mined optical densities (600 nm; 0.05 for mid-exponential, 0.5 for
late-exponential, and 1.0 for stationary phase) cells were sampled
directly into ice-cold RNAlater (Ambion, Foster City, CA). Total
RNA was extracted using Qiagen RNeasy Minikits (Valencia, CA)
with optional on-column DNase treatment steps according to the
manufacturer’s specifications. RNA integrity was checked by gel
electrophoresis and stored in 2 volumes of ethanol at 280uC.
cDNA was generated by first strand synthesis using Superscript II
(Invitrogen, Carlsbad, CA) and random hexamers according to the
manufacturer’s specifications. Fragmentation and biotinylation of
cDNA proceeded according to the Affymetrix prokaryotic labeling
protocol using the ENZO Kit from Roche Diagnostics (Indianap-
olis, IN). Biotinylated cDNA was hybridized to custom Affymetrix
GeneChips for 16 h at 45uC. The custom microarrays used in this
study contained probes for several prokaryotic genomes including
Enterococcus faecalis V583 (GEO Accession number: GPL6702).
Affymetrix protocol ProkGE_WS2v2-450 was used to stain the
hybridized arrays. Following scanning, raw data files (.cel) were
analyzed using RMA processing with quartile normalization [83].
Biological and technical replicates were averaged, and genes were
considered to be significantly induced or repressed if the DBS01 :
E99 expression ratio was greater than twofold [84]. Heatmaps
were generated using DecisionSite for Functional Genomics
(Spotfire, Somerville, MA). The microarray data has been
deposited at GEO (GEO accession number, GSE31538). All data
are MIAME compliant.
qRT-PCR
Transcript levels were confirmed by qRT-PCR using RNA
extracted from cells harvested during mid-exponential, late-
exponential, and stationary phase. The primers listed in Table 1
were designed using Primer Express software provided with the
ABI Prism 7000 sequence detector (Applied Biosystems, Foster
City, CA). Amplicon lengths were 100 bp. Quantification of 16 S
rRNA levels was used as an internal control and to normalize
RNA. Amplification was detected using SYBR Green PCR Master
Mix (Applied Biosystems) with automatic calculation of threshold
value (CT). The fold changes in gene expression were determined
by comparing mRNA abundance in DBS01 to that in E99 as
previously described [85]. Analysis was repeated in triplicate on
two biological replicates for each time point. Replicates were
averaged and the results are presented in Table 2.
Assessment of Platelet Binding
The ability of E. faecalis cultures to bind human platelets was
assessed as previously described [55]. Briefly, human platelets were
washed, fixed and immobilized on poly-L-lysine-coated 22-mm-
diameter tissue culture wells at a concentration of 16108platelets
per well. Following 30 min incubation at 37uC, unbound platelets
were removed by aspiration. The remaining bound platelets were
subsequently incubated in a 1% casein solution for 1 h at 37uC to
reduce non-specific adherence. Following removal of the blocking
solution, each well was inoculated with 16108of E. faecalis E99,
DBS01, or DBS01 (pGT101) suspended in PBS and further
incubated with gentle rocking. After 1 h unbound bacteria were
removed by washing each well twice with PBS and the bound
bacteria were collected by scraping and resuspending them in
PBS. The number of bacteria bound to platelets was determined
by plating suspensions on THB supplemented with appropriate
antibiotics. Binding was expressed as a percentage of the
inoculum. Platelet binding assays were performed three times,
each assay replicated in triplicate (n=9) using blood from
multiple, healthy volunteers. Differences in platelet binding
efficiencies were determined using an unpaired t-test, as shown
in Fig. 6.
Ethics Statement
This study was performed under the supervision and approval
of the Institutional Review Board at the University of Oklahoma.
The platelets used in this study were purchased from Bioreclama-
tion (Long Island, NY) and obtained from a blood bank supplied
by healthy volunteers.
Supporting Information
Table S1
the E. faecalis E99 PerA regulon.
(XLSX)
The gene, locus tag, and annotated gene product for
Author Contributions
Conceived and designed the experiments: SMM PSC NS TC. Performed
the experiments: SMM PSC. Analyzed the data: SMM PSC NS TC.
Contributed reagents/materials/analysis tools: SMM PSC NS TC. Wrote
the paper: SMM.
The PerA Regulon in Enterococcus faecalis
PLoS ONE | www.plosone.org9April 2012 | Volume 7 | Issue 4 | e34398

Page 10

References
1.Shankar N, Lockatell CV, Baghdayan AS, Drachenberg C, Gilmore MS, et al.
(2001) Role of Enterococcus faecalis surface protein Esp in the pathogenesis of
ascending urinary tract infection. Infect Immun 69: 4366–4372.
Edmond MB, Wallace SE, McClish DK, Pfaller MA, Jones RN, et al. (1999)
Nosocomial bloodstream infections in United States hospitals: a three-year
analysis. Clin Infect Dis 29: 239–244.
Megran DW (1992) Enterococcal endocarditis. Clin Infect Dis 15: 63–71.
Maccallum WG, Hastings TW (1899) A case of acute endocarditis caused by
Micrococcus zymogenes (Nov. Spec.), with a description of the microorganism. The
Journal of Experimental Medicine 4: 521–534.
Palmer KL, Kos VN, Gilmore MS (2010) Horizontal gene transfer and the
genomics of enterococcal antibiotic resistance. Current Opinion in Microbiology
13: 632–639.
Hegstad K, Mikalsen T, Coque TM, Werner G, Sundsfjord A (2010) Mobile
genetic elements and their contribution to the emergence of antimicrobial
resistant Enterococcus faecalis and Enterococcus faecium. Clinical Microbiology
and Infection 16: 541–554.
Van Schaik W, Willems RJL (2010) Genome-based insights into the evolution of
enterococci. Clinical Microbiology and Infection 16: 527–532.
Richards MJ, Edwards JR, Culver DH, Gaynes RP (2000) Nosocomial
infections in combined medical-surgical intensive care units in the United
States. Infection control and hospital epidemiology : the official journal of the
Society of Hospital Epidemiologists of America 21: 510–515.
Palmer KL, Gilmore MS (2010) Multidrug-resistant enterococci lack CRISPR-
cas. mBio 1.
10. McBride SM, Coburn PS, Baghdayan AS, Willems RJL, Grande MJ, et al.
(2009) Genetic variation and evolution of the pathogenicity island of Enterococcus
faecalis. J Bacteriol. JB.00031-00009 p.
11. Hacker J, Kaper JB (2000) Pathogenicity islands and the evolution of microbes.
Annual Review of Microbiology 54: 641–679.
12. Low D, David V, Lark D, Schoolnik G, Falkow S (1984) Gene clusters governing
the production of hemolysin and mannose-resistant hemagglutination are closely
linked in Escherichia coli serotype O4 and O6 isolates from urinary tract
infections. Infect Immun 43: 353–358.
13. Hacker J, Knapp S, Goebel W (1983) Spontaneous deletions and flanking
regions of the chromosomally inherited hemolysin determinant of an Escherichia
coli O6 strain. J Bacteriol 154: 1145–1152.
14. Shankar N, Baghdayan AS, Gilmore MS (2002) Modulation of virulence within
a pathogenicity island in vancomycin-resistant Enterococcus faecalis. Nature 417:
746–750.
15. Coburn PS, Baghdayan AS, Dolan GT, Shankar N (2007) Horizontal transfer of
virulence genes encoded on the Enterococcus faecalis pathogenicity island.
Molecular Microbiology 63: 530–544.
16. Tendolkar PM, Baghdayan AS, Gilmore MS, Shankar N (2004) Enterococcal
surface protein, Esp, enhances biofilm formation by Enterococcus faecalis. Infect
Immun 72: 6032–6039.
17. Shankar V, Baghdayan AS, Huycke MM, Lindahl G, Gilmore MS (1999)
Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a
novel surface protein. Infect Immun 67: 193–200.
18. Booth MC, Bogie CP, Sahl HG, Siezen RJ, Hatter KL, et al. (1996) Structural
analysis and proteolytic activation of Enterococcus faecalis cytolysin, a novel
lantibiotic. Mol Microbiol 21: 1175–1184.
19. Gilmore MS, Segarra RA, Booth MC, Bogie CP, Hall LR, et al. (1994) Genetic
structure of the Enterococcus faecalis plasmid pAD1-encoded cytolytic toxin system
and its relationship to lantibiotic determinants. J Bacteriol 176: 7335–7344.
20. Coburn PS, Gilmore MS (2003) The Enterococcus faecalis cytolysin: a novel toxin
active against eukaryotic and prokaryotic cells. Cell Microbiol 5: 661–669.
21. Coburn PS, Pillar CM, Jett BD, Haas W, Gilmore MS (2004) Enterococcus faecalis
senses target cells and in response expresses cytolysin. Science 306: 2270–2272.
22. Ike Y, Hashimoto H, Clewell DB (1984) Hemolysin of Streptococcus faecalis
subspecies zymogenes contributes to virulence in mice. Infect Immun 45:
528–530.
23. Chow JW, Thal LA, Perri MB, Vazquez JA, Donabedian SM, et al. (1993)
Plasmid-associated hemolysin and aggregation substance production contribute
to virulence in experimental enterococcal endocarditis. Antimicrob Agents
Chemother 37: 2474–2477.
24. Garsin DA, Sifri CD, Mylonakis E, Qin X, Singh KV, et al. (2001) A simple
model host for identifying Gram-positive virulence factors. Proc Natl Acad
Sci U S A 98: 10892–10897.
25. Olmsted SB, Kao SM, van Putte LJ, Gallo JC, Dunny GM (1991) Role of the
pheromone-inducible surface protein Asc10 in mating aggregate formation and
conjugal transfer of the Enterococcus faecalis plasmid pCF10. J Bacteriol 173:
7665–7672.
26. Waters CM, Dunny GM (2001) Analysis of functional domains of the Enterococcus
faecalis pheromone-induced surface protein aggregation substance. J Bacteriol
183: 5659–5667.
27. Kreft B, Marre R, Schramm U, Wirth R (1992) Aggregation substance of
Enterococcus faecalis mediates adhesion to cultured renal tubular cells. Infect
Immun 60: 25–30.
28. Olmsted SB, Dunny GM, Erlandsen SL, Wells CL (1994) A plasmid-encoded
surface protein on Enterococcus faecalis augments its internalization by cultured
intestinal epithelial cells. J Infect Dis 170: 1549–1556.
2.
3.
4.
5.
6.
7.
8.
9.
29. Sussmuth SD, Muscholl-Silberhorn A, Wirth R, Susa M, Marre R, et al. (2000)
Aggregation substance promotes adherence, phagocytosis, and intracellular
survival of Enterococcus faecalis within human macrophages and suppresses
respiratory burst. Infect Immun 68: 4900–4906.
30. Coburn PS, Baghdayan AS, Dolan G, Shankar N (2008) An AraC-type
transcriptional regulator encoded on the Enterococcus faecalis pathogenicity island
contributes to pathogenesis and intracellular macrophage survival. Infect
Immun 76: 5668–5676.
31. Gallegos MT, Schleif R, Bairoch A, Hofmann K, Ramos JL (1997) Arac/XylS
family of transcriptional regulators. Microbiol Mol Biol Rev 61: 393–410.
32. Detmers FJM, Lanfermeijer FC, Poolman B (2001) Peptides and ATP binding
cassette peptide transporters. Research in Microbiology 152: 245–258.
33. Morishita T, Deguchi Y, Yajima M, Sakurai T, Yura T (1981) Multiple
nutritional requirements of lactobacilli: genetic lesions affecting amino acid
biosynthetic pathways. J Bacteriol 148: 64–71.
34. Tendolkar PM, Baghdayan AS, Shankar N (2006) Putative surface proteins
encoded within a novel transferable locus confer a high-biofilm phenotype to
Enterococcus faecalis. J Bacteriol 188: 2063–2072.
35. Nallapareddy SR, Singh KV, Sillanpaa J, Garsin DA, Hook M, et al. (2006)
Endocarditis and biofilm-associated pili of Enterococcus faecalis. Journal of Clinical
Investigations 116: 2799–2807.
36. Singh KV, Nallapareddy SR, Murray B (2007) Importance of the ebp
(endocarditis and biofilm-associated pilus) locus in the pathogenesis of
Enterococcus faecalis ascending urinary tract infection. The Journal of Infectious
Diseases 195: 1671–1677.
37. Bourgogne A, Singh KV, Fox KA, Pflughoeft KJ, Murray BE, et al. (2007)
EbpR is important for biofilm formation by activating expression of the
endocarditis and biofilm-associated pilus operon (ebpABC) of Enterococcus faecalis
OG1RF. J Bacteriol 189: 6490–6493.
38. Toledo-Arana A, Valle J, Solano C, Arrizubieta MJ, Cucarella C, et al. (2001)
The Enterococcal Surface Protein, Esp, is involved in Enterococcus faecalis biofilm
formation. Appl Environ Microbiol 67: 4538–4545.
39. Nakayama J, Cao Y, Horii T, Sakuda S, Akkermans ADL, et al. (2001)
Gelatinase biosynthesis-activating pheromone: a peptide lactone that mediates a
quorum sensing in Enterococcus faecalis. Molecular Microbiology 41: 145–154.
40. Qin X, Singh KV, Weinstock GM, Murray BE (2000) Effects of Enterococcus
faecalis fsr genes on production of gelatinase and a serine protease and virulence.
Infection and Immunity 68: 2579–2586.
41. Qin X, Singh KV, Weinstock GM, Murray BE (2001) Characterization of fsr, a
regulator controlling expression of gelatinase and serine protease in Enterococcus
faecalis OG1RF. Journal of Bacteriology 183: 3372–3382.
42. Hancock LE, Perego M (2004) The Enterococcus faecalis fsr two-component system
controls biofilm development through production of gelatinase. Journal of
Bacteriology 186: 5629–5639.
43. Nakayama J, Chen S, Oyama N, Nishiguchi K, Azab EA, et al. (2006) Revised
model for Enterococcus faecalis fsr quorum-sensing system: the small open reading
frame fsrD encodes the gelatinase biosynthesis-activating pheromone propeptide
corresponding to staphylococcal agrD. Journal of Bacteriology 188: 8321–8326.
44. Coque TM, Patterson JE, Steckelberg JM, Murray BE (1995) Incidence of
hemolysin, gelatinase, and aggregation substance among enterococci isolated
from patients with endocarditis and other infections and from feces of
hospitalized and community-based persons. Journal of Infectious Diseases 171:
1223–1229.
45. Bourgogne A, Thomson LC, Murray BE (2010) Bicarbonate enhances
expression of the endocarditis and biofilm associated pilus locus, ebpR-ebpABC,
in Enterococcus faecalis. BMC Microbiology 10: 17.
46. Yang J, Hart E, Tauschek M, Price GD, Hartland EL, et al. (2008) Bicarbonate-
mediated transcriptional activation of divergent operons by the virulence
regulatory protein, RegA, from Citrobacter rodentium. Molecular Microbiology 68:
314–327.
47. Abuaita BH, Withey JH (2009) Bicarbonate induces Vibrio cholerae virulence gene
expression by enhancing ToxT activity. Infection and Immunity 77: 4111–4120.
48. Cunin R, Glansdorff N, Pierard A, Stalon V (1986) Biosynthesis and metabolism
of arginine in bacteria. Microbiol Mol Biol Rev 50: 314–352.
49. Barcelona-Andres B, Marina A, Rubio V (2002) Gene structure, organization,
expression, and potential regulatory mechanisms of arginine catabolism in
Enterococcus faecalis. J Bacteriol 184: 6289–6300.
50. Riboulet-Bisson E, Sanguinetti M, Budin-Verneuil A, Auffray Y, Hartke A, et al.
(2008) Characterization of the Ers regulon of Enterococcus faecalis. Infect Immun
76: 3064–3074.
51. Bourgogne A, Hilsenbeck SG, Dunny GM, Murray BE (2006) Comparison of
OG1RF and an isogenic fsrB deletion mutant by transcriptional analysis: The
Fsr system of Enterococcus faecalis is more than the activator of gelatinase and
serine protease. Journal of Bacteriology 188: 2875–2884.
52. Paulsen IT, Banerjei L, Myers GS, Nelson KE, Seshadri R, et al. (2003) Role of
mobile DNA in the evolution of vancomycin-resistant Enterococcus faecalis. Science
299: 2071–2074.
53. Yasmin A, Kenny JG, Shankar J, Darby AC, Hall N, et al. (2010) Comparative
genomics and transduction potential of Enterococcus faecalis temperate bacterio-
phages. J Bacteriol 192: 1122–1130.
54. Bensing BA, Rubens CE, Sullam PM (2001) Genetic loci of Streptococcus mitis that
mediate binding to human platelets. Infect Immun 69: 1373–1380.
The PerA Regulon in Enterococcus faecalis
PLoS ONE | www.plosone.org 10 April 2012 | Volume 7 | Issue 4 | e34398

Page 11

55. Mitchell J, Siboo IR, Takamatsu D, Chambers HF, Sullam PM (2007)
Mechanism of cell surface expression of the Streptococcus mitis platelet binding
proteins PblA and PblB. Mol Microbiol 64: 844–857.
56. Seo HS, Xiong YQ, Mitchell J, Seepersaud R, Bayer AS, et al. (2010)
Bacteriophage lysin mediates the binding of Streptococcus mitis to human platelets
through interaction with fibrinogen. PLoS Pathog 6.
57. Rasmussen M, Johansson D, Sobirk SK, Morgelin M, Shannon O (2010)
Clinical isolates of Enterococcus faecalis aggregate human platelets. Microbes Infect
12: 295–301.
58. Nallapareddy SR, Sillanpaa J, Mitchell J, Singh KV, Chowdhury SA, et al.
(2011) Conservation of Ebp-type pilus genes among enterococci and
demonstration of their role in adherence of Enterococcus faecalis to human
platelets. Infect Immun 79: 2911–2920.
59. Bustamante VcH, MartA˜-nez LC, Santana FJ, Knodler LA, Steele-Mortimer O,
et al. (2008) HilD-mediated transcriptional cross-talk between SPI-1 and SPI-2.
Proceedings of the National Academy of Sciences 105: 14591–14596.
60. Abe H, Miyahara A, Oshima T, Tashiro K, Ogura Y, et al. (2008) Global
regulation by horizontally transferred regulators establishes the pathogenicity of
Escherichia coli. DNA Res 15: 25–38.
61. Mace C, Seyer D, Chemani C, Cosette P, Di-Martino P, et al. (2008)
Identification of biofilm-associated cluster (bac) in Pseudomonas aeruginosa involved
in biofilm formation and virulence. PLoS ONE 3: e3897.
62. Zhu Y, Weiss EC, Otto M, Fey PD, Smeltzer MS, et al. (2007) Staphylococcus
aureus biofilm metabolism and the influence of arginine on polysaccharide
intercellular adhesin synthesis, biofilm formation, and pathogenesis. Infect
Immun 75: 4219–4226.
63. Mohamed JA, Huang DB (2007) Biofilm formation by enterococci. J Med
Microbiol 56: 1581–1588.
64. Costerton JW, Cheng KJ, Geesey GG, Ladd TI, Nickel JC, et al. (1987)
Bacterial biofilms in nature and disease. Annual Review of Microbiology 41:
435–464.
65. Baldassarri L, Bertuccini L, Creti R, Filippini P, Ammendolia MG, et al. (2005)
Glycosaminoglycans mediate invasion and survival of Enterococcus faecalis into
macrophages. J Infect Dis 191: 1253–1262.
66. Gao P, Pinkston KL, Nallapareddy SR, van Hoof A, Murray BE, et al. (2010)
Enterococcus faecalis rnjB is required for pilin gene expression and biofilm
formation. J Bacteriol 192: 5489–5498.
67. Even S, Pellegrini O, Zig L, Labas V, Vinh J, et al. (2005) Ribonucleases J1 and
J2: two novel endoribonucleases in B.subtilis with functional homology to E.coli
RNase E. Nucleic Acids Research 33: 2141–2152.
68. Mathy N, Benard L, Pellegrini O, Daou R, Wen T, et al. (2007) 59-to-39
exoribonuclease activity in bacteria: role of RNase J1 in rRNA maturation and
59 stability of mRNA. Cell 129: 681–692.
69. Condon C (2010) What is the role of RNase J in mRNA turnover? RNA Biology
7: 316–321.
70. Sullam PM, Bayer AS, Foss WM, Cheung AL (1996) Diminished platelet
binding in vitro by Staphylococcus aureus is associated with reduced virulence in a
rabbit model of infective endocarditis. Infection and Immunity 64: 4915–4921.
71. Fitzgerald JR, Foster TJ, Cox D (2006) The interaction of bacterial pathogens
with platelets. Nat Rev Micro 4: 445–457.
72. Durack DT (1975) Experimental bacterial endocarditis. IV. Structure and
evolution of very early lesions. The Journal of Pathology 115: 81–89.
73. Hills GM (1940) Ammonia production by pathogenic bacteria. Biochem J 34:
1057–1069.
74. Slade HD, Slamp WC (1952) The formation of arginine dihydrolase by
streptococci and some properties of the enzyme system. J Bacteriol 64: 455–466.
75. Chaussee MS, Somerville GA, Reitzer L, Musser JM (2003) Rgg coordinates
virulence factor synthesis and metabolism in Streptococcus pyogenes. J Bacteriol 185:
6016–6024.
76. Allen A, Flemstrom G (2005) Gastroduodenal mucus bicarbonate barrier:
protection against acid and pepsin. American Journal of Physiology - Cell
Physiology 288: C1–C19.
77. Kaunitz JD, Akiba Y (2006) Review article: duodenal bicarbonate - mucosal
protection, luminal chemosensing and acid-base balance. Alimentary pharma-
cology & therapeutics 24 Suppl 4: 169–176.
78. Abe H, Tatsuno I, Tobe T, Okutani A, Sasakawa C (2002) Bicarbonate ion
stimulates the expression of locus of enterocyte effacement-encoded genes in
enterohemorrhagic Escherichia coli O157:H7. Infection and Immunity 70:
3500–3509.
79. Hidalgo E, Leautaud V, Demple B (1998) The redox-regulated SoxR protein
acts from a single DNA site as a repressor and an allosteric activator. EMBO J
17: 2629–2636.
80. Griffith KL, Wolf Jr. RE (2002) A comprehensive alanine scanning mutagenesis
of the Escherichia coli transcriptional activator SoxS: Identifying amino acids
important for DNA binding and transcription activation. Journal of Molecular
Biology 322: 237–257.
81. Coburn PS, Baghdayan AS, Craig N, Burroughs A, Tendolkar P, et al. (2010) A
novel conjugative plasmid from Enterococcus faecalis E99 enhances resistance to
ultraviolet radiation. Plasmid 64: 18–25.
82. Traxler M, Summers SM, Nguyen HT, Zacharia VM, Hightower GA, et al.
(2008) The global, ppGpp-mediated stringent response to amino acid starvation
in Escherichia coli. Molecular Microbiology 68: 1128–1148.
83. Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, et al. (2003)
Exploration, normalization, and summaries of high density oligonucleotide array
probe level data. Biostat 4: 249–264.
84. Wren J, Conway T (2006) Meta-analysis of published transcriptional and
translational fold changes reveals a preference for low-fold inductions. OMICS
10: 13.
85. Shepard BD, Gilmore MS (2002) Differential expression of virulence-related
genes in Enterococcus faecalis in response to biological cues in serum and urine.
Infection and immunity 70: 4344–4352.
The PerA Regulon in Enterococcus faecalis
PLoS ONE | www.plosone.org 11 April 2012 | Volume 7 | Issue 4 | e34398