A Highly Efficient Escherichia coli-Based Chromosome Engineering System Adapted for Recombinogenic Targeting and Subcloning of BAC DNA

Mouse Cancer Genetics Program, National Cancer Institute–Frederick, Frederick, Maryland, 21702
Genomics (Impact Factor: 2.28). 05/2001; 73(1):56-65. DOI: 10.1006/geno.2000.6451
Source: PubMed


Recently, a highly efficient recombination system for chromosome engineering in Escherichia coli was described that uses a defective λ prophage to supply functions that protect and recombine a linear DNA targeting cassette with its substrate sequence (Yu et al., 2000, Proc. Natl. Acad. Sci. USA 97, 5978–5983). Importantly, the recombination is proficient with DNA homologies as short as 30–50 bp, making it possible to use PCR-amplified fragments as the targeting cassette. Here, we adapt this prophage system for use in bacterial artificial chromosome (BAC) engineering by transferring it to DH10B cells, a BAC host strain. In addition, arabinose inducible cre and flpe genes are introduced into these cells to facilitate BAC modification using loxP and FRT sites. Next, we demonstrate the utility of this recombination system by using it to target cre to the 3′ end of the mouse neuron-specific enolase (Eno2) gene carried on a 250-kb BAC, which made it possible to generate BAC transgenic mice that specifically express Cre in all mature neurons. In addition, we show that fragments as large as 80 kb can be subcloned from BACs by gap repair using this recombination system, obviating the need for restriction enzymes or DNA ligases. Finally, we show that BACs can be modified with this recombination system in the absence of drug selection. The ability to modify or subclone large fragments of genomic DNA with precision should facilitate many kinds of genomic experiments that were difficult or impossible to perform previously and aid in studies of gene function in the postgenomic era.

Download full-text


Available from: E-Chiang Lee, Mar 19, 2014
  • Source
    • "and obtained from Invitrogen. All recombineering experiments were performed according to protocols published previously (Lee et al., 2001; Warming et al., 2005; Yu et al., 2003). The eGFP-pSV40-Neo R reporter cassette, amplification protocols and primers were kindly provided by Dr Yvonne Fischer (Fischer et al., 2010). "
    [Show abstract] [Hide abstract]
    ABSTRACT: MicroRNAs (miRNAs) have been implicated in regulating multiple processes during brain development in various species. However, the function of miRNAs in human brain development remains largely unexplored. Here, we provide a comprehensive analysis of miRNA expression of regionalized neural progenitor cells derived from human embryonic stem cells and human foetal brain. We found miR-92b-3p and miR-130b-5p to be specifically associated with neural progenitors and several miRNAs that display both age-specific and region-specific expression patterns. Among these miRNAs, we identified miR-10 to be specifically expressed in the human hindbrain and spinal cord, while being absent from rostral regions. We found that miR-10 regulates a large number of genes enriched for functions including transcription, actin cytoskeleton and ephrin receptor signalling. When overexpressed, miR-10 influences caudalization of human neural progenitor cells. Together, these data confirm a role for miRNAs in establishing different human neural progenitor populations. This dataset also provides a comprehensive resource for future studies investigating the functional role of different miRNAs in human brain development.
    Development 09/2015; 142(18). DOI:10.1242/dev.122747 · 6.46 Impact Factor
  • Source
    • "loxP sequences contained in the pBACe3.6 backbone of RP23-352G18 BAC DNA were replaced via homologous recombination [25] by an ampicillin resistance gene cassette generated via PCR amplification of a PGEM-T-Easy vector template with the primer sets: 5 0 GATAAACTACCGCATTAAAGCTTATCGATGATAAGCTGTCAAACATGAG- AATTGATCCGGATATATGAGTAAACTTGGTCTGAC and 5 0 GTTAACCGGGCTGCATCCGATGCAAGTGTGTCGCTGTCGACGGTGACC- CTATAGTCGAGGCGGTATTTTCTCCTTACGCATC. The modified RP23- 352G18 BAC DNA was then purified and microinjected in its circular state into pronuclei of fertilized embryos of C57Bl/6J mice using standard methods [24]. "

  • Source
    • "Retrieval from the recombined BAC clones by gap repair (Copeland et al., 2001; Lee et al., 2001) into PCR-amplified vector pCR-Blunt (Invitrogen) was mediated by either GalR1 target sequences with adjacent introduced rare SwaI restriction sites, or GalR2 target sequences with adjacent introduced BstZ17I restriction sites. Recombined plasmid DNAs were transformed into STBL3 E. coli (Invitrogen) and the final targeting constructs were excised with either SwaI (GalR1-mCherry- FRTneoFRT; 11.3 kb, with GalR1 homology arms of 4.2 and 3.9 kb) or BstZ17I (GalR2-hrGFP-FRTneoFRT; 8.1 kb, with GalR2 homology arms of 2.3 and 2.7 kb). Targeting construct inserts were electroporated into embryonic stem (ES) cell line E14.1a (strain 129P2/OlaHsd; Downing and Battey, 2004; Hooper et al., 1987) and the SV40-neo cassette selected with 250 μg/ml G418 by Geneta (Dept. of Biochemistry, University of Leicester ). "
    [Show abstract] [Hide abstract]
    ABSTRACT: The neuropeptide galanin has diverse roles in the central and peripheral nervous systems, by activating the G protein-coupled receptors Gal1 and Gal2 and the less studied Gal3 (GalR1-3 gene products). There is a wealth of data on expression of Gal1-3 at the mRNA level, but not at the protein level due to the lack of specificity of currently available antibodies. Here we report the generation of knock-in mice expressing Gal1 or Gal2 receptor fluorescently tagged at the C-terminus with, respectively, mCherry or hrGFP (humanized Renilla green fluorescent protein). In dorsal root ganglia (DRG) neurons expressing the highest levels of Gal1-mCherry, localization to the somatic cell membrane was detected by live-cell fluorescence and immunohistochemistry, and that fluorescence decreased upon addition of galanin. In spinal cord, abundant Gal1-mCherry immunoreactive processes were detected in the superficial layers of the dorsal horn, and highly expressing intrinsic neurons of the lamina III/IV border showed both somatic cell membrane localization and outward transport of receptor from the cell body, detected as puncta within cell processes. In brain, high levels of Gal1-mCherry immunofluorescence were detected within thalamus, hypothalamus and amygdala, with a high density of nerve endings in the external zone of the median eminence, and regions with lesser immunoreactivity included the dorsal raphe nucleus. Gal2-hrGFP mRNA was detected in DRG, but live-cell fluorescence was at the limits of detection, drawing attention to both the much lower mRNA expression than to Gal1 in mice and the previously unrecognized potential for translational control by upstream open reading frames (uORFs). Copyright © 2015. Published by Elsevier Inc.
    Molecular and Cellular Neuroscience 08/2015; 68. DOI:10.1016/j.mcn.2015.08.006 · 3.84 Impact Factor
Show more