Dynamic 5-HT2C receptor editing in a mouse model of obesity.

Abstract

The central serotonergic signalling system has been shown to play an important role in appetite control and the regulation of food intake. Serotonin exerts its anorectic effects mainly through the 5-HT(1B), 5-HT(2C) and 5-HT(6) receptors and these are therefore receiving increasing attention as principal pharmacotherapeutic targets for the treatment of obesity. The 5-HT(2C) receptor has the distinctive ability to be modified by posttranscriptional RNA editing on 5 nucleotide positions (A, B, C, D, E), having an overall decreased receptor function. Recently, it has been shown that feeding behaviour and fat mass are altered when the 5-HT(2C) receptor RNA is fully edited, suggesting a potential role for 5-HT(2C) editing in obesity. The present studies investigate the expression of serotonin receptors involved in central regulation of food intake, appetite and energy expenditure, with particular focus on the level of 5-HT(2C) receptor editing. Using a leptin-deficient mouse model of obesity (ob/ob), we show increased hypothalamic 5-HT(1A) receptor expression as well as increased hippocampal 5-HT(1A), 5-HT(1B), and 5-HT(6) receptor mRNA expression in obese mice compared to lean control mice. An increase in full-length 5-HT(2C) expression, depending on time of day, as well as differences in 5-HT(2C) receptor editing were found, independent of changes in total 5-HT(2C) receptor mRNA expression. This suggests that a dynamic regulation exists of the appetite-suppressing effects of the 5-HT(2C) receptor in both the hypothalamus and the hippocampus in the ob/ob mice model of obesity. The differential 5-HT(1A), 5-HT(1B) and 5-HT(6) receptor expression and altered 5-HT(2C) receptor editing profile reported here is poised to have important consequences for the development of novel anti-obesity therapies.

Full text

Page 1

Dynamic 5-HT2CReceptor Editing in a Mouse Model of
Obesity
Harrie ¨t Schellekens1,5, Gerard Clarke2,3, Ian B. Jeffery6, Timothy G. Dinan1,2,3, John F. Cryan1,2,4*
1Food for Health Ireland, University College Cork, Cork, Ireland, 2Laboratory of Neurogastroenterology, Alimentary Pharmabiotic Centre, University College Cork, Cork,
Ireland, 3Department of Psychiatry, University College Cork, Cork, Ireland, 4Department of Anatomy and Neuroscience, University College Cork, Cork, Ireland, 5School of
Pharmacy, University College Cork, Cork, Ireland, 6Department of Microbiology, University College Cork, Cork, Ireland
Abstract
The central serotonergic signalling system has been shown to play an important role in appetite control and the regulation
of food intake. Serotonin exerts its anorectic effects mainly through the 5-HT1B, 5-HT2Cand 5-HT6receptors and these are
therefore receiving increasing attention as principal pharmacotherapeutic targets for the treatment of obesity. The 5-HT2C
receptor has the distinctive ability to be modified by posttranscriptional RNA editing on 5 nucleotide positions (A, B, C, D, E),
having an overall decreased receptor function. Recently, it has been shown that feeding behaviour and fat mass are altered
when the 5-HT2Creceptor RNA is fully edited, suggesting a potential role for 5-HT2Cediting in obesity. The present studies
investigate the expression of serotonin receptors involved in central regulation of food intake, appetite and energy
expenditure, with particular focus on the level of 5-HT2Creceptor editing. Using a leptin-deficient mouse model of obesity
(ob/ob), we show increased hypothalamic 5-HT1Areceptor expression as well as increased hippocampal 5-HT1A, 5-HT1B, and
5-HT6receptor mRNA expression in obese mice compared to lean control mice. An increase in full-length 5-HT2Cexpression,
depending on time of day, as well as differences in 5-HT2Creceptor editing were found, independent of changes in total 5-
HT2Creceptor mRNA expression. This suggests that a dynamic regulation exists of the appetite-suppressing effects of the 5-
HT2Creceptor in both the hypothalamus and the hippocampus in the ob/ob mice model of obesity. The differential 5-HT1A,
5-HT1Band 5-HT6receptor expression and altered 5-HT2Creceptor editing profile reported here is poised to have important
consequences for the development of novel anti-obesity therapies.
Citation: Schellekens H, Clarke G, Jeffery IB, Dinan TG, Cryan JF (2012) Dynamic 5-HT2CReceptor Editing in a Mouse Model of Obesity. PLoS ONE 7(3): e32266.
doi:10.1371/journal.pone.0032266
Editor: Alessandro Bartolomucci, University of Minnesota, United States of America
Received September 26, 2011; Accepted January 25, 2012; Published March 20, 2012
Copyright: ? 2012 Schellekens et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The work described herein was supported by Enterprise Ireland under Grant Number CC20080001. JFC and TGD are also supported in part by Science
Foundation Ireland (SFI) in the form of a centre grant (Alimentary Pharmabiotic Centre) through the Irish Government’s National Development Plan. The authors
and their work were supported by SFI (grant no.s 02/CE/B124 and 07/CE/B1368). JFC is funded by European Community’s Seventh Framework Programme; Grant
Number: FP7/2007–2013, Grant Agreement 201714. GC is in receipt of research funding from the American Neurogastroenterology and Motility Society. The
funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: j.cryan@ucc.ie
Introduction
Obesity is rapidly increasing in prevalence in developed
countries [1,2]. Thus, there is increasing medical and societal
needs for novel treatments, which induce appetite suppression and
weight loss. Satiety and appetite control pathways have been
studied extensively both in animals and humans but the exact
underlying molecular mechanisms remain unclear [3,4,5,6]. It is
well established that increased serotonin (5-hydroxytryptamine, 5-
HT) neurotransmission in the brain regulates food intake [7,8,9].
In particular, 5-HT1B, 5-HT2Cand 5-HT6receptors have received
attention as promising anti-obesity therapeutic targets [10,11,12,
13,14,15]. Centrally acting serotonergic agents, including sibu-
tramine, m-chlorophenylpiperazine (mCPP) and fenfluramine, act
as potent appetite suppressants [16,17,18]. However, these
compounds are pharmacologically promiscuous, showing activity
across multiple 5-HT and non-5-HT pathways and receptors, and
accordingly exert many unwanted side effects. A better under-
standing of the mechanisms by which serotonergic receptors
regulate appetite and energy homeostasis may lead to the
development of novel effective anti-obesity drugs.
Within the serotonergic system, the 5-HT2Creceptor requires
special attention due to its distinctive ability to be modified by post-
transcriptional RNA editing [19]. The 5-HT2Creceptor pre-RNA
can be enzymatically edited on 5 specific nucleotide positions (A, B,
C, D, E) converting an adenosine to inosine residues, causing amino
acid sequence changes. Selective editing can generate up to 32
different mRNA isoforms translating into 24 predicted protein
sequences, all with unique signalling features (Figure 1). Even
though not all 5-HT2Cisoforms have been tested to date, it is
accepted that increased RNA editing reduces receptor constitutive
activity and decreases agonist potency and G-protein coupling,
resulting in an overall decreased receptor function [19,20,21,22,
23,24,25]. In addition, distribution of edited 5-HT2Cisoforms has
been shown to be different across brain regions [26]. Therefore,
differential editing of the 5-HT2Creceptors in the CNS may have
important consequences forthe functional properties ofthereceptor
in vivo. Recently, it has been shown that feeding behaviour and fat
mass are altered when studying mice engineered to express a fully
edited 5-HT2Creceptor isoform in the brain, suggesting a potential
role for 5-HT2Creceptor editing in obesity [24,27,28]. In addition,
5-HT2CRNA editing status has been implicated in psychiatric and
PLoS ONE | www.plosone.org1March 2012 | Volume 7 | Issue 3 | e32266

Page 2

stress-related disorders and has been shown to be a dynamic
process, demonstrating changes in response to either stress or
pharmacotherapeutic drug across in vitro and in vivo studies
[26,29,30,31,32,33,34,35]. The 5-HT2C receptor RNA editing
profile within obesity phenotypes and its impact on feeding has so
far, to our knowledge not been investigated. The ob/ob mouse, a
leptin protein deficient strain, is one of the most widely used mouse
model of obesity and is characterised by several metabolic and
neuroendocrine abnormalities, including a prominent hyperphagia
leading to obesity [36,37,38,39]. This study aims to analyse central
mRNA expression levels of 5-HT receptors related to feeding (5-
HT1A, 5-HT1B, 5-HT6, 5-HT2C) withinthismouse modelof obesity
(ob/ob) and in particular to analyse if there is an altered 5-HT2C
receptor editing profile within the obesity phenotype, by analysing
the expression of partially as well as fully edited 5-HT2Creceptor
isoforms.
Materials and Methods
Animals
Animals, male ob/ob mice (n=8–10 per cohort) and lean
littermate controls (n=8–10 per cohort), generated on a C57BL/6
background, were purchased from Harlan, UK. The sample size is
based on a power calculation aimed at detecting differences at the
0.05 level. Mice were received at the facility when they were 5 to 6
weeks old. Groups of four mice were housed in standard holding
cages in a light-controlled (12-hour light/dark cycle; lights on at 7.45
am), temperature-controlled (21uC61) and humidity-controlled
(55610%) environment. Water was available ad libitum throughout
the study and 10 g pre-weighed standard lab chow (2018S Teklad
Global 18% Protein Rodent Diet) was given per mouse each day.
Mice were weighed each day between 9am and 10am and the
amountofdailyfoodintakewascalculated.Animalsweresacrificedat
ages between 8 and 9 weeks using cervical dislocation. Brain tissue
was dissected at 4uC, processed in RNA Later (Ambion, Warrington,
UK) and stored at 280uC until the analysis. The hypothalamus and
hippocampus were the two regions where most of the analysis is
carried out. The brains were removed from the skull and placed with
ventral side up on an ice-cooled Petri dish. For dissection, the
coordinates of the brain regions were selected according to the ‘‘The
Mouse Brain in Stereotaxic Coordinates, 3rd Edition’’ [40]. Using a
curved forceps, the hypothalamus was pinched out from the ventral
surface of the brain by pushing the curved part of the forceps down
around the hypothalamus starting directly behind the optic chiasm.
With the dorsal side up, a sagittal cut was made down the midline of
the brain, leaving the cerebellum and brainstem intact. The
hippocampai were separated from the white matter beneath the
neocortex with a curved forceps and pinched out from each side of
the brain. All daytime samples were harvested in the morning,
directly following the dark phase. In addition, hypothalamus brain
tissue was also harvested from a different cohort of animals in the
evening, before onset of the dark phase, designated as nighttime
samples. All experiments were conducted in full accordance with the
European Community Council Directive 86/609/EEC, the Recom-
mendation 2007/526/65/EC and approved by the Animal
Experimentation Ethics Committee of University College Cork
(Animalethicalpermitnumber#2010/028).Alleffortsweremadeto
minimiseanimal suffering and to reduce the number of animalsused.
All experiments in this manuscript are performed on the same cohort
of animals, with the exception of the neurotransmitter concentration
determination.
Neurotransmitter concentrations
Neurotransmitter concentrations were determined in ob/ob mice
and control littermates, using a modification of a previously
described procedure [41]. Briefly, brain tissue was sonicated in
500 ml of chilled mobile phase spiked with 4 ng/40 ul of N-Methyl
5-HT (Sigma Chemical Co., UK) as internal standard. The mobile
phase contained 0.1 M citric acid, 5.6 mM octane-1-sulphonic acid
(Sigma), 0.1 M sodium dihydrogen phosphate, 0.01 mM EDTA
(Alkem/Reagecon, Cork) and 9% (v/v) methanol (Alkem/Reage-
con), and was adjusted to pH 2.8 using 4N sodium hydroxide
(Alkem/Reagecon). Homogenates were then centrifuged for
15 minutes at 14,000 rpm at 4uC and 40 ml of the supernatant
injected onto the HPLC system which consisted of a SCL 10-Avp
systemcontroller, LECD 6A electrochemical detector (Shimadzu), a
LC-10AS pump, a CTO-10A oven, a SIL-10A autoinjector (with
sample cooler maintained at 40C) and an online Gastorr Degasser
(ISS, UK).A reverse-phase
10064.6 mm, Phenomenex) maintained at 30uC was employed in
the separation (Flow rate 0.9 ml/min). The glassy carbon working
electrode combined with an Ag/AgCL reference electrode
column (Kinetex2.6 u C18
Figure 1. Serotonin 2C receptor gene structure. A) The human full-length 5-HT2Cgene, located on the X chromosome and processed from
mRNA encoded from exon 3 to exon 6 after splicing out intronic sequence is depicted (not including 39- or 59- untranslated regions and not
according to scale). B) The 5-HT2Cgene is translated into a seven-transmembrane G-protein coupled receptor. The editing cassette is located in the
second intracellular loop. C) The nucleotide sequence of the 5-HT2Cediting cassette is depicted including the five nucleotide positions prone to
adenosine to inosine editing.
doi:10.1371/journal.pone.0032266.g001
5-HT2CReceptor Editing and Obesity
PLoS ONE | www.plosone.org2 March 2012 | Volume 7 | Issue 3 | e32266

Page 3

(Shimdazu) was operated a +0.8V and the chromatograms
generated were analysed using Class-VP 5 software (Shimadzu).
The neurotransmitters were identified by their characteristic
retention times as determined by standard injections, which were
run at regular intervals during the sample analysis. The ratios of
peak heights of analyte versus internal standard were measured and
compared with standard injection. Results were expressed as ng of
neurotransmitter per g fresh weight of tissue.
Sample preparation
Total RNA was isolated using the Absolutely RNAH Miniprep
kit (Stratagene, La Jolla, USA) according to manufacturer’s
instructions. Briefly, brain tissues were homogenized using a
Polytron PT2100 in RNA lysis buffer and nucleic acids were
extracted using a buffer and spin column protocol. The nucleic
acids were subsequently washed and separated using an elution
column. DNase treatment was carried out using the Ambion
Turbo DNase kit (Ambion, Warrington, UK) according to
manufacturer’s instructions. RNA was quantified using Nano-
DropTMspectrophotometer (Mason Technology, Cork, Ireland)
according to the manufacturer’s instructions. RNA quality and
RNA integrity number (RIN) were determined using the
AgilentTMBioanalyzer (Agilent, Stockport, UK). RNA samples
that satisfied criteria (RIN value .7) were reverse transcribed to
cDNA using the High Capacity cDNA kit (Applied Biosystem,
Warrington, UK) according to manufacturer’s protocol. Briefly,
Multiscribe Reverse Transcriptase (50 U/mL) was added as part of
the RT master mix, incubated at 25uC for 10 minutes, at 37uC for
2 hours, at 85uC for 5 minutes and stored at 4uC.
Real-time quantitative RT-PCR
Quantitative PCR (Q-PCR) was carried out using 6 carboxy
fluorescein (FAMTM) dye-labeled TaqManH MGB probes supplied
by Applied BiosystemsTMto mouse specific 5-HT1A, 5-HT1B, total
5-HT2C, full-length 5-HT2C, 5-HT6, ADAR1 and ADAR2 while
using b-Actin as an endogenous control (Mm00434106_s;
Mm00439377_s1; Mm00434127_m1; Mm00664865_m1; Mm004
45320_m1; Mm00493794_m1;
8001_m1; Mm00504621_m1; Mm00607939_s1). Custom made
probes to detect differentially edited 5-HT2Cisoforms (Table 1),
werealsosupplied by Applied Biosystems and designed accordingto
a recently described method [42]: 5-HT2C-INI(non edited form),
probe=[Fam]tagcaatacgtaatcctattg [MGB/NFQ]; 5-HT2C-VNV
(ABD edited form), probe=[Fam]tagcagtgcgtaatcctgttga [MGB/
NFQ]; 5-HT2C-VSV (ABCD edited form), probe=[Fam]tag-
cagtgcgtagtcctgttg [MGB/NFQ]; 5-HT2C-VGV (ABECD edited
form), probe=[Fam]tagcagtgcgtggtcctgttg [MGB/NFQ] and 5-
HT2C-VNI(AB edited form), probe=[Fam]tagcagtgcgtaatcctattg
[MGB/NFQ]. Reaction mix was prepared using TaqManH
Universal PCR Master Mix (Applied Biosystems, Warrington,
UK). Q-PCR was carried out on the ABI7300 Real Time PCR
machine (Applied Biosystems, Warrington, UK). Samples were
heated to 95uC for 10 minutes, and then subjected to 50 cycles of
amplification by melting at 95uC and annealing at 60uC for
1 minute. Experimental samples were run in triplicate with 1 mL
cDNA per reaction.No template controls wereincludedin eachrun
in triplicate to check for amplicon contamination. Cycle threshold
(Ct) values were normalised using b-Actin and transformed using
the 22DCt method [43]. Fold change of relative gene expression
level compared to control animals was calculated.
Mm00557717_m1;Mm0050
Sequence analysis
Direct sequencing of 5-HT2C receptor transcripts was per-
formed after amplification of the editing cassette of the 5-HT2C
receptor. The editing cassette was amplified with PCR using the
following primer sets: Editing cassette sense; 59-TGCTGA-
TATGCTGGTGGGACT-39, Editing cassette antisense; 59-
TCGTCCCTCAGTCCAATCACAG-39. PCR products were
run on a 2% agarose gel to reduce background on sequencing
chromatogram. Expected bands (,300 bp) were isolated and
purified using Purelink gel extraction kit (Invitrogen) according to
manufacturer’s instructions. Purified amplicons were eluted in
20 ul elution buffer and sent to Eurofins MWG operon for custom
DNA sequencing using primer Editing sequence antisense; 59-
GATATTGCCCAAACGATGGC-39.
grams were aligned using Clustal W and raw relative peak
amplitude data for each sample was analyzed. Editing frequency
was quantified comparing the height of the adenosine and
guanosine peaks on the sequencing chromatogram. Gross editing
frequency was calculated using the following formula: X=G
height/(A height + G height). The real editing frequency was
calculated following the calibration quotation: A site; Y=1.114*X,
B site; 1.009*X. Pyrosequencing analysis of the 5-HT2Creceptor
RNA editing profiles were performed using next generation 454-
sequencing. Briefly, the 5-HT2Cediting cassette was PCR purified
using similar primers as described above with the addition of an
adaptor, designated adaptor A (59-CGTATCGCCTCCCTC-
GCGCCATCAG-39) in forward primer as well as barcode 1 for
lean control animals (ACGAGTGCGT) and barcode 2 for ob/ob
animals (ACGCTCGACA). In addition, a reverse primer, similar
as above, was used including an adaptor, adaptor B (59
CTATGCGCCTTGCCAGCCCGCTCAG-39). Bands of correct
size (,300 bp) were isolated and purified using Purelink gel
extraction kit (Invitrogen) according to manufacturer’s instruc-
tions. Following gel purification, PCR products were precipitated
with sodium acetate to remove chaotropic salts. PCR products
from ob/ob (n=8) and lean control (n=8) were pooled,
respectively, and PCR product was sent on dry ice to Roche
(Branford CT USA) for 454-sequencing on a Roche 454 GS-FLX
using Titanium chemistry.
Sequencing chromato-
Statistical Analysis
Results for body weight and food intake are expressed as mean
6 SEM. A two-way repeated measures ANOVA was used where
appropriate with planned comparisons. Analysis of mRNA
expression levels is depicted as fold change compared to control.
Gene expression data are presented as the mean values 6 SEM.
Two-tailed unpaired Student’s t-test were used to compare
baseline values in obese and lean animals with a correction for
multiple tests. The statistical significance was indicated as follows:
* indicates p,0.05; ** indicates p,0.01 and *** indicates
p,0.001. For the pyrosequencing dataset, the sequenced cDNA
amplicons were quality filtered using Lucy software with the
defaults for maximum acceptable average probability of error
(0.025) and the maximum probability of error that is allowed for
the 2 bases at each end (0.02). Sequences were aligned with
MUSCLE (version 3.8.31) [44]. Identification of differentially
associated RNA editing sites was carried out by assigning
sequences based on the associated barcode, using the barcode
identifiers. Frequencies of each base at the sites of interest were
analysed using the Fisher’s exact test with Bonferroni correction.
Results
Food intake and body weight
In our experiments, the leptin-deficient ob/ob mice were
hyperphagic, consuming 50% more food compared to their
controls during ad libitum conditions, and displayed significantly
5-HT2CReceptor Editing and Obesity
PLoS ONE | www.plosone.org3March 2012 | Volume 7 | Issue 3 | e32266

Page 4

Table 1. Major mouse hypothalamic 5-HT2CmRNA isoforms analysed using pyrosequencing.
5-HT2CIsoform
DNA Sequence
(AnB-nnn-ECn-nn-Dnn)
Nr sequences
lean
% Relative
occurence
Nr sequences
ob/ob
% Relative
occurence
Total nr
sequences
% Relative
occurence
5HT2C (VNV) ABD edited form
GnG-nnn-AAn-nnn-Gnn
3607
17.20
3429
16.37
7036
33.58
5HT2C (VNV) AD edited form
GnA-nnn-AAn-nnn-Gnn
283
1.40
253
1.21
536
2.56
5HT2C (VNI) AB edited form
GnG-nnn-AAn-nnn-Ann
1871
8.90
2175
10.38
4046
19.31
5HT2C (VNI) A edited form
GnA-nnn-AAn-nnn-Ann
857
4.10
962
4.59
1819
8.68
5HT2C (VSV) ABCD edited form
GnG-nnn-AGn-nnn-Gnn
1278
6.10
1094
5.22
2372
11.32
5HT2C (VSV) ACD edited form
GnA-nnn-AGn-nnn-Gnn
60
0.30
63
0.30
123
0.59
5HT2C (INI) UNEDITED
AnA-nnn-AAn-nnn-Ann
720
3.40
588
2.81
1308
6.24
5HT2C (VGV) ABECD edited form
GnG-nnn-GGn-nnn-Gnn
37
0.20
25
0.12
62
0.30
5HT2C (VGV) AECD edited form
GnA-nnn-GGn-nnn-Gnn
11
0.10
6
0.03
17
0.08
5HT2C (VSI) ABC edited form
GnG-nnn-AGn-nnn-Ann
850
4.10
997
4.76
1847
8.82
5HT2C (VSI) AC edited form
GnA-nnn-AGn-nnn-Ann
119
0.60
114
0.54
233
1.11
5HT2C (MNI) B edited form
AnG-nnn-AAn-nnn-Ann
45
0.20
48
0.23
93
0.44
5HT2C (IDI) E edited form
AnA-nnn-GAn-nnn-Ann
19
0.10
12
0.06
31
0.15
5HT2C (ISI) C edited form
AnA-nnn-AGn-nnn-Ann
67
0.30
61
0.29
128
0.61
5HT2C (INV) D edited form
AnA-nnn-AAn-nnn-Ann
354
1.70
203
0.97
557
2.66
5HT2C (VDV) ABEC edited form
GnG-nnn-GAn-nnn-Gnn
98
0.50
77
0.37
175
0.84
5HT2C (VDV) AED edited form
GnA-nnn-GAn-nnn-Gnn
16
0.10
9
0.04
25
0.12
5HT2C (VDI) ABE edited form
GnG-nnn-GAn-nnn-Ann
84
0.40
70
0.33
154
0.74
5HT2C (VDI) AE edited form
GnA-nnn-GAn-nnn-Ann
26
0.10
24
0.11
50
0.24
5HT2C (ISV) CD edited form
AnA-nnn-AGn-nnn-Gnn
30
0.10
52
0.25
82
0.39
5HT2C (MNV) BD edited form
AnG-nnn-AAn-nnn-Gnn
54
0.30
41
0.20
95
0.45
5HT2C (VGI) ABEC edited form
GnG-nnn-GGn-nnn-Ann
30
0.10
29
0.14
59
0.28
5HT2C (VGI) AEC edited form
GnA-nnn-GGn-nnn-Ann
31
0.10
21
0.10
52
0.25
5HT2C (IGV) ECD edited form
AnA-nnn-GGn-nnn-Gnn
1
0.00
10
0.05
11
0.05
5HT2C (MSI) BC edited form
AnG-nnn-AGn-nnn-Ann
6
0.00
9
0.04
15
0.07
5HT2C (IGI) EC edited form
AnA-nnn-GGn-nnn-Ann
6
0.00
2
0.01
8
0.04
5HT2C (IDV) ED edited form
AnA-nnn-GAn-nnn-Gnn
14
0.10
3
0.01
17
0.08
5HT2C (MDI) BE edited form
AnG-nnn-GAn-nnn-Ann
0
0.00
0
0.00
0
0.00
5HT2C (MGI) BEC edited form
AnG-nnn-GGn-nnn-Ann
0
0.00
0
0.00
0
0.00
5HT2C (MDV) BED edited form
AnG-nnn-GAn-nnn-Gnn
0
0.00
0
0.00
0
0.00
5HT2C (MSV) BCD edited form
AnG-nnn-AGn-nnn-Gnn
0
0.00
0
0.00
0
0.00
5HT2C (MGV) BECD edited form
AnG-nnn-GGn-nnn-Gnn
0
0.00
0
0.00
0
0.00
doi:10.1371/journal.pone.0032266.t001
5-HT2CReceptor Editing and Obesity
PLoS ONE | www.plosone.org4March 2012 | Volume 7 | Issue 3 | e32266

Page 5

higher body weights characteristic of the obesity phenotype
(Figure 2A and B). When analysing body weight, repeated
measures ANOVA showed significant main effect of genotype;
F(1;14)=66.421;p,0.001, as well as a significant interaction of
day and genotype; F(1.938;27.135)=33.589;p,0.001, and a
significantmaineffectofday:
p,0.001. In addition, food intake analysed using repeated
measures ANOVA showed a significant main effect of genotype;
F(1;2)=52.333;p,0.001, as well as a significant interaction of day
and genotype; F(17.904;35.808)=5.993;p,0.001, and a signifi-
cant main effect of day: F(17.904;35.808)=5.081;p,0.001.
F(1.938;27.135)=420.308;
Serotonin turnover
Serotonin levels and serotonin metabolites were analysed in a
different cohort of animals in the hypothalamus and hippocampus
(Figure 3). No changes in 5-HT levels could be detected in ob/ob
mice compared to control (data not shown). However, an overall
decrease in the 5HIAA levels was observed (data not shown)
leading to significant decrease in 5HIAA/5HT ratio in ob/ob mice
in hippocampus (p,0.001) and hypothalamus (P,0.01) compared
to lean control littermates. The hypothalamus is the main
processor and integrator of peripheral metabolic information
controlling food intake and plays a key role in the homeostatic
regulation of appetite and energy metabolism [3,45]. The
hippocampus, a brain structure involved in learning and memory
function, has recently been linked with food intake control [46].
Serotonergic receptor mRNA expression
To determine central serotonergic receptor expression in
relation to the obesity phenotype, hypothalamic receptor mRNA
expression was analysed using quantitative real-time PCR together
with mRNA levels in the hippocampus and amygdala. The
hippocampal 5-HT1A(p,0.001), 5-HT1B(p,0.001) and 5-HT6
(p,0.01) were significantly increased in obese, leptin-deficient
mice compared to their lean counterpart control (Figure 4A, B and
C). On the hypothalamic level, only the 5-HT1Areceptor of 5-HT
receptors analysed demonstrated a significant (p=0.042) increased
expression in obese mice compared to lean control (Figure 4A).
Total 5-HT2C mRNA expression was analysed using a probe
spanning the exon 3 and 4 boundary of translated mRNA,
detecting the full-length 5-HT2Creceptor expression as well as
expression of all splice variants. No differential expression of total
5-HT2Creceptor mRNA expression was observed between ob/ob
and control groups in all regions assessed (Figure 4D). However,
when analysing 5-HT2Creceptor mRNA expression levels using a
probe spanning the exon 5 and 6 boundary which solely detects
full-length 5-HT2C receptor mRNA, a significant (p=0.004)
increase in expression of full-length 5-HT2CmRNA was observed
in the hypothalamus of obese mice relative to the lean mice
(Figure 5A). No difference in full-length 5-HT2C mRNA
expression was observed in the hippocampus or amygdale (data
not shown).
Hippocampal 5-HT2Creceptor editing
Editing of the 5-HT2Creceptor relative to total 5-HT2CmRNA
levels in the hippocampus was analysed by a recently described
real-time PCR method using a 5-HT2Cprobes specific for several
edited 5-HT2Cisoforms, all expressed in mouse brain [26,42].
Specific significantly increased expression of the 5-HT2C-VNV
isoform (ABD edited), indicative of increased editing, was observed
in the hippocampus (p=0.005) of ob/ob mice compared to lean
control (Figure 6B). A numerical decrease in mRNA levels of the
unedited 5-HT2C-INI isoform was noted in ob/ob mice compared
Figure 2. Body weight and food intake in mouse model of obesity. A) Repeated measures ANOVA showed significant increase in body
weight in ob/ob mice; F(1;14)=66.421;p,0.001. B) Food intake was significantly higher in ob/ob mice compared to lean control as analysed using
repeated measures ANOVA; F(1;2)=52.333;p,0.001; n=8 per genotype.
doi:10.1371/journal.pone.0032266.g002
Figure 3. Monoamine analysis in brain regions. Decreased
serotonin turnover is observed in hippocampus and hypothalamus of
ob/ob mice compared to control. Unpaired, two-tailed T-test; statistical
significance is notated as *** p,0.001, ** p,0.01 compared to lean
control; n=8 for hypothalamus, n=10 for hippocampus.
doi:10.1371/journal.pone.0032266.g003
5-HT2CReceptor Editing and Obesity
PLoS ONE | www.plosone.org5March 2012 | Volume 7 | Issue 3 | e32266

Page 6

to control, but this effect was not statistically significant (Figure 6A).
No difference was observed when analysing mRNA expression
with the 5-HT2C-VSV (ABCD edited) or the 5-HT2C-VGV
(ABECD edited) probe (Figure 6C and 6D). No differential editing
of 5-HT2Creceptor in amygdala was found (data not shown). In
addition, the 5-HT2Creceptor editing frequency was analysed
using a direct sequencing method, pinpointing the change in 5-
HT2Cediting to position A and B of the editing cassette (Figure 7),
which corresponds to the isoform detected with the 5-HT2C-VNV
(ABD edited) probe.
Hypothalamic 5-HT2Creceptor editing
In the hypothalamus, using quantitative real-time PCR, a
significant increase in 5-HT2C mRNA editing in ob/ob mice
compared to control was shown for all edited 5-HT2Cisoforms
tested (Figure 8). However, no difference in editing could be
observed for the 5-HT2Creceptor using direct sequencing (data
not shown). This apparent contradiction between sequencing
results and quantitative real-time PCR outcome may be explained
by the observed increased mRNA levels of full-length 5-HT2C
(Figure 5A). Full-length 5-HT2Ccan be edited and therefore an
increase of all major 5-HT2Cisoforms, including the low abundant
isoforms, may merely reflect an increase of full-length 5-HT2C
receptor. This concept is reinforced by the observed lack of an
increase in full-length 5-HT2C mRNA levels observed in the
evening (Figure 5B) coupled with unchanged mRNA levels of 5-
HT2Cisoforms (data not shown). To more precisely pinpoint if
hypothalamic 5-HT2Creceptor editing is affected in obese versus
lean mice, samples were analysed using pyrosequencing, which is a
more sensitive and quantitative method of sequencing. In
pyrosequencing, approximately equal amounts of cDNA ampli-
cons from ob/ob mice (14763) compared to lean control (14958)
were sequenced, with a combined total of 29721 reads. After
sequence validation and filtering, a total of 20951 sequences,
comprising both lean control and ob/ob 5-HT2Cediting cassette
sequences were passed and aligned accordingly. Pyrosequencing
demonstrated the 5-HT2C–VNV (ABD/AD edited), 5-HT2C–VNI
(AB/A edited) and the 5-HT2C–VSV (ABCD/ACD edited)
isoforms to be indeed the major isoforms, in decreasing order of
occurrence (Table 1). The fully edited isoform, 5-HT2C-VGV
(ABECD/AECD edited) was one of the least abundantly expressed
isoforms. Specific 5-HT2CRNA residues in the pooled ob/ob group
Figure 4. Central serotonin (5-HT) receptor mRNA expression. A) 5-HT1A mRNA is increased in ob/ob mice in hippocampus and
hypothalamus. B) 5-HT1BmRNA is increased in ob/ob mice in hippocampus. C) 5-HT6mRNA is increased in ob/ob mice in hippocampus. D) No change
in mRNA levels of total 5-HT2CmRNA measured using qRT-PCR relative to b-actin expression. Fold changes depicted compared to hippocampus in
control group. Unpaired, two-tailed T-test; statistical significance is notated as *** p,0.001, ** p,0.01, * p,0.05 compared to lean control; n=7–8
per genotype.
doi:10.1371/journal.pone.0032266.g004
5-HT2CReceptor Editing and Obesity
PLoS ONE | www.plosone.org6 March 2012 | Volume 7 | Issue 3 | e32266

Page 7

Figure 5. Daytime and nighttime full-length 5-HT2Creceptor mRNA expression in the hypothalamus. A) Significantly increased
expression of the full-length 5-HT2Creceptor in hypothalamus of ob/ob mice was observed in daytime. B) No change in expression of the full-length
5-HT2Creceptor was observed in animals culled in nighttime. mRNA measured using qRT-PCR relative to b-actin expression. Unpaired, two-tailed T-
test; statistical significance is notated as ** p,0.01, compared to lean control; n=7–10 per genotype.
doi:10.1371/journal.pone.0032266.g005
Figure 6. 5-HT2Creceptor editing in the hippocampus. Expression of 5-HT2Creceptor isoforms in order of fully unedited isoform to fully edited
5-HT2Creceptor isoform. A) Decreased expression of the unedited 5-HT2C-INI isoform in hippocampus of ob/ob mice, but not statistically significant. B)
Significantly increased expression of the edited 5-HT2C-VNV (ABD edited) isoform in hippocampus of ob/ob mice. C) No change in mRNA levels of 5-
HT2C-VSV (ABCD edited) isoform. D) No change in mRNA levels of the 5-HT2C-VGV (ABECD edited) isoform. All mRNA measured using qRT-PCR relative
to b-actin expression and depicted as fold change compared to lean control littermates. Unpaired, two-tailed T-test; statistical significance is notated
as ** p,0.01, compared to lean control; n=7–8 per genotype.
doi:10.1371/journal.pone.0032266.g006
5-HT2CReceptor Editing and Obesity
PLoS ONE | www.plosone.org7March 2012 | Volume 7 | Issue 3 | e32266

Page 8

were compared to the pooled lean control group and pinpointed
an increase in editing on position A (p=2.07*1028) and a decrease
in editing on position D (p=4.47*10211) in ob/ob mice compared
to control (Table 2). This small but significant change of editing
corresponds to an increase of the 5-HT2C-VNI isoform in ob/ob
mice compared to lean counterpart (Table 1). The 5-HT2C
Figure 8. 5-HT2Creceptor editing in the hypothalamus. Expression of 5-HT2Creceptor isoforms in order of fully unedited isoform to fully
edited 5-HT2Creceptor isoform. A) No change in expression of the unedited 5-HT2C-INI isoform. B) Significantly increased expression of the edited 5-
HT2C-VNI (AB edited) isoform in hypothalamus of ob/ob mice. C) Significantly increased expression of the edited 5-HT2C-VNV (ABD edited) isoform in
hypothalamus of ob/ob mice. D) Significant increase in expression of mRNA levels of 5-HT2C-VSV (ABCD edited) in ob/ob mice compared to control. E)
Significant increase in expression of mRNA levels of 5-HT2C-VGV (ABECD edited) isoform. All mRNA measured using qRT-PCR relative to b-actin
expression and depicted as fold change compared to lean control littermates. Unpaired, two-tailed T-test; statistical significance is notated as **
p,0.01, * p,0.05 compared to lean control; n=7–8 per genotype.
doi:10.1371/journal.pone.0032266.g008
Figure 7. 5-HT2Creceptor editing in the hippocampus. Editing of hippocampal the 5-HT2Creceptor was pinpointed to nucleotide position A
and B using direct sequencing. A) Column scatter plot of editing frequencies on site A and B of the editing cassette. B) A typical reverse complement
chromatogram trace of an ob/ob mouse is depicted. Specific editing positions A to E are indicated by arrows. C) A typical control chromatogram is
depicted. Unpaired, two-tailed T-test; statistical significance is notated as * p,0.05, compared to lean control; n=5 per genotype.
doi:10.1371/journal.pone.0032266.g007
5-HT2CReceptor Editing and Obesity
PLoS ONE | www.plosone.org8 March 2012 | Volume 7 | Issue 3 | e32266

Page 9

receptors are widely expressed in the hypothalamus, well beyond
the pro-opiomelanocortin (POMC) expressing neurons of the
arcuate nucleus regulating feeding behaviour, and this small
increase in 5-HT2C–VNI isoform may well be diluted by other 5-
HT2Creceptor expressing nuclei in the hypothalamus.
Hypothalamic adenosine deaminase mRNA levels and
effect of time
In samples harvested during the daytime, no significant
alterations in adenosine deaminase acting on RNA (ADAR1 and
ADAR2), the enzymes responsible for editing, were observed in
either hippocampus or hypothalamus (Figure 9 A to D). However,
a decrease of ADAR1 mRNA expression was observed in
hippocampal tissue of ob/ob mice compared to lean control, but
Figure 9. Adenosine deaminase (ADAR) mRNA expression. No significantly increased expression of the adenosine deaminase, ADAR1 (A) or
ADAR2 (B) in the hippocampus. No significantly increased expression of the hypothalamic adenosine deaminase, ADAR1 (C) or ADAR2 (D) in
hypothalamus during the day. No significantly increased expression of the hypothalamic adenosine deaminase, ADAR1 (E) at nighttime. However,
ADAR2 mRNA levels at nighttime are significantly reduced in hypothalamus of ob/ob mice (F). All mRNA is measured using qRT-PCR relative to b-actin
expression. Unpaired, two-tailed T-test; statistical significance is notated as * p,0.05 compared to lean control; n=7–10 per genotype.
doi:10.1371/journal.pone.0032266.g009
Table 2. Site-specific hypothalamic 5-HT2CmRNA editing in
ob/ob mice compared to control.
Edit site percentage
(%)ABECD
Lean Control (n=8)87.58 75.233.6724.39 55.18
ob/ob (n=8) 90.0176.67 3.0123.750.65
D (%)
q2.43
q1.44
Q0.66
Q0.69
Q4.5
P-value2.07*1028
--- 4.47*10211
doi:10.1371/journal.pone.0032266.t002
5-HT2CReceptor Editing and Obesity
PLoS ONE | www.plosone.org9March 2012 | Volume 7 | Issue 3 | e32266

Page 10

this did not reach statistical significance. Interestingly, a similar
decrease in ADAR2 expression, which did reach significance
(p,0.05), was detected in the hypothalamus of obese mice relative
to lean mice in the evening, before the active phase of food intake
(Figure 9F). Interestingly, a significant increase in ADAR1
(p=0.005) was detected in the amygdala of obese mice relative
to lean mice (data not shown).
Discussion
The importance of the central serotonergic system, including
the 5-HT2C, 5-HT1Band 5-HT6receptors, in the regulation of
feeding behaviour, body weight and energy homeostasis has been
consistently demonstrated in pharmacological and genetic studies
[7,9,12,47]. This study demonstrates significant increases in
hypothalamic 5-HT1Aand 5-HT2Creceptor mRNA expression
as well as in hippocampal 5-HT1A, 5-HT1Band 5-HT6receptor
expression in obese mice (ob/ob) compared to lean control.
Moreover, editing of the 5-HT2Creceptor on specific nucleotide
positions was detected in the hippocampus as well as in
hypothalamic tissue. In conclusion, we suggest that 5-HT2C
receptor mRNA expression changes and 5-HT2Creceptor editing
may play a key role in the observed hyperphagic phenotype in the
leptin-deficient obese mouse model.
Serotonin 2C receptor mRNA expression
Hypothalamic full-length 5-HT2Creceptor mRNA levels were
increased in obese mice relative to lean controls, which reinforce
the key role of the 5-HT2Creceptor in the regulation of food
intake and appetite. Previously, it has been shown that 5-HT2C
receptor mutants are hyperphagic leading to an obese phenotype
and impaired glucose tolerance [48]. In addition, hyperphagia in
A(y) mice with increased expression levels of the agouti peptide has
been associated with increased hypothalamic 5-HT2Cexpression
[49]. The increased hypothalamic full-length 5-HT2C receptor
expression in obese mice was observed only in samples harvested
after the active phase of the animals (daytime samples), while in
samples taken at the onset of the dark phase (nighttime) no altered
full-length 5-HT2C receptor expression was observed. The
nighttime is the active phase of the mouse where baseline food
intake is greater. We therefore hypothesize that the increase in
hypothalamic full-length 5-HT2Cin the ob/ob mice may occur as a
compensatory mechanism during the active phase of food intake in
an attempt to increase the 5-HT2Cmediated satiety signalling and
curb the phenotypical associated hyperphagia.
Serotonin 2C receptor editing
Considering recent data, demonstrating that that feeding
behaviour and fat mass are altered in mice engineered to express
a fully edited 5-HT2Creceptor isoform [24,27,28], we found it
important to investigate whether 5-HT2C receptor editing was
affected in a physiological model of obesity. We therefore set out to
determine the expression of specific edited isoforms of the 5-HT2C
receptor using specific probes detecting the major editing variants of
the 5-HT2Creceptor in the hippocampus and hypothalamus. In
addition, we employed direct sequencing to pinpoint the exact
editing position. Noteworthy, the employment of direct sequencing
to quantify RNA editing has its limitations as the height of peaks
depicting the same nucleotide can differ within a chromatogram,
although we found nucleotide height to be consistent based on
position. Therefore, this technique requires careful interpretation
and should be used in support of other methods, such as the
qRTPCR employed here. This study demonstrated altered 5-HT2C
receptor editing in both the hippocampus and the hypothalamus of
the obese mice model. Increased 5-HT2Cediting in the hippocam-
pus could be pinpointed to position A and B of the 5-HT2Creceptor
editing cassette. A recent study showed that hippocampal leptin
signalling reduced food intake and that ventral hippocampal leptin
signalling contributes to the inhibition of food-related memories
elicited by contextual stimuli [46] indicating a key role for
hippocampal mediated regulation of food intake. The absence of
hippocampal leptin signalling in the leptin deficient ob/ob mice may
suggest abnormal food-related memory processing to be involved in
the hyperphagic phenotype (but see [50]). Our findings suggest that
differential 5-HT2Cisoform expression potentially also plays a key
role in the hippocampal mediated regulation of food intake and
food-related memory processing. This hypothesis is reinforced by
studies demonstrating the involvement of the 5-HT2Creceptor in
memory function and consolidation [51,52,53]. However, the
hippocampus is mainly involved in learning and memory and
involvement of 5-HT2C receptor editing within this domain of
hippocampal function and particularly within psychological disor-
ders, such as schizophrenia and seizure disorders such as epilepsy,
remains to be investigated. Analysis of the editing profile of the 5-
HT2Creceptor in the hypothalamus demonstrated a significant
increaseinediting onpositionA buta significantlydecreased editing
on position D, corresponding to an increased expression of the
partially edited 5-HT2C–VNI isoform. It is tempting to speculate on
the functional consequences of selective 5-HT2Creceptor mRNA
editing in specific regions of the brain. Individual 5-HT2Cisoforms
have shown to demonstrate differential constitutive activity, affinity,
potencyandadifferent ability
[19,20,21,22,23,24,25]. An increased 5-HT2C receptor editing
profile renders the 5-HT2C receptor less functional. Thus, the
increased expression of the VNI edited 5-HT2Creceptor isoform
may point to a reduced cellular function. This supports the premise
of decreased 5-HT2C receptor function in reducing appetite-
suppression in the ob/ob mouse model. However, we cannot
exclude that different hypothalamic nuclei express different 5-HT2C
receptor editing isoforms.
Additionally, expression levels of the adenosine deaminase
enzymes (ADAR1 and ADAR2), the enzymes responsible for
RNA editing, were investigated. It has been shown that expression
levels of both the enzymes ADAR1 and ADAR2 directly affect the
RNA editing level of 5-HT2C[25,26,54,55,56]. ADAR1 selectively
edits the A and B sites of the 5-HT2Creceptor, whereas ADAR2
edits exclusively D site of the 5-HT2Creceptor. No differential
ADAR expression were found in the hippocampus (Figure 8A and
8B) or hypothalamus (Figure 8C and 8D) of the obese mice in the
daytime experiments. This may suggest that the increased 5-HT2C
editing in obese mice is not a consequence of altered ADAR
expression but may potentially be due to other molecular
mechanism, such as 5-HT2C receptor splicing or degradation.
Interestingly, a significant decrease in ADAR2 mRNA levels, in
hypothalamic ob/ob mice relative to the lean control mice, in
samples taken in the evening was observed (Figure 8F). Reduced
ADAR2 expression may lead to a subsequent decrease in editing
on position D of the hypothalamic 5-HT2Cediting cassette, as
observed after pyrosequencing of hypothalamic 5-HT2Creceptor
during the daytime. In conclusion, altered 5-HT2C receptor
editing in combination with changes in ADAR expression in ob/ob
mice suggest a dynamic regulation in the appetite-suppressing
activity of the 5-HT2Creceptor through receptor editing.
to couple toG-proteins
Serotonin 1A, serotonin 1B and serotonin 6 receptor
expression
We also showed significant increased hypothalamic 5-HT1A
mRNA expression levels and increases in 5-HT1A, 5-HT1Band 5-
5-HT2CReceptor Editing and Obesity
PLoS ONE | www.plosone.org10March 2012 | Volume 7 | Issue 3 | e32266

Page 11

HT6receptor expression in the hippocampus of obese mice (ob/
ob). Previously, exposure to 5-HT1Areceptor agonists have shown
to increase food intake, which would be in line with the altered 5-
HT1A receptor expression [57,58,59]. The 5-HT1Aand 5-HT1B
receptors have also been shown to regulate 5-HT release by a
negative feedback mechanism as presynaptic autoreceptors by
exerting direct inhibitory effects [59]. In addition, down-regulation
of neuropeptide release involved in food intake has also been
demonstrated via serotonin-mediated activation of post-synaptic 5-
HT1A receptors in both AgRP/NPY and POMC/CART
containing neurons of the arcuate nucleus [60]. Therefore, the
increased post-synaptic 5-HT1A and 5-HT1B expression in
hypothalamus and hippocampus may lead to a decrease in
terminal serotonin release and may consequently reduce seroto-
nergic activation of anorectic pathways as previously suggested
[14]. Indeed, decreased 5HIAA levels and a decreased 5HIAA/
5HT ratio were observed in obese, leptin deficient mice compared
to lean control littermates, indicating decreased 5HT turnover,
which is supported in a previous a study by Rowland and
colleagues [61]. However, 5-HT1Ahas not been a major focus as a
therapeutic target in obesity research and is implicated stronger in
serotonergic regulation of anxiety and depression [62,63]. A
dysregulated serotonergic tone in the hippocampus in ob/ob mice
might contribute to the anxiogenic phenotype observed in ob/ob
mice compared to lean control mice [50] which warrants further
investigation. The 5-HT6receptor has also been implicated to play
a role in the regulation of satiety and energy homeostasis.
However, an effect on body weight is usually associated with
antagonism of this receptor [64,65,66]. Overall, increased central
5-HT1A, 5-HT1B and 5-HT6 receptor gene expression may
contribute to the obesity phenotype by decreasing serotonergic
tone leading to a decreased sensitivity towards satiety signals in the
leptin-deficient ob/ob mice.
Together, these studies demonstrate aberrant mRNA expression
changes in the 5-HT receptors studied in leptin deficient obese
mice. Most interestingly, our findings suggests a diurnal hypotha-
lamic 5-HT2C receptor expression and increases in 5-HT2C
receptor editing in the ob/ob mouse model of obesity, which may
have important physiological consequences to either the regulation
of feeding behaviour through the modulation of 5-HT2Creceptor
mediated appetite-suppressing effects or compensatory responses
to the absence of leptin. The increase in 5-HT2Creceptor editing
in the ob/ob mouse model would suggest the 5-HT2Creceptor
editing to occur as a consequence of leptin-deficiency or as a
compensatory mechanism to the phenotypical-associated weight
gain or hyperphagia. However, significant reduced leptin levels
have previously been associated with 5-HT2C editing in mice
genetically engineered to only express the 5-HT2C-VGV isoform,
the fully edited variant of the 5-HT2Creceptor [27]. These mice
were also hyperphagic but had reduced fat mass due to increased
energy expenditure. This may suggest, a bidirectional relationship
between leptin and 5-HT2Creceptor editing independent of body
weight but directly correlating to hyperphagia. It would be
interesting to investigate if 5-HT2Creceptor editing would still
occur in absence of weight gain in the ob/ob leptin-deficient mouse
model. In addition, it would be interesting to see if 5-HT2C
receptor editing profiles are dynamically regulated such the
observed diurnal change in full-length 5-HT2Creceptor mRNA
expression in this study and the time-of day dependent ghrelin
receptor mRNA expression observed in our previous studies [67].
In addition, these results warrant further investigation into
corresponding 5-HT2Creceptor protein expression following the
phenotype-associated 5-HT2C receptor editing. Concomitant
changes in 5-HT2C receptor protein expression and receptor
functioning could potentially support the conclusion that 5-HT2C
receptor editing is associated with obesity.
Acknowledgments
We would like to thank Caroline A. Browne, Daniela Felice and Beate
Finger for technical assistance and Dr. Cedric Mombereau for advice on
editing.
Author Contributions
Conceived and designed the experiments: HS JFC TGD. Performed the
experiments: HS GC. Analyzed the data: HS IJ. Contributed reagents/
materials/analysis tools: HS GC IJ. Wrote the paper: HS.
References
1.Bloom SR, Kuhajda FP, Laher I, Pi-Sunyer X, Ronnett GV, et al. (2008) The
obesity epidemic: pharmacological challenges. Mol Interv 8: 82–98.
Schellekens H, Dinan TG, Cryan JF (2009) Lean mean fat reducing ‘‘ghrelin’’
machine: hypothalamic ghrelin and ghrelin receptors as therapeutic targets in
obesity. Neuropharmacology 58: 2–16.
Simpson KA, Martin NM, Bloom SR (2009) Hypothalamic regulation of food intake
and clinical therapeutic applications. Arq Bras Endocrinol Metabol 53: 120–128.
Simpson KA, Martin NM, Bloom SR (2008) Hypothalamic regulation of
appetite. http://wwwexpert-reviewscom/loi/eem 3: 577–592.
Ahima RS, Antwi DA (2008) Brain regulation of appetite and satiety.
Endocrinol Metab Clin North Am 37: 811–823.
Morton GJ, Cummings DE, Baskin DG, Barsh GS, Schwartz MW (2006)
Central nervous system control of food intake and body weight. Nature 443:
289–295.
Tecott LH, Sun LM, Akana SF, Strack AM, Lowenstein DH, et al. (1995)
Eating disorder and epilepsy in mice lacking 5-HT2c serotonin receptors.
Nature 374: 542–546.
Saller CF, Stricker EM (1976) Hyperphagia and increased growth in rats after
intraventricular injection of 5,7-dihydroxytryptamine. Science 192: 385–387.
Tecott LH (2007) Serotonin and the orchestration of energy balance. Cell Metab
6: 352–361.
10. Somerville EM, Horwood JM, Lee MD, Kennett GA, Clifton PG (2007) 5-
HT(2C) receptor activation inhibits appetitive and consummatory components
of feeding and increases brain c-fos immunoreactivity in mice. Eur J Neurosci
25: 3115–3124.
11. Dutton AC, Barnes NM (2006) Anti-obesity pharmacotherapy: Future
perspectives utilising 5-HT2C receptor agonists. Drug Discovery Today:
Therapeutic Strategies 3: 577–583.
2.
3.
4.
5.
6.
7.
8.
9.
12. Garfield AS, Heisler LK (2009) Pharmacological targeting of the serotonergic
system for the treatment of obesity. J Physiol 587: 49–60.
13. Halford JC, Harrold JA, Boyland EJ, Lawton CL, Blundell JE (2007)
Serotonergic drugs: effects on appetite expression and use for the treatment of
obesity. Drugs 67: 27–55.
14. Lam DD, Heisler LK (2007) Serotonin and energy balance: molecular
mechanisms and implications for type 2 diabetes. Expert Rev Mol Med 9: 1–24.
15. Miller KJ (2005) Serotonin 5-ht2c receptor agonists: potential for the treatment
of obesity. Mol Interv 5: 282–291.
16. Dalton GL, Lee MD, Kennett GA, Dourish CT, Clifton PG (2004) mCPP-
induced hyperactivity in 5-HT2C receptor mutant mice is mediated by
activation of multiple 5-HT receptor subtypes. Neuropharmacology 46:
663–671.
17. Dalton GL, Lee MD, Kennett GA, Dourish CT, Clifton PG (2006) Serotonin 1B
and 2C receptor interactions in the modulation of feeding behaviour in the
mouse. Psychopharmacology (Berl) 185: 45–57.
18. Vickers SP, Clifton PG, Dourish CT, Tecott LH (1999) Reduced satiating effect
of d-fenfluramine in serotonin 5-HT(2C) receptor mutant mice. Psychophar-
macology (Berl) 143: 309–314.
19. Burns CM, Chu H, Rueter SM, Hutchinson LK, Canton H, et al. (1997)
Regulation of serotonin-2C receptor G-protein coupling by RNA editing.
Nature 387: 303–308.
20. Berg KA, Clarke WP, Cunningham KA, Spampinato U (2008) Fine-tuning
serotonin2c receptor function in the brain: molecular and functional
implications. Neuropharmacology 55: 969–976.
21. Berg KA, Cropper JD, Niswender CM, Sanders-Bush E, Emeson RB, et al.
(2001) RNA-editing of the 5-HT(2C) receptor alters agonist-receptor-effector
coupling specificity. Br J Pharmacol 134: 386–392.
5-HT2CReceptor Editing and Obesity
PLoS ONE | www.plosone.org11March 2012 | Volume 7 | Issue 3 | e32266

Page 12

22. Herrick-Davis K, Grinde E, Niswender CM (1999) Serotonin 5-HT2C receptor
RNA editing alters receptor basal activity: implications for serotonergic signal
transduction. J Neurochem 73: 1711–1717.
23. Niswender CM, Copeland SC, Herrick-Davis K, Emeson RB, Sanders-Bush E
(1999) RNA editing of the human serotonin 5-hydroxytryptamine 2C receptor
silences constitutive activity. J Biol Chem 274: 9472–9478.
24. Olaghere da Silva UB, Morabito MV, Canal CE, Airey DC, Emeson RB, et al.
(2010) Impact of RNA editing on functions of the serotonin 2C receptor in vivo.
Frontiers in Neuropharmacology.
25. Wang Q, O’Brien PJ, Chen CX, Cho DS, Murray JM, et al. (2000) Altered G
protein-coupling functions of RNA editing isoform and splicing variant
serotonin2C receptors. J Neurochem 74: 1290–1300.
26. Werry TD, Loiacono R, Sexton PM, Christopoulos A (2008) RNA editing of the
serotonin 5HT2C receptor and its effects on cell signalling, pharmacology and
brain function. Pharmacol Ther 119: 7–23.
27. Kawahara Y, Grimberg A, Teegarden S, Mombereau C, Liu S, et al. (2008)
Dysregulated editing of serotonin 2C receptor mRNAs results in energy
dissipation and loss of fat mass. J Neurosci 28: 12834–12844.
28. Morabito MV, Abbas AI, Hood JL, Kesterson RA, Jacobs MM, et al. (2010)
Mice with altered serotonin 2C receptor RNA editing display characteristics of
Prader-Willi syndrome. Neurobiol Dis 39: 169–180.
29. Doe CM, Relkovic D, Garfield AS, Dalley JW, Theobald DE, et al. (2009) Loss
of the imprinted snoRNA mbii-52 leads to increased 5htr2c pre-RNA editing
and altered 5HT2CR-mediated behaviour. Hum Mol Genet 18: 2140–2148.
30. Englander MT, Dulawa SC, Bhansali P, Schmauss C (2005) How stress and
fluoxetine modulate serotonin 2C receptor pre-mRNA editing. J Neurosci 25:
648–651.
31. Gardiner K, Du Y (2006) A-to-I editing of the 5HT2C receptor and behaviour.
Brief Funct Genomic Proteomic 5: 37–42.
32. Gurevich I, Tamir H, Arango V, Dwork AJ, Mann JJ, et al. (2002) Altered
editing of serotonin 2C receptor pre-mRNA in the prefrontal cortex of depressed
suicide victims. Neuron 34: 349–356.
33. Iwamoto K, Bundo M, Kato T (2009) Serotonin receptor 2C and mental
disorders: genetic, expression and RNA editing studies. RNA Biol 6: 248–253.
34. Iwamoto K, Nakatani N, Bundo M, Yoshikawa T, Kato T (2005) Altered RNA
editing of serotonin 2C receptor in a rat model of depression. Neurosci Res 53:
69–76.
35. Dracheva S, Patel N, Woo DA, Marcus SM, Siever LJ, et al. (2008) Increased
serotonin 2C receptor mRNA editing: a possible risk factor for suicide. Mol
Psychiatry 13: 1001–1010.
36. Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P (1995) Recombinant
mouse OB protein: evidence for a peripheral signal linking adiposity and central
neural networks. Science 269: 546–549.
37. Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, et al. (1995) Weight-
reducing effects of the plasma protein encoded by the obese gene. Science 269:
543–546.
38. Ingalls AM, Dickie MM, Snell GD (1950) Obese, a new mutation in the house
mouse. J Hered 41: 317–318.
39. Pelleymounter MA, Cullen MJ, Baker MB, Hecht R, Winters D, et al. (1995)
Effects of the obese gene product on body weight regulation in ob/ob mice.
Science 269: 540–543.
40. Paxinos G, Franklin KBJ (2007) The Mouse Brain in Stereotaxic Coordinates,
3rd Edition. London: Academic Press.
41. O’Mahony S, Chua AS, Quigley EM, Clarke G, Shanahan F, et al. (2008)
Evidence of an enhanced central 5HT response in irritable bowel syndrome and
in the rat maternal separation model. Neurogastroenterol Motil 20: 680–688.
42. Lanfranco MF, Seitz PK, Morabito MV, Emeson RB, Sanders-Bush E, et al.
(2009) An innovative real-time PCR method to measure changes in RNA editing
of the serotonin 2C receptor (5-HT(2C)R) in brain. J Neurosci Methods 179:
247–257.
43. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:
402–408.
44. Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy
and high throughput. Nucleic Acids Res 32: 1792–1797.
45. Suzuki K, Simpson KA, Minnion JS, Shillito JC, Bloom SR (2010) The role of
gut hormones and the hypothalamus in appetite regulation. Endocr J 57:
359–372.
46. Kanoski SE, Hayes MR, Greenwald HS, Fortin SM, Gianessi CA, et al. (2011)
Hippocampal Leptin Signaling Reduces Food Intake and Modulates Food-
Related Memory Processing. Neuropsychopharmacology.
47. Clifton PG, Kennett GA (2006) Monoamine receptors in the regulation of
feeding behaviour and energy balance. CNS Neurol Disord Drug Targets 5:
293–312.
48. Nonogaki K, Strack AM, Dallman MF, Tecott LH (1998) Leptin-independent
hyperphagia and type 2 diabetes in mice with a mutated serotonin 5-HT2C
receptor gene. Nat Med 4: 1152–1156.
49. Nonogaki K, Nozue K, Oka Y (2006) Hyperphagia alters expression of
hypothalamic 5-HT2C and 5-HT1B receptor genes and plasma des-acyl ghrelin
levels in Ay mice. Endocrinology 147: 5893–5900.
50. Finger BC, Dinan TG, Cryan JF (2010) Leptin-deficient mice retain normal
appetitive spatial learning yet exhibit marked increases in anxiety-related
behaviours. Psychopharmacology (Berl) 210: 559–568.
51. Meneses A (1999) Are 5-HT(1B/1D) and 5-HT(2A/2B/2C) receptors involved
in learning and memory processes? IDrugs 2: 796–801.
52. Meneses A (1999) 5-HT system and cognition. Neurosci Biobehav Rev 23:
1111–1125.
53. Walker EA, Foley JJ (2010) Acquisition session length modulates consolidation
effects produced by 5-HT2C ligands in a mouse autoshaping-operant procedure.
Behav Pharmacol 21: 83–89.
54. Feng Y, Sansam CL, Singh M, Emeson RB (2006) Altered RNA editing in mice
lacking ADAR2 autoregulation. Mol Cell Biol 26: 480–488.
55. Higuchi M, Maas S, Single FN, Hartner J, Rozov A, et al. (2000) Point mutation
in an AMPA receptor gene rescues lethality in mice deficient in the RNA-editing
enzyme ADAR2. Nature 406: 78–81.
56. Wang Q, Khillan J, Gadue P, Nishikura K (2000) Requirement of the RNA
editing deaminase ADAR1 gene for embryonic erythropoiesis. Science 290:
1765–1768.
57. Bendotti C, Samanin R (1986) 8-Hydroxy-2-(di-n-propylamino) tetralin (8-OH-
DPAT) elicits eating in free-feeding rats by acting on central serotonin neurons.
Eur J Pharmacol 121: 147–150.
58. Neill JC, Cooper SJ (1988) MDL 72832, a selective 5-HT1A receptor ligand,
stereospecifically increases food intake. Eur J Pharmacol 151: 329–332.
59. Sharp T, Boothman L, Raley J, Queree P (2007) Important messages in the
‘post’: recent discoveries in 5-HT neurone feedback control. Trends Pharmacol
Sci 28: 629–636.
60. Collin M, Backberg M, Onnestam K, Meister B (2002) 5-HT1A receptor
immunoreactivity in hypothalamic neurons involved in body weight control.
Neuroreport 13: 945–951.
61. Rowland NE, Dunn AJ (1995) Effect of dexfenfluramine on metabolic and
neurochemical measures in restraint-stressed ob/ob mice. Physiol Behav 58:
749–754.
62. Cryan JF, Leonard BE (2000) 5-HT1A and beyond: the role of serotonin and its
receptors in depression and the antidepressant response. Hum Psychopharmacol
15: 113–135.
63. O’Leary OF, Cryan JF (2010) The Behavioral Genetics of Serotonin: Relevance
to Anxiety and Depression. In: Mu ¨ller B, Jacobs, eds. Handbook of the
behavioral neurobiology of serotonin.
64. Frassetto A, Zhang J, Lao JZ, White A, Metzger JM, et al. (2008) Reduced
sensitivity to diet-induced obesity in mice carrying a mutant 5-HT6 receptor.
Brain Res 1236: 140–144.
65. Heal DJ, Smith SL, Fisas A, Codony X, Buschmann H (2008) Selective 5-HT6
receptor ligands: progress in the development of a novel pharmacological
approach to the treatment of obesity and related metabolic disorders. Pharmacol
Ther 117: 207–231.
66. Singer JM, Wilson MW, Johnson PD, Graham SR, Cooke LW, et al. (2009)
Synthesis and SAR of tolylamine 5-HT6 antagonists. Bioorg Med Chem Lett 19:
2409–2412.
67. Finger BC, Schellekens H, Dinan TG, Cryan JF (2011) Is there altered sensitivity
to ghrelin-receptor ligands in leptin-deficient mice?: importance of satiety state
and time of day. Psychopharmacology (Berl) 216: 421–429.
5-HT2CReceptor Editing and Obesity
PLoS ONE | www.plosone.org12 March 2012 | Volume 7 | Issue 3 | e32266