Expression levels of novel cytokine IL-32 in periodontitis and its role in the suppression of IL-8 production by human gingival fibroblasts stimulated with Porphyromonas gingivalis.

Abstract

IL-32 was recently found to be elevated in the tissue of rheumatoid arthritis and inflammatory bowel disease. Periodontitis is a chronic inflammatory disease caused by polymicrobial infections that result in soft tissue destruction and alveolar bone loss. Although IL-32 is also thought to be associated with periodontal disease, its expression and possible role in periodontal tissue remain unclear. Therefore, this study investigated the expression patterns of IL-32 in healthy and periodontally diseased gingival tissue. The expression of IL-32 in cultured human gingival fibroblasts (HGF) as well as effects of autocrine IL-32 on IL-8 production from HGF were also examined.
Periodontal tissue was collected from both healthy volunteers and periodontitis patients, and immunofluorescent staining was performed in order to determine the production of IL-32. Using real-time PCR and ELISA, mRNA expression and protein production of IL-32 in HGF, stimulated by Porphyromonas gingivalis (Pg), were also investigated.
Contrary to our expectation, the production of IL-32 in the periodontitis patients was significantly lower than in the healthy volunteers. According to immunofluorescent microscopy, positive staining for IL-32 was detected in prickle and basal cell layers in the epithelium as well as fibroblastic cells in connective tissue. Addition of fixed Pgin vitro was found to suppress the otherwise constitutive expression of IL-32 mRNA and protein in HGF. However, recombinant IL-32 in vitro inhibited the expression of IL-8 mRNA by HGF stimulated with Pg. Interestingly, anti-IL-32 neutralizing antibody upregulated the IL-8 mRNA expression in non-stimulated HGF, indicating that constitutive expression of IL-32 in HGF suppressed IL-8 mRNA expression in the absence of bacterial stimulation.
These results indicate that IL-32 is constitutively produced by HGF which can be suppressed by Pg and may play a role in the downregulation of inflammatory responses, such as IL-8 production, in periodontal tissue.

Full text

Page 1

Expression levels of novel cytokine
IL-32 in periodontitis and its role in
the suppression of IL-8 production by
human gingival fibroblasts stimulated
with Porphyromonas gingivalis
Kazuhisa Ouhara1,2*, Toshihisa Kawai2, Marcelo J.B. Silva2,
Tsuyoshi Fujita1, Kouichi Hayashida1, Nadeem Y. Karimbux3,
Mikihito Kajiya2, Hideki Shiba1, Hiroyuki Kawaguchi1and
Hidemi Kurihara1
1Department of Periodontal Medicine, Hiroshima University Graduate School of Biomedical Sciences,
Hiroshima, Japan;2Department of Immunology, The Forsyth Institute, Boston, MA, USA;3Office of
Education, Harvard School of Dental Medicine, Boston, MA, USA
Background: IL-32 was recently found to be elevated in the tissue of rheumatoid arthritis and inflammatory
bowel disease. Periodontitis is a chronic inflammatory disease caused by polymicrobial infections that result
in soft tissue destruction and alveolar bone loss. Although IL-32 is also thought to be associated with
periodontal disease, its expression and possible role in periodontal tissue remain unclear. Therefore, this study
investigated the expression patterns of IL-32 in healthy and periodontally diseased gingival tissue. The
expression of IL-32 in cultured human gingival fibroblasts (HGF) as well as effects of autocrine IL-32 on IL-8
production from HGF were also examined.
Methods: Periodontal tissue was collected from both healthy volunteers and periodontitis patients, and
immunofluorescent staining was performed in order to determine the production of IL-32. Using real-time
PCR and ELISA, mRNA expression and protein production of IL-32 in HGF, stimulated by Porphyromonas
gingivalis (Pg), were also investigated.
Results: Contrary to our expectation, the production of IL-32 in the periodontitis patients was significantly
lower than in the healthy volunteers. According to immunofluorescent microscopy, positive staining for IL-32
was detected in prickle and basal cell layers in the epithelium as well as fibroblastic cells in connective tissue.
Addition of fixed Pg in vitro was found to suppress the otherwise constitutive expression of IL-32 mRNA and
protein in HGF. However, recombinant IL-32 in vitro inhibited the expression of IL-8 mRNA by HGF
stimulated with Pg. Interestingly, anti-IL-32 neutralizing antibody upregulated the IL-8 mRNA expression in
non-stimulated HGF, indicating that constitutive expression of IL-32 in HGF suppressed IL-8 mRNA
expression in the absence of bacterial stimulation.
Conclusion: These results indicate that IL-32 is constitutively produced by HGF which can be suppressed by
Pg and may play a role in the downregulation of inflammatory responses, such as IL-8 production, in
periodontal tissue.
Keywords: Interleukin-32; periodontal disease; Porphyromonas gingivalis; human gingival fibroblast; Interleukin-8
Received: 25 November 2011; Revised: 21 February 2012; Accepted: 22 February 2012; Published: 16 March 2012
P
genic bacteria such as Porphyromonas gingivalis (1). Such
Gram-negative bacteria are known to produce patho-
eriodontitis is a chronic inflammatory and infec-
tious disease characterized by the interaction
between periodontal tissue and periodontopatho-
genic factors, such as outer membrane protein (Omps),
leukotoxin, and protease, to induce inflammation in
gingival tissue (2). These bacteria also possess lipopoly-
saccharide (LPS) in the outer membrane as a modu-
lator of inflammation (3). The immune response to
(page number not for citation purpose)
?
ORIGINAL ARTICLE
Journal of Oral Microbiology 2012.
Noncommercial 3.0 Unported License (http://creativecommons.org/licenses/by-nc/3.0/), permitting all non-commercial use, distribution, and reproduction in any
medium, provided the original work is properly cited.
Citation: Journal of Oral Microbiology 2012, 4: 14832 - DOI: 10.3402/jom.v4i0.14832
# 2012 Kazuhisa Ouhara et al. This is an Open Access article distributed under the terms of the Creative Commons Attribution-
1

Page 2

periodontopathogenic bacteria plays an essential role
in the breakdown of connective tissue and alveolar bone
(4, 5). Gingival fibroblasts, the major component of
periodontal connective tissue, are involved in the inflam-
matory processes in response to bacterial challenge. In
particular, gingival fibroblasts produce proinflammatory
cytokines, including IL-1b, IL-6, IL-8 and TNF-a (6, 7).
These cytokines produced from gingival fibroblasts are
involved in the activation of monocytes, macrophages,
dendritic cells, neutrophils and lymphocytes (8). As a
consequence of upregulation of acquired cellular immune
responses caused by fibroblast-derived proinflammatory
cytokines, the progression of periodontal disease is
promoted (8).
IL-32, a recently characterized cytokine, has six iso-
forms and is produced by natural killer (NK) cells, T-cells,
epithelial cells and monocytes (9?11). IL-32 is also
upregulated in response to TNF-a and IL-1b in inflam-
matory bowel disease, Crohn’s disease and rheumatoid
arthritis (12, 13). Therefore, it is thought that IL-32
functions as a proinflammatory cytokine. Since IL-32 is
involved in the upregulation of the proinflammatory
cytokine production in some diseases, it was hypothesized
that IL-32 might also be associated with periodontal
disease by upregulation of proinflammatory cytokines.
Therefore, in this study, the expression of IL-32 in healthy
subjects and in the inflamed periodontal tissue collected
from patients was compared. The expression patterns of
IL-32 were then analyzed in cultured human gingival
fibroblasts (HGF). The effect of IL-32 on the proinflam-
matorycytokineexpressionbyHGFwasalsoinvestigated.
Materials and methods
Collection of human gingival tissue samples
After obtaining approval from the Ethical Committees of
The Forsyth Institute and Harvard School of Dental
Medicine (HSDM, Boston, MA, USA), both healthy and
inflamed gingival tissue samples were collected in the
Periodontology Department laboratories at HSDM.
Healthy gingival tissue was characterized by the lack of
bleeding on probing (gingival pocket depth53 mm; n?
5, 2 males and 3 females, aged 29?43 years) and collected
from the healthy volunteer who signed informed consent
prior to enrollment. Periodontal disease was divided into
three categories by the degree of swelling of the site
collected from the patients. Since there was a limitation
among the small number of samples to discuss the
correlation between the production of IL-32 and three
different categories, these were all grouped as one
category ‘inflamed’. Inflamed gingival tissues were ob-
tained from patients with periodontal disease at flap
surgery. The periodontally diseased sites of patients who
donated the gingival tissue samples were also character-
ized by radiological bone resorption and bleeding on
probing (gingival pocket depth]5 mm; n?7, 4 males
and 3 females, aged 20?55 years) (Table 1).
Cell culture
Human gingival fibroblasts (HGF) were obtained from
healthy volunteers as described previously (14). HGF
were cultured to confluence in a 35 mm diameter dish
with Dulbecco’s modified Eagle’s medium supplemented
with 10% fetal bovine serum (GIBCO, Grand Island, NY,
USA), 100 units/ml penicillin, 100 mg/ml streptomycin
and 1 mg/ml amphotericin B. When HGF cells formed a
confluent monolayer, cells were harvested with 0.05%
trypsin and 0.02% EDTA and transferred to a 100 mm
diameter plastic culture dish. Fourth passage HGF
cultures were used in the following experiments.
Detection of interleukin-32 and IL-8 by enzyme-
linked immunosorbent assay (ELISA)
In order to examine the production of IL-32 in the
gingival tissue, gingival tissues were homogenized in lysis
buffer (15). IL-32 from the gingival tissue homogenate or
Table 1. Clinical parameters
No.SexAge Smoking RaceTooth numberPD (mm)BOP Diagnosis
1M 41NoWhite182
?
?
?
?
?
?
?
?
?
?
?
?
Healthy
2F35No?24/253Healthy
3F29 NoWhite 193Healthy
4F38NoAsian 42Healthy
5M43 No Asian313Healthy
6F 38 NoWhite14/155Slight Periodontitis
7M 43No White6/56 Slight Periodontitis
8
9
F
F
38
43
No
No
White
White
31
2
7
7
Moderate Periodontitis
Moderate Periodontitis
10M 20NoWhite 307 Moderate Periodontitis
11M 55 NoBlack 149 Moderate Periodontitis
12M41 No?46Severe Periodontitis
Kazuhisa Ouhara et al.
2
(page number not for citation purpose)
Citation: Journal of Oral Microbiology 2012, 4: 14832 - DOI: 10.3402/jom.v4i0.14832

Page 3

the supernatant of HGF was detected by ELISA, as
previously described (16). Briefly, anti-IL-32 mouse
monoclonal antibody (2 mg/ml, #513501; BioLegend,
San Diego, CA, USA; sodium bicarbonate buffer, pH
9.7) was coated onto a 96-well ELISA plate (BD Falcon,
Franklin Lakes, NJ, USA). After blocking each well with
0.5% BSA in PBS supplemented with 0.05% Tween 20
(PBST), either a homogenate of gingival tissue samples or
a cultured medium supernatant was applied into each
well, followed by purified anti-IL-32 rabbit IgG (2 mg/ml,
#IMX-5871; IMGENEX, San Diego, CA, USA). The
IL-8 ELISA Development kit (#900-K18; Peprotech,
Rocky Hill, NJ, USA) was used to detect IL-8, following
the manufacturer’s protocol. Each well was then reacted
with anti-rabbit IgG-conjugated horseradish peroxidase
(Roche, Indianapolis, IN, USA). Colorimetric reactions
were developed with o-Phenylenediamine (Sigma, Tokyo,
Japan) in the presence of 0.02% H2O2. Color develop-
ment was paused with H2SO4(2 N) and measured by an
ELISA reader (OD 490 nm). The actual concentration of
IL-32 was calibrated by referring to a standard curve
prepared by serial dilution of recombinant human IL-32g
(BioVision, Mountain View, CA, USA) or g (R and D
Systems, Inc., Minneapolis, MN, USA). Each sample was
examined in triplicate wells of a 96-well ELISA plate.
Immunofluorescent microscopic observation
Frozen sections of each tissue (two healthy and three
inflamed tissues) were fixed with Acetone-alcohol at 48C
for 1 min. After blocking with 0.5% BSA in PBST, each
section was incubated with anti-IL-32 mouse monoclonal
antibody (2 mg/ml, #513501; BioLegend) or anti-IL-8
mouse monoclonal antibody (2 mg/ml, #500-M8; Pepro-
tech) in PBS at 48C for 12 hours. Then, Alexa594-labeled
anti-mouse IgG (Invitrogen, Carlsbad, CA, USA) was
applied for 30 min at room temperature. The Alexa594
signals in the sections were observed using fluorescent
microscopy (model BZ-9000; Keyence, Osaka, Japan).
Stimulation of HGF
The confluent culture of HGF was stimulated with
formalin fixed P. gingivalis W83 (107CFU/ml) for 12
hours to examine the expression of mRNA and for 24
hours to detect the production of IL-32 or IL-8 by
ELISA.
Real-time PCR analysis
After the stimulation of HGF, total RNA was purified
and analyzed by the two-step LightCycler
Time PCR System (17). Briefly, one microgram of total
RNA was used for reverse transcription by the First
Strand cDNA Synthesis Kit for RT-PCR (Roche
Diagnostics, Tokyo, Japan). Then, one microliter of
cDNA was used for real-time PCR. The amplified
†480 Real-
condition was described previously (17). The primers
used in this study are listed in Table 2.
Statistical analysis
Differences between the two groups were analyzed by
Student’s t-test.
Results
Detection of IL-32 and IL-8 in human gingival tissue
homogenate
The production of total IL-32 in human healthy
or inflamed gingival tissues was examined by ELISA
(Fig. 1A). Although IL-32 was detected in both healthy
and inflamed tissues, the amount of IL-32 in the
inflamed gingival tissue was lower than that observed in
the healthy tissue (average healthy tissue: 471.69108.7
pg/mg tissue; inflamed tissue: 106.1969.7 pg/mg tissue).
Proinflammatory cytokine IL-8 production in the gingi-
val tissues was also measured by ELISA (Fig. 1B). The
amount of IL-8 in periodontally diseased tissue was
higher than in healthy gingival tissue (average healthy
tissue: 38.6911.4 pg/mg tissue; inflamed tissue: 840.59
513.6 pg/mg tissue), suggesting that the gingival tissues
sampled from patients with periodontal disease were
inflamed. Immunohistostaining of IL-32 showed the
presence of many positively stained cells in the healthy
gingival tissue section (Fig. 1C). In particular, prickle and
basal cell layers in the epithelium and fibroblastic cells in
connective tissue were heavily stained. On the other hand,
there were fewer positive cells in the inflamed gingival
tissue (Fig. 1D). Neither healthy nor diseased gingival
tissue was stained in the control non-immunized mouse
IgG (Fig. 1E, F). On the other hand, the production of
IL-8 in healthy tissue was weak, whereas positive stain-
ing of IL-8 expression was found in the inflamed gingi-
val tissues, especially epithelium and connective tissue
(Fig. 1G, H).
Table 2. Primers
PrimersSequence target
IL-32a-SaatcaggacgtggacaggtgatgtIL-32a
IL-32a-AS gtgccaccaggtctgcagccg
IL-32b-SaatcaggacgtggacaggtgatgtIL-32b
IL-32b-AS
IL-32c-S
gtgccaccaggtctgcagccg
tgaaggcccgaatggtgatgtIL-32g
IL-32c-ASgtgccaccaggtctgcagccg
IL-32d-S acgtggacaggacgacttcaaagIL-32d
IL-32d-ASgtgccaccaggtctgcagccg
IL-8-AStctcagccctcttcaaaaacttctcIL-8
IL-8-ASatgacttccaagctggccgtggct
actin-Sgacggggtcacccacactgt
b-actin
actin-ASaggagcaatgatcttgatcttc
Expression and role of IL-32 in periodontal tissue
Citation: Journal of Oral Microbiology 2012, 4: 14832 - DOI: 10.3402/jom.v4i0.14832
3
(page number not for citation purpose)

Page 4

IL-32 mRNA expression and production in HGF
stimulated with P. gingivalis
Four isoforms of IL-32 mRNA are well known:
IL-32a, b, g and d (10). To determine the mRNA
expression of IL-32a, b, g and d in HGF stimulated
by P. gingivalis W83, real-time PCR was performed by
using specific primer and the LightCycler system. Each
IL-32 mRNA isoform was detected in unstimulated
HGF. However, stimulation of HGF with P. gingivalis
downregulated the mRNA expression of each IL-32
isoform, respectively (Fig. 2A). A similar result was
obtained in the total IL-32 production at the protein
level in the HGF culture supernatant (66% reduction)
(Fig. 2B).
The effect of IL-32 on expressions of IL-8 mRNA
in HGF
In an attempt to examine the anti-inflammatory effect of
IL-32, recombinant IL-32g was added into the HGF
culture with or without fixed P. gingivalis. Bacterial
stimulation induced the mRNA expression of IL-8
(Fig. 2C). However, the addition of IL-32g resulted in
the suppression of IL-8 mRNA expression (66% reduc-
tion). Furthermore,anti-IL-32
reversed the suppression of IL-8 mRNA caused by
P. gingivalis. Interestingly, recombinant IL-32g alone
without P. gingivalis also showed inhibitory effect on
IL-8 mRNA expression in HGF (35% reduction).
Finally, anti-IL-32 neutralizing antibody upregulated
goatIgG partially
*
600
400
200
0
IL-8 production (pg/mg tissue)
A
IL-32 production (pg/mg tissue)
B
*
Ctrl Ab
xIL-32 pAb
Healthy Inflamed
HealthyInflamed
Healthy Inflamed
C
D
F
xIL-8
E
G
H
Fig. 1. Analyses of IL-32 and IL-8 expressed in healthy and inflamed human gingival tissue. (A) In order to determine the
production of IL-32 by ELISA, both healthy gingival tissue (gingival pocket depth 5 3mm; n?5, two males and three females,
aged 29?43 years) and inflamed gingival tissue (gingival pocket depth?4mm; n?5, four males and two females, aged 20?55
years) were collected from volunteer patients. The gingival tissue was homogenized for the sample. IL-32 present in the gingival
tissue homogenates was measured using ELISA. (B) IL-8 production was measured by ELISA Development kit in accordance
with the manufacturer’s instructions. The values represent the means and standard deviations of triplicate experiments.
*Significantly higher than healthy gingival tissue, by Student’s t-test (PB0.01). (C?H) Immunohistochemical analysis of human
IL-32 and IL-8 production in the gingival tissue: IL-32 production in human healthy (C, E) and inflamed (D, F) gingival tissues
was determined using immunohistochemical staining, following the previously published protocol. For IL-32-positive staining,
mouse monoclonal anti-IL-32 was utilized to detect the production of IL-32 (C, D). As a negative control, non-immune mouse
IgG was used (E, F). In order to show the inflammation of the tissue, IL-8 was stained following the published procedure. In the
positively stained samples, arrows indicate IL-32- and IL-8-positive cells. Original magnification is 200 times. The white bar
corresponds to 50 mm.
Kazuhisa Ouhara et al.
4
(page number not for citation purpose)
Citation: Journal of Oral Microbiology 2012, 4: 14832 - DOI: 10.3402/jom.v4i0.14832

Page 5

IL-8 mRNA expression in the non-stimulated HGF,
indicating that constitutively expressed IL-32 appeared
to suppress IL-8 mRNA expression. These results
suggested that IL-32 may play a role in the down-
regulation of IL-8 mRNA expression in HGF and that
the periodontal pathogen P. gingivalis can suppress IL-32
production from HGF.
Discussion
In this study, we investigated the production pattern of
IL-32 in periodontal tissue with or without periodontal
disease. The production of IL-32 was lower in the tissue
from periodontitis patients compared with the tissue
of healthy volunteers (Fig. 1). An in vitro study showed
that IL-32 was constitutively expressed in HGF, but
Fig. 2. In vitro evaluation of IL-32 and IL-8 expression in human gingival fibroblasts. (A) Effects of Porphyromonas gingivalis
stimulation on the production of IL-32 mRNA in human gingival fibroblasts: Primary culture of human gingival fibroblasts was
stimulated with formalin fixed P. gingivalis (108cells/ml) for 12 hours, and total RNAwas extracted to perform the quantitative
RT-PCR for the four different isoforms of IL-32. The mRNA expression of IL-32 was standardized by the ratio against
Glyceraldehyde 3 ? phosphate dehydrogenase (GAPDH). The values represent the means and standard deviations of triplicate
experiments. *Significantly higher than medium control alone without bacteria by Student’s t-test (P B0.01). (B) Effect of
Porphyromonas gingivalis on IL-32 protein production from HGF: The production of IL-32 in contact with P. gingivalis for
24 hours was monitored using an IL-32 ELISA. The values represent the means and standard deviations of triplicate
experiments. *Significantly higher than control without bacteria (the far left bar with #) by Student’s t-test (PB0.01). (C) The
effects of IL-32 on expression of IL-8 mRNA in HGF: In order to determine the effect of IL-32 in HGF, recombinant human
IL-32g (10 ng/ml) was applied to the culture medium with and without P. gingivalis stimulation. Anti-IL-32 polyclonal antibody
(2 mg/ml) or normal goat IgG (2 mg/ml) was also added into the medium for neutralization of IL-32. Total RNA was extracted
for quantitative RT-PCR to analyze the IL-8 mRNA expression after 12 hours of stimulation by P. gingivalis. The values
represent the means and standard deviations of triplicate experiments. *Significantly higher than control without bacteria (the
far left bar with #) by Student’s t-test (PB0.01).
Expression and role of IL-32 in periodontal tissue
Citation: Journal of Oral Microbiology 2012, 4: 14832 - DOI: 10.3402/jom.v4i0.14832
5
(page number not for citation purpose)

Page 6

suppressed by P. gingivalis stimulation. Recombinant
IL-32g exhibited an anti-inflammatory effect by supp-
ressing the IL-8 expression in HGF stimulated with
P. gingivalis. Furthermore, antibody-mediated neutraliza-
tion of IL-32 in non-stimulated HGF increased IL-8
production. Taken together, these results suggested that
IL-32 appeared to play an anti-inflammatory role in
healthy gingival tissue, while suppression of IL-32 by
the periodontal pathogen P. gingivalis may lead to the
upregulation of inflammatory response, which promotes
the progression of periodontal disease.
Previous reports show that IL-32 was originally cloned
as a transcript (NK4) that is produced in NK- or T-cells
(11). In addition, IL-32 is produced by mononuclear,
endothelial and epithelial cells after stimulation by IL-1b,
IL-2, IL-18, TNF-a or IFN-g (9, 18?20). DNA micro-
array analysis shows that P. gingivalis-derived LPS
induced the expression of IL-32 in monocytes (THP-1
cells) (3). However, very little is known about the
expression of IL-32 in the gingival fibroblasts which
constitute majority of tissue supporting cells in lamina
propria of periodontal tissue. Immunohistochemistry
showed strong staining patterns in subgingival fibroblas-
tic cells as well as gingival epithelial cells (Fig. 1C, D),
and such expression of IL-32 in the gingival tissue was
lower in the diseased gingival tissue compared with the
healthy ones (Fig. 1A). Although some cytokines are
known to be influenced by genetic background or single-
nucleotide polymorphism (SNP), the small number of
subjects used in this study is not suitable to compare the
correlation between healthy and periodontitis tissue (21).
Furthermore, the production of IFN-g and IL-13 in
whole blood cell from smokers is reported to be higher
than non-smoker (22). Therefore, it is very significant to
analyze the production of IL-32 in many subjects
including multiple genetic background. Our in vitro
experiment showed that the addition of P. gingivalis
suppressed the otherwise constitutively expressed IL-32
mRNA and protein in HGF (Fig. 2A, B). These results
indicated that down-regulatory effects of IL-32 on
inflammatory response can be interrupted by periodontal
pathogen, P. gingivalis, in the context of periodontal
disease.
It has been reported that the production of IL-32 is
increased in rheumatoid arthritis (RA), an inflammatory
bone resorptive disease, which shares several pathogenic
characteristics in common with periodontal disease (23).
Therefore, these results were unexpected. However, one of
the major differences between RA and periodontal
disease is the phenomenon of polymicrobial infection.
A number of virulent factors are reported to be produced
from periodontal pathogens such as P. gingivalis (24?26).
Therefore, it is plausible that some bacterial factors,
including LPS, outer membrane protein, and protease,
might have acted on HGF and suppressed IL-32 produc-
tion by generating a negative signal to reduce IL-32
mRNA expression. On the other hand, IL-32b has been
reported to induce the production of anti-inflammatory
cytokine IL-10 (27). More specifically, IL-32 was
found to promote the expression of IL-10 in monocyte
linage cells upon stimulation with phorbol 12-myristate
13-acetate (PMA) or lipopolysaccharide (LPS) (27).
While immune cells are accepted as the major cellular
source of IL-10 in the context of inflammation (28, 29), it
is also true that HGF produce IL-10 in response to
bacterial challenge (30). Therefore, it is conceivable that
IL-10 may intervene in the bacteria-mediated suppression
of IL-32 production from HGF.
Our in vivo and in vitro results showed that IL-32 is
produced constitutively in healthy conditions. Hence, it
was hypothesized that IL-32 might have an anti-inflam-
matory effect in periodontal tissue. IL-8 is a chemokine
produced by gingival epithelial cells and upregulated in
the presence of periodontopathogenic bacterial stimula-
tion (31). IL-8 induces the chemoattraction of neutro-
phils through CXCR1 receptors in the affected lesion,
which, in turn, promote inflammatory response by such
tissue destructive factors as reactive oxygen species (ROS)
from migrating neutrophils (32). Recombinant IL-32g
suppressed the induction of IL-8 mRNA in HGF, while
anti-IL-32 antibody neutralized the effect of IL-32.
Furthermore, the addition of anti-IL-32 antibody into
HGF culture without P. gingivalis increased IL-8 mRNA.
Thus, IL-32 may function as an autocrine factor to
downregulate the expression of IL-8.
It is curious that a putative receptor for IL-32 remains
unknown. To date, the only identified IL-32 binding
protein is proteinase 3 (PR3) whose catalytic activity
partially cleaves IL-32, increasing bioactivity of IL-32
(33). The difficulty of identifying an IL-32 receptor was
speculated to result from its possibly high molecular
weight which is not feasibly separated in SDS-PAGE.
Alternatively, the binding affinity of IL-32 could be lower
than PR3 (33) which is not suitable for affinity-dependent
isolation. However, based on the contrary results between
present study and the report of RA (3, 13), two different
types of IL-32 receptors can be assumed to induce cell
signaling; one type of receptor induces a proinflamma-
tory signal, while another induces an anti-inflammatory
signal. Based on the results of this study, it can be
hypothesized that HGF express IL-32 that has a receptor
of the second type. This theory, however, requires further
study to identify the HGF-specific IL-32 receptor and to
characterize the properties of the cell signaling elicited by
the IL-32 receptor expressed on HGF.
In conclusion, since constitutive production of IL-32
can inhibit IL-8 production, IL-32 might play an
important role in regulating inflammation in healthy
gingival tissue. On the other hand, it was found that
periodontopathogenic bacterial challenge can suppress
Kazuhisa Ouhara et al.
6
(page number not for citation purpose)
Citation: Journal of Oral Microbiology 2012, 4: 14832 - DOI: 10.3402/jom.v4i0.14832

Page 7

IL-32 production, leading to the increase of inflamma-
tory response by loss of anti-inflammatory IL-32.
Taken together, these findings could help to further
define the etiology of periodontal disease, as well as
form a basis for novel therapeutic regimens against
periodontitis. Further study will be needed to determine
the target molecule of IL-32 in periodontitis and the
structural component of P. gingivalis that suppresses
IL-32 expression.
Acknowledgements
This research was supported by a Grant-in-Aid for the Encourage-
ment of Young Scientists (B) 22792085 from the Japan Society for
the Promotion of Science and by an NIH grant DE-018499 from the
NIDCR (Kawai). We would like to thank Mr. Tomoya Matsumoto
(Keyence, Osaka, Japan) for his helpful advice and technical
support.
Conflict of interest and funding
There is no conflict of interest in the present study for
any of the authors.
References
1. Socransky SS, Haffajee AD. Implications of periodontal micro-
biology for the treatment of periodontal infections. Compend
Suppl 1994: S684?5, 8?93; quiz S714?7.
2. Kadowaki T, Nakayama K, Okamoto K, Abe N, Baba A, Shi Y,
et al. Porphyromonas gingivalis proteinases as virulence deter-
minants in progression of periodontal diseases. J Biochem 2000;
128: 153?9.
3. Barksby HE, Nile CJ, Jaedicke KM, Taylor JJ, Preshaw PM.
Differential expression of immunoregulatory genes in mono-
cytes in response to Porphyromonas gingivalis and Escherichia
coli lipopolysaccharide. Clin Exp Immunol 2009; 156: 479?87.
4. Oshiro T, Shiotani A, Shibasaki Y, Sasaki T. Osteoclast
induction in periodontal tissue during experimental movement
of incisors in osteoprotegerin-deficient mice. Anat Rec 2002;
266: 218?25.
5. Teng YT, Nguyen H, Gao X, Kong YY, Gorczynski RM, Singh
B, et al. Functional human T-cell immunity and osteoprotegerin
ligand control alveolar bone destruction in periodontal infec-
tion. J Clin Invest 2000; 106: R59?67.
6. Steffen MJ, Holt SC, Ebersole JL. Porphyromonas gingivalis
induction of mediator and cytokine secretion by human gingival
fibroblasts. Oral Microbiol Immunol 2000; 15: 172?80.
7. Imatani T, Kato T, Okuda K. Production of inflammatory
cytokines by human gingival fibroblasts stimulated by cell-
surface preparations of Porphyromonas gingivalis. Oral Micro-
biol Immunol 2001; 16: 65?72.
8. van Winkelhoff AJ. Antibiotics in periodontics: are we getting
somewhere? J Clin Periodontol 2005; 32: 1094?5.
9. Kim SH, Han SY, Azam T, Yoon DY, Dinarello CA. Inter-
leukin-32: a cytokine and inducer of TNFalpha. Immunity 2005;
22: 131?42.
10. Dinarello CA, Kim SH. IL-32, a novel cytokine with a possible
role in disease. Ann Rheum Dis 2006; 65 (Suppl 3): iii61?4.
11. Dahl CA, Schall RP, He HL, Cairns JS. Identification of a novel
gene expressed in activated natural killer cells and T cells. J
Immunol 1992; 148: 597?603.
12. Shioya M, Nishida A, Yagi Y, Ogawa A, Tsujikawa T, Kim-
Mitsuyama S, et al. Epithelial overexpression of interleukin-
32alpha in inflammatory bowel disease. Clin Exp Immunol
2007; 149: 480?6.
13. Joosten LA, Netea MG, Kim SH, Yoon DY, Oppers-Walgreen
B, Radstake TR, et al. IL-32, a proinflammatory cytokine in
rheumatoid arthritis. Proc Natl Acad Sci USA 2006; 103:
3298?303.
14. Fujita T, IwataT, Shiba
Takeda K, et al. Identification of marker genes distinguishing
human periodontal ligament cells from human mesenchymal
stem cells and human gingival fibroblasts. J Periodontal Res
2007; 42: 283?6.
15. Ueki Y, Lin CY, Senoo M, Ebihara T, Agata N, Onji M, et al.
Increased myeloid cell responses to M-CSF and RANKL cause
bone loss and inflammation in SH3BP2 ‘cherubism’ mice. Cell
2007; 128: 71?83.
16. Hosokawa I, Hosokawa Y, Komatsuzawa H, Goncalves RB,
Karimbux N, Napimoga MH, et al. Innate immune peptide
LL-37 displays distinct expression pattern from beta-defensins
in inflamed gingival tissue. Clin Exp Immunol 2006; 146:
218?25.
17. Shiba H, Tsuda H, Kajiya M, Fujita T, Takeda K, Hino T, et al.
Neodymium-doped yttrium-aluminium-garnet laser irradiation
abolishes the increase in interleukin-6 levels caused by pepti-
doglycan through the p38 mitogen-activated protein kinase
pathway in human pulp cells. J Endod 2009; 35: 373?6.
18. Netea MG, Azam T, Ferwerda G, Girardin SE, Walsh M, Park
JS, et al. IL-32 synergizes with nucleotide oligomerization
domain (NOD) 1 and NOD2 ligands for IL-1beta and IL-6
production through a caspase 1-dependent mechanism. Proc
Natl Acad Sci USA 2005; 102: 16309?14.
19. Mun SH, Kim JW, Nah SS, Ko NY, Lee JH, Kim JD, et al.
Tumor necrosis factor alpha-induced interleukin-32 is positively
regulated via the Syk/protein kinase Cdelta/JNK pathway in
rheumatoid synovial fibroblasts. Arthritis Rheum 2009; 60:
678?85.
20. Nold-Petry CA, Nold MF, Zepp JA, Kim SH, Voelkel NF,
Dinarello CA. IL-32-dependent effects of IL-1beta on endothe-
lial cell functions. Proc Natl Acad Sci USA 2009; 106: 3883?8.
21. Takashiba S, Naruishi K. Gene polymorphisms in periodontal
health and disease. Periodontol 2000 2006; 40: 94?106.
22. de Heens GL, van der Velden U, Loos BG. Cigarette smoking
enhances T cell activation and a Th2 immune response; an
aspect of the pathophysiology in periodontal disease. Cytokine
2009; 47: 157?61.
23. Smolik I, Robinson D, El-Gabalawy HS.Periodontitis and
rheumatoid arthritis: epidemiologic, clinical, and immunologic
associations. Compend Contin Educ Dent 2009; 30: 188?90, 92,
94 passim; quiz 98, 210.
24. Stathopoulou PG, Benakanakere MR, Galicia JC, Kinane DF.
The host cytokine response to Porphyromonas gingivalis is
modified bygingipains. Oral Microbiol Immunol 2009; 24: 11?7.
25. Baba A, Kadowaki T, Asao T, Yamamoto K. Roles for Arg- and
Lys-gingipains in the disruption of cytokine responses and loss
of viability of human endothelial cells by Porphyromonas
gingivalis infection. Biol Chem 2002; 383: 1223?30.
26. Pingel LC, Kohlgraf KG, Hansen CJ, Eastman CG, Dietrich
DE, Burnell KK, et al. Human beta-defensin 3 binds
to hemagglutinin B (rHagB), a non-fimbrial adhesin from
Porphyromonas gingivalis, and attenuates a pro-inflammatory
cytokine response. Immunol Cell Biol 2008; 86: 643?9.
27. Hong J, Bae S, Kang Y, Yoon D, Bai X, Chan ED, et al.
Suppressing IL-32 in monocytes impairs the induction of the
proinflammatory cytokines TNFalpha and IL-1beta. Cytokine
2009; 49: 171?6.
H,Igarashi A,HirataR,
Expression and role of IL-32 in periodontal tissue
Citation: Journal of Oral Microbiology 2012, 4: 14832 - DOI: 10.3402/jom.v4i0.14832
7
(page number not for citation purpose)

Page 8

28. Colic M, Gazivoda D, Vasilijic S, Vucevic D, Lukic A.
Production of IL-10 and IL-12 by antigen-presenting cells in
periapical lesions. J Oral Pathol Med 39: 690?6.
29. Conti P, Kempuraj D, Kandere K, Di Gioacchino M,
Barbacane RC, Castellani ML, et al. IL-10, an inflammatory/
inhibitory cytokine, but not always. Immunol Lett 2003; 86:
123?9.
30. Morandini AC, Sipert CR, Ramos-Junior ES, Brozoski DT,
Santos CF. Periodontal ligament and gingival fibroblasts
participate in the production of TGF-beta, interleukin (IL)-8
and IL-10. Braz Oral Res 25: 157?62.
31. Uchida Y, Shiba H, Komatsuzawa H, Takemoto T, Sakata M,
Fujita T, et al. Expression of IL-1 beta and IL-8 by human
gingival epithelial cells in response to Actinobacillus actinomy-
cetemcomitans. Cytokine 2001; 14: 152?61.
32. Baggiolini M, Clark-Lewis I. Interleukin-8, a chemotactic and
inflammatory cytokine. FEBS Lett 1992; 307: 97?101.
33. Novick D, Rubinstein M, Azam T, Rabinkov A, Dinarello CA,
Kim SH. Proteinase 3 is an IL-32 binding protein. Proc Natl
Acad Sci USA 2006; 103: 3316?21.
*Kazuhisa Ouhara
Department of Periodontal Medicine
Hiroshima, University Graduate School of Biomedical Sciences
Hiroshima
Japan
Tel: ?81-82-257-5663
Email: kouhara@hiroshima-u.ac.jp
Kazuhisa Ouhara et al.
8
(page number not for citation purpose)
Citation: Journal of Oral Microbiology 2012, 4: 14832 - DOI: 10.3402/jom.v4i0.14832