Tandem repeat markers as novel diagnostic tools for high resolution fingerprinting of Wolbachia.

Abstract

BACKGROUND: Strains of the endosymbiotic bacterium Wolbachia pipientis are extremely diverse both genotypically and in terms of their induced phenotypes in invertebrate hosts. Despite extensive molecular characterisation of Wolbachia diversity, little is known about the actual genomic diversity within or between closely related strains that group tightly on the basis of existing gene marker systems, including Multiple Locus Sequence Typing (MLST). There is an urgent need for higher resolution fingerprinting markers of Wolbachia for studies of population genetics, horizontal transmission and experimental evolution. RESULTS: The genome of the wMel Wolbachia strain that infects Drosophila melanogaster contains inter- and intragenic tandem repeats that may evolve through expansion or contraction. We identified hypervariable regions in wMel, including intergenic Variable Number Tandem Repeats (VNTRs), and genes encoding ankyrin (ANK) repeat domains. We amplified these markers from 14 related Wolbachia strains belonging to supergroup A and were successful in differentiating size polymorphic alleles. Because of their tandemly repeated structure and length polymorphism, the markers can be used in a PCR-diagnostic multilocus typing approach, analogous to the Multiple Locus VNTR Analysis (MLVA) established for many other bacteria and organisms. The isolated markers are highly specific for supergroup A and not informative for other supergroups. However, in silico analysis of completed genomes from other supergroups revealed the presence of tandem repeats that are variable and could therefore be useful for typing target strains. CONCLUSIONS: Wolbachia genomes contain inter- and intragenic tandem repeats that evolve through expansion or contraction. A selection of polymorphic tandem repeats is a novel and useful PCR diagnostic extension to the existing MLST typing system of Wolbachia, as it allows rapid and inexpensive high-throughput fingerprinting of closely related strains for which polymorphic markers were previously lacking.

Full text

Page 1

RESEARCHOpen Access
Tandem repeat markers as novel diagnostic tools
for high resolution fingerprinting of Wolbachia
Markus Riegler1†, Iñaki Iturbe-Ormaetxe2,4†, Megan Woolfit2,4, Wolfgang J Miller3*, Scott L O’Neill2,4*
Abstract
Background: Strains of the endosymbiotic bacterium Wolbachia pipientis are extremely diverse both genotypically
and in terms of their induced phenotypes in invertebrate hosts. Despite extensive molecular characterisation of
Wolbachia diversity, little is known about the actual genomic diversity within or between closely related strains that
group tightly on the basis of existing gene marker systems, including Multiple Locus Sequence Typing (MLST).
There is an urgent need for higher resolution fingerprinting markers of Wolbachia for studies of population
genetics, horizontal transmission and experimental evolution.
Results: The genome of the wMel Wolbachia strain that infects Drosophila melanogaster contains inter- and
intragenic tandem repeats that may evolve through expansion or contraction. We identified hypervariable regions
in wMel, including intergenic Variable Number Tandem Repeats (VNTRs), and genes encoding ankyrin (ANK) repeat
domains. We amplified these markers from 14 related Wolbachia strains belonging to supergroup A and were
successful in differentiating size polymorphic alleles. Because of their tandemly repeated structure and length
polymorphism, the markers can be used in a PCR-diagnostic multilocus typing approach, analogous to the Multiple
Locus VNTR Analysis (MLVA) established for many other bacteria and organisms. The isolated markers are highly
specific for supergroup A and not informative for other supergroups. However, in silico analysis of completed
genomes from other supergroups revealed the presence of tandem repeats that are variable and could therefore
be useful for typing target strains.
Conclusions: Wolbachia genomes contain inter- and intragenic tandem repeats that evolve through expansion or
contraction. A selection of polymorphic tandem repeats is a novel and useful PCR diagnostic extension to the
existing MLST typing system of Wolbachia, as it allows rapid and inexpensive high-throughput fingerprinting of
closely related strains for which polymorphic markers were previously lacking.
Background
Wolbachia pipientis (a-Proteobacteria) is an obligate
endosymbionts of invertebrates, known to infect up to
70% of insect species, as well as spiders, terrestrial crus-
taceans and medically important filarial nematodes
[1-5]. Many strains of Wolbachia found in insects
manipulate their hosts by inducing feminisation, parthe-
nogenesis, male killing or cytoplasmic incompatibility
(CI) [6-9]; in contrast, the Wolbachia of nematodes are
mutualists necessary for host reproduction [10]. Despite
this great diversity of hosts and extended phenotypes, all
strains of Wolbachia are currently recognised as the sin-
gle species W. pipientis. Within this species, strains are
clustered into at least eight divergent clades or ‘super-
groups’, named A to K [11-15].
Several genes have been used for strain typing in Wol-
bachia. Initially, work focused on 16S rDNA[16], the
genes encoding the cell division protein, ftsZ [11] and
the Wolbachia surface protein, wsp [12]. Subsequent to
the demonstration of widespread intra- and intergenic
recombination betweens strains [17-19], two multi-locus
sequence typing (MLST) systems were developed using
different sets of a total of 14 Wolbachia genes [20,21].
The MLST approach uses partial nucleotide sequences
of several ubiquitous loci with moderate rates of
* Correspondence: wolfgang.miller@meduniwien.ac.at; scott.oneill@monash.
edu.au
† Contributed equally
2School of Biological Sciences, The University of Queensland, QLD 4072,
Australia
3Center of Anatomy and Cell Biology, Medical University of Vienna,
Währingerstr. 10, 1090 Vienna, Austria
Full list of author information is available at the end of the article
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
© 2012 Riegler et al; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.

Page 2

evolution to generate an allelic profile for tested strains.
These profiles can be used to type novel isolates, while
the relationships between strains may be inferred on the
basis of either the allelic profiles themselves or the
nucleotide sequences underlying them. MLST data have
been used for both strain typing and evolutionary ana-
lyses of horizontal transfer events between host species
of Wolbachia (e.g. [22,23]). Since most MLST primer
sets cover housekeeping genes that are under purifying
selection, these markers often cannot differentiate
between closely related strains. Such difficulties have
been revealed in the comparisons between wMel,
wMelCS and wMelPop [20] or wMel and wAu within
the ST-13 complex which appear indistinguishable in
MLST loci [21,24]. These strains induce different phe-
notypes in their hosts, i.e. wMel induces CI in Droso-
phila, but wAu does not [25] and wMelPop induces
lifespan reduction in its hosts but not wMel [26-28].
The divergence between MLST typing and actual geno-
mic diversity within ST-13 was also raised when these
closely related strains were compared for presence or
absence of Wolbachia prophage WO-A and WO-B [24]
and other genomic differences such as a large chromo-
somal inversion and differential IS5 insertion sites
between wMel, wMelPop and wMelCS [29,30]. Further-
more, MLST can be time consuming and expensive for
large population genetic studies as it requires sequen-
cing of all MLST loci for many individuals. Recently
other typing systems have been developed for bacteria
that build on markers that contain Variable Number
Tandem Repeats (VNTR). VNTRs consist of units of
DNA (periods) that are tandemly repeated and vary in
copy number between different isolates. These loci can
be used for a PCR-based typing system and are increas-
ingly being utilised in bacterial strain typing such as
Multi Locus VNTR Analysis (MLVA) (e.g. [31-35]).
MLVA offers a number of advantages, including highly
polymorphic markers that allow fine-scale typing of very
closely related isolates, rapid, high-throughput screening
that is not dependent on sequencing, and potentially the
fingerprinting of multiply infected hosts. The modular
structure and evolution of these sites through tandem
expansion and contraction also allows cladistic and phy-
logenetic inference.
Amplicon size polymorphic markers have previously
been identified in Wolbachia genomes and include
transposable element insertion sites [30,36,37], VNTRs
[30,38-40] and genes encoding ankyrin repeat domains
[36], but their efficiency for strain typing has not yet
been compared. In this paper, we used some of these
markers in order to estimate the feasibility of a MLVA
system for Wolbachia. We isolated markers with tandem
repeats from the wMel genome [41] and applied them
to a number of Wolbachia strains from supergroups A,
B and C to assess their applicability and resolution for
Wolbachia strain typing. We chose two types of loci
containing tandem repeats, two intergenic VNTR loci
and two genes encoding proteins containing ankyrin
repeats. The two VNTR loci, VNTR-105 and VNTR-141
were originally isolated from supergroup A strain wMel
and were polymorphic between wMel, wMelCS and
wMelPop isolates from different D. melanogaster lines
[30]. VNTRs are also polymorphic between the closely
related wAu from D. simulans and wWil from Droso-
phila willistoni [38], and serve as highly diagnostic mar-
ker sets for fingerprinting conspecific Wolbachia strains
in the Drosophila paulistorum species cluster [39].
Recently, a polymorphic VNTR locus was isolated from
supergroup B strain wPip [40]. Ankyrin repeat genes are
abundant in the genomes of Wolbachia and a number
of other intracellular bacteria [42,43]. The number and
distribution of these repeats varies substantially between
strains that induce different host phenotypes, suggesting
that they may be involved in host manipulation [36].
We extended our analysis to include a wider range of
Wolbachia strains from supergroup A, B and C in order
to evaluate the usefulness of the four markers VNTR-
105, VNTR-141, WD0550 and WD0766, originally iso-
lated from wMel, in discriminating between Wolbachia
strains.
Methods
Wolbachia strains and hosts
We used 14 supergroup A Wolbachia isolates from 8
different Drosophila species and 2 tephritid species,
Rhagoletis cerasi, a host that is naturally infected, and
Ceratitis capitata, microinjected with Wolbachia origi-
nating from R. cerasi (Table 1). Based on previous
strain typing using 16S rRNA, ftsZ, wsp and some
MLST loci, these 14 strains are moderately or closely
related, yet they reveal different phenotypic character-
istics, such as varying levels of CI induction (strong,
weak, or non-CI inducers), and different CI rescue
phenotypes (reviewed in [44]). Wolbachia DNA was
isolated from Drosophila fly stocks reared on standard
corn-flour-sugar-yeast medium at 25°C. Wolbachia-free
controls D. melanogaster yw67c23T and D. simulans
Riverside-DSRT were established by tetracycline treat-
ment using standard techniques [45]. Wolbachia of R.
cerasi was isolated from field collected samples from
Austria and Hungary [46]. Wolbachia from C. capitata
was isolated from the WolMed 88.6 lab line that was
artificially infected with wCer2 from R. cerasi [47]. We
also included strains from B (wNo, wBol1, wMau) and
C (wDim) supergroups. wNo and wMau were isolated
from D. simulans, wBol1 from Hypolimnas bolina [48]
and wDim from dog heart worm Dirofilaria immitis
[49].
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 2 of 15

Page 3

DNA extraction, PCR amplification and sequencing of
molecular markers
Total genomic DNA was extracted from either freshly
collected specimens or specimens stored in pure ethanol
in a -20°C freezer. Extraction was carried out on pools
of Drosophila flies and single individuals of Rhagoletis,
Ceratitis, Hypolimnas and Dirofilaria. Flies were homo-
genized and extracted following either the Holmes-Bon-
ner protocol [50] or the STE extraction method [16].
Wolbachia markers were amplified from total genomic
DNA using specific primers (Table 2). The wsp gene
was used as a quality control for DNA extraction and
was amplified using the primers 81F and 691R,
described in [12]. PCR cycling conditions were as fol-
lows: 94°C 3 min, (94°C 30 s, 50°C 30 s, 72°C 3 min) x
35 cycles, then 72°C 10 min. The reaction mixture con-
tained 500 nM of each primer, 200 µM dNTPs, 1.5 mM
MgCl2, 100 ng of DNA and 1 unit of Taq Polymerase
(Promega) in a final volume of 20 µl. The reaction buf-
fer contained 10 mM Tris pH 9.0, 50 mM KCl and 0.1%
Triton X-100. PCR products were separated in 1% agar-
ose gels, stained with ethidium bromide and gel-purified
using gel extraction kits (QIAGEN). Purified DNA was
cloned into the pGEM®-T-easy plasmid (Promega) and
sequenced by Macrogen, in Korea, using T7, M13R, and
internal primers, as required. Three independent PCRs
were sequenced for each gene, checked and confirmed
for consistency. Partial sequences of the VNTR-105,
VNTR-141 and the ANK genes WD0550 and WD0766
from different Wolbachia strains have been deposited
GenBank database (Table 3).
Selection of size variable markers
Polymorphic loci were previously identified from the
sequenced genome of wMel of D. melanogaster ([41],
GenBank reference sequence NC_002978) in silico by
using Tandem Repeats Finder TRF (http://tandem.bu.
edu/trf/trf.html) [51]. Two VNTR regions of interest,
VNTR-105andVNTR-141were found to be
Table 1 List of Wolbachia strains.
Strain Supergroup Host Locationmodres Reference
wMel
wMelCS
wMelPop
wAu
wSan
wYak
wTei
wWil
wSpt
wPro
wCer1
wCer2
wCer2
wCer2
wRi
wHa
wNo
wMau
wBol1
wDim
A
A
A
A
A
A
A
A
A
A
A
A
A
A
A
A
B
B
B
C
D. melanogaster
D. melanogaster
D. melanogaster
D. simulans
D. santomea
D. yakuba
D. teissieri
D. willistoni
D. septentriosaltans
D. prosaltans
R. cerasi
R. cerasi
D. simulans
C. capitata
D. simulans
D. simulans
D. simulans
D. simulans
H. bolina
Dirofilaria immitis
USA
CantonS, USA
laboratory strain, USA
Coffs Harbour, Australia
Sao Tome, Africa
Bom Successo, Africa
Bom Successo, Africa
Central and South America
Central and South America
Central and South America
Hungary
Austria
microinjected
microinjected
Riverside, USA
Hawaii, USA
Noumea
microinjected
French Polynesia
Queensland
yes
yes
yes
no
no*
no*
no*
no
n.d.
n.d.
n.d.
yes
yes
yes
yes
yes
yes
no
yes¶
no
yes
yes
yes
no
yes
yes
yes
n.d.
n.d.
n.d.
n.d.
yes
yes
yes
yes
yes
yes
yes
yes¶
no
[75,76]
[30,70]
[26,27]
[25]
[77]
[77]
[77]
[38]
[38]
[38]
[46,61]
[46,61]
[62]
[47]
[16,45]
[16,78]
[79]
[80]
[81]
[49]
Modification/rescue phenotypes are included except for strains for which crossing phenotypes had not been determined (n.d.). Modification corresponds to the
capacity of a strain to induce cytoplasmic incompatibility (CI) through sperm modification whereas rescue corresponds to the capacity to rescue CI in eggs
fertilized by modified sperm [74]. The reference relates to the first description of the strain and/or the phenotype.
* wSan, wYak, wTei do not induce CI in their original hosts, yet can rescue CI induced by other strains [77], and induce CI in novel hosts upon artificial horizontal
transfer through microinjection into D. simulans [23].
¶CI only expressed in host genotypes that are resistant to the expression of male killing induced by wBol1 [48,81]
Table 2 List of primers designed according to the wMel
genome sequence to amplify VNTRs and ANK genes.
Locus/primer5’ sequenceReference
VNTR-141 for
VNTR-141 rev
VNTR-105 for
VNTR-105 rev
RO550F
RO550R
RO766F
RO766R
ggagtattattgatatgcg
gactaaaggttagttgcat
gcaattgaaaatgtggtgcc
atgacaccttacttaaccgtc
ggccaccatgggatcagaatttgaag
gatgacttatacgcagccccatag
gaccaccatgaaatatgacaaattt
tcaagtaagtgctttttctgtc
[30]
[30]
[30]
[30]
[82]
[82]
[82]
[82]
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 3 of 15

Page 4

polymorphic between different lines of D. melanogaster
[30]. The TRF analysis also detected more candidate
loci, including some genes encoding ANK domain
repeats that can also contain tandemly repeated DNA,
and are hence candidate markers for MLVA. Genes
encoding ANK domain repeats were previously anno-
tated [41] and variability was found in supergroup A
and B Wolbachia strains [36]. All of the tandem repeats
analysed here were amplified by using primers designed
for the conserved flanking regions (single copy coding
genes) of the repeats within wMel. We further extended
the TRF analysis to other completed Wolbachia gen-
omes, wRi ([52] NC_012416), wPip ([53] NC_010981)
and wBm ([54] NC_006833) in order to highlight the
potential of MLVA for more distantly related Wolbachia
strains in silico. The TRF analysis also included the gen-
omes of Anaplasma marginale strain St. Maries
(CP_000030) and Ehrlichia ruminantium strain Welge-
vonden (NC_005295) and Neorickettsia risticii strain Illi-
nois (NC_013009), the closest relatives of the genus
Wolbachia [55], as well as a comparison with free living
Escherichia coli K12 substrain MG1655 (NC_000913).
The bacterial genomes were analysed in the basic mode
of TRF (version 4.04), with alignment parameters for
match, mismatch and indels set at 2, 7 and 7, respec-
tively. The minimum alignment score to report repeats
was set at 50, with a maximum period size of 500bp
(Table 4).
Sequence analysis
The analysis and assembly of the sequences was done
using the EditSeq, SeqMan and MegAlign components
of the Lasergene sequence analysis software package
(DNAStar Inc., Madison, Wis.). The sequenced VNTR
loci of the Wolbachia strains had to be manually aligned
because of their long period length, internal repeats,
SNPs and indels within individual VNTR periods.
VNTR periods were searched for internal direct repeats,
palindromic (dyad) repeats and secondary structures by
using DNA Strider [56]. For ANK proteins, domain
architecture was predicted using SMART v3.5 (Simple
Modular Architecture Research Tool) (http://smart.
embl-heidelberg.de/) [57,58] and TMHMM2 (http://
www.cbs.dtu.dk/services/TMHMM/). We analysed the
phylogenetic relationships between individual ANK
repeats from WD0766 and their orthologs to investigate
the mode of evolution of these repeats. All ANK repeats
were extracted from the full length sequences of each
gene and translated into amino acids. Gaps were
inserted where necessary to correct for frameshifts.
Sequences were aligned using T_coffee [59]. Maximum
likelihood phylogenetic analysis of this alignment was
performed using PhyML [60], with a JTT model of
amino acid substitution, and a gamma model of rate
heterogeneity with four rate classes and the gamma
parameter estimated from the data. 1000 bootstrap
replicates were performed.
Results and discussion
VNTR variability between strains of A-group Wolbachia
We isolated sequences for two Wolbachia VNTR loci,
VNTR-141 and VNTR-105, with tandemly repeated per-
iods of 141 and 105bp, respectively, for representative
supergroup A Wolbachia strains. The loci had pre-
viously produced size polymorphic PCR fragments in
isolates of wMel and wMelCS/wMelPop when amplified
using primers that were designed to the flanking regions
of the two VNTR loci of the sequenced wMel genome
[30]. VNTR-141 is positioned between WD0096 and
WD0098, and VNTR-105 is between WD1129 and
WD1131 of the final wMel genome annotation (NCBI
accession NC_002978, [41]). The basic 141bp period of
VNTR-141 consists of the internal 15bp direct repeat A,
a 23bp hairpin with a 9bp palindromic stem, an 18bp
insertion and the internal 15bp direct repeat B (Figure 1
of this paper, and Figure 2E of [38]). Diagnostic VNTR-
141 PCRs were run on DNA obtained from different
Wolbachia hosts known to harbour very closely related
strains of the symbiont that were not clearly distinguish-
able by using MLST [20,21,24]. The VNTR-141 frag-
ments were sequenced and compared to the 141bp
period of wMel. The shortest VNTR-141 alleles were
amplified from wWil and wCer1: they contained only
one single period consisting of a 108bp core period
without the 18bp insertion, and missing the downstream
15bp A repeat. All other supergroup A strains produced
VNTR-141 alleles containing different copy numbers of
the 141bp period (Figure 1), i.e. 0.8 (wWil, amplicon
size using the locus specific primers 387bp, wCer1
Table 3 GenBank accession numbers for VNTR and ANK
sequences.
StrainVNTR-105 VNTR-141
WD0766
wMel
wMelCS
wMelPop
wRi
wAu
wSan
wWil
wSpt
wPro
wCer1
wCer2
wHa
JF797619
JF797618
as wMelCS
n.d.
JF797617
JN191623
JF797616
JF797620
n.d.
JF797615
n.d.
n.d.
JF797613
JF797611
JF797612
n.d.
JF797608
JN191622
JF797607
JF797609
JF797610
JF797606
JF797614
n.d.
NC_002978*
JF683428
JF683429
NC_012416**
AY649753
JF683435
JF683433
JF683431
JF683430
JF683434
JF683432
JF683436
*wMel genome sequence
**wRi genome sequence
n.d. not determined
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 4 of 15

Page 5

388bp), 1.7 (wAu 530bp), 2.3 (wSpt 643bp), 4.3 (wSan
889bp, wPro 925bp; wYak and wTei had similar ampli-
con sizes to wSan but were not sequenced), 6.3
(wMelCS 1189bp, wMelPop 1189bp) and 7.3 (wMel
1330bp, wCer2 1348bp for both original host R. cerasi
and novel host C. capitata) (Figure 1). These poly-
morphic amplicons in VNTR-141 were visualised by
standard PCR as different amplicon sizes on an agarose
gel (Figure 2). Multiply infected R. cerasi [46,61]
revealed two bands, with amplicons representing wCer1
and wCer2 (Figure 2). The VNTR alleles of wCer2 were
assigned through comparisons with the isolates from the
microinjected novel hosts D. simulans [62] and C. capi-
tata [47]. Besides the internal deletions in the wWil and
wCer1 periods, and variation in copy numbers, the
sequence composition of the VNTR-141 periods are
almost identical (i.e. 99%) within wMel and other
strains, and hence highly conserved. For this reason a
phylogenetic sequence analysis, other than the analysis
of repeat numbers in cladistical approaches, is not
informative.
In contrast to VNTR-141, the basic period of VNTR-
105 is 105bp long containing two 23bp hairpins with
9bp palindromic stem structures and one internal short
repeat of 10bp (Figure 3). VNTR-105 of wMel contains
four complete 105bp periods, and two with internal
deletions of 25bp each. wMelCS and wMelPop lack one
of the complete 105bp periods, i.e. contain three com-
plete 105bp copies and two with internal deletions of
32bp (Figure 3). The tested supergroup A strains display
different alleles in the VNTR-105 locus with amplicon
sizes ranging from 3x0.5 copies (wCer1, amplicon size
using the locus specific primers 998bp), 2.5 copies
(wWil 1065bp, wAu 1065bp), 3+2x0.5 copies (wMelCS
and wMelPop 1241bp), 4+2x0.5 copies (wMel 1347bp),
3+4x0.5 copies (wSpt 1408bp) and 5+2x0.5 copies
(wSan, 1476bp; wYak and wTei had similar amplicon
sizes to wSan but were not sequenced). wCer2 had a
large amplicon for this VNTR locus and difficulties were
experienced with accurately sequencing these large loci
because of restrictions with read lengths, as well as pro-
blems in detecting an accurate overlap between forward
and reverse sequences. VNTR-105 amplicon size differ-
ences can be easily resolved on agarose gels (data not
shown). In comparison to VNTR-141, the structure of
the VNTR-105 locus is less conserved within and
between strains because of internal deletions, yet the
period sequences are almost identical (i.e. 98%) within
wMel and between other strains. For this reason a phy-
logenetic analysis of period sequence data is not appro-
priate, whereas the analysis of diagnostic characters
such as copy numbers are more informative (Figure 3).
We extended our PCR analysis to a wider range of
Wolbachia strains, including wRi and wHa, both super-
group A strains that are distantly related to wMel, as
well as strains from supergroup B (wNo, wBol1, wMau)
and C (wDim). None of these strains yielded PCR pro-
ducts for the tested VNTR primers, probably because of
sequence divergence within the primer region or gen-
ome rearrangements [52-54]. Because of the latter it was
not attempted to design primers of conserved coding
regions in distantly related strains.
Evolution of repeats in VNTR loci
The individual periods of VNTR-141 and VNTR-105
respectively display high sequence conservation within
and between strains, with variability in the copy num-
bers and internal deletions within some of the repeated
periods. Two evolutionary processes may be shaping
these loci with high variability in repeat copy numbers
yet small sequence divergence. The accumulation of tan-
demly repeated periods may be facilitated through slip-
page and mispairing in the process of Wolbachia DNA
replication and repair. Slipped-strand mispairing has
previously been identified as a source for generation of
repeat copies in general [63-65] and in E. ruminantium
Table 4 Summary of Tandem Repeats Finder (TRF) analysis.
Straingenome
size genome)
TRTR size in total (% mean TR period size
(range)
mean number of repeats/TR
(range)
mean TR internal match
(%)
wMel
wRi
wPip
wBm
A. m.
E. r.
N. r.
E. coli
1,267,812bp
1,445,904bp
1,482,530bp
1,080,114bp
1,197,687bp
1,516,355bp
879,977bp
4,649,675bp
93
94
72
11
54
201
27
89
20,349bp (1.6%)
16,667bp (1.1%)
13,268bp (0.9%)
1,032bp (0.1%)
8,541bp (0.7%)
95,290bp (6.3%)
5,569bp (0.6%)
17,807bp (0.38%)
80.9bp (10-291)
58.5bp (10-378)
68.5bp (12-399)
42.8bp (3-112)
64.4bp (11-495)
138.7bp (1-471)
68.8bp (9-297)
70.4bp (8-304)
2.7 (1.8-11.8)
2.8 (1.8-8.8)
2.8 (1.8-10.6)
3.3 (1.9-15.7)
2.8 (1.9-11.2)
4.8 (1.8-65.1)
2.9 (1.9-4.9)
3.1 (1.9-12.5)
88.3
87.5
87.9
89.0
91.1
91.6
88.4
90.1
Analysis in basic TRF basic mode included four completed Wolbachia genomes with strain names in bold, wMel (NCBI accession NC_002978), wRi (NC_012416),
wPip (NC_010981) and wBm (NC_006833), and the genomes of Anaplasma marginale (A.m.) strain St. Maries (CP_000030), Ehrlichia ruminantium (E.r.) st.
Welgevonden (NC_005295), Neorickettsia risticii (N.r.) st. Illinois (NC_013009) and Escherichia coli (E. coli) K12 substrain MG1655 (NC_000913). TRF detected several
tandem repeats (TR) within the same genomic regions, as some tandem repeats contain internal repeats; the number of tandem repeats in column three does
hence overrepresent the number of tandem repeat loci in the genome.
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 5 of 15

Page 6

in particular, a genome with an elevated number of tan-
dem repeats [66]. Palindromic sequences with the strong
potential of forming secondary stem loops are well
known to cause slipped-strand mispairing [67]. Hence
we assume that the hairpins present in both Wolbachia
VNTRs may trigger slippage in both these loci. The sec-
ond evolutionary mechanism in action could be
concerted evolution between different periods within the
two loci, a phenomenon that has previously been
observed in members of gene families that tend to be
more similar within a species than between species
because of the elimination or fixation of new point
mutations [68]. The high structural turnover, triggering
expansions and/or contractions of copy numbers in
Figure 1 Schematic presentation of the VNTR-141 locus in ten wMel-like Wolbachia strains of Drosophila and R. cerasi. The complete
141bp period and the core 108bp period are shown as black and grey arrows, respectively; the 23bp hairpin as a lariat; the two 15bp inverted
repeats A and B as dotted and grey boxes, respectively; and the 18bp insertion as a black arrow head.
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 6 of 15

Page 7

both VNTR loci of wMel-like Wolbachia, can thus be
applied for simple and rapid but highly informative sym-
biont fingerprinting by standard PCR (Figure 2). We
cannot infer directionality between expansion and con-
tractions in the evolution of both loci. It is hence impos-
sible to determine whether low copy numbers within the
intergenic loci manifest an ancestral or derived state. It
has been suggested though that tandem repeats go
through cycles of gradual expansion followed by collapse
of repeats [69]. It is hence adequate to state that closely
related strains are more likely to have similar copy num-
bers, e.g. wMel and wMelCS. Interestingly, the CI indu-
cing strains wCer2, wMel and wMelCS contain larger
VNTR loci when compared to the non CI inducing
wWil and wAu, with larger VNTR loci in wMel than
wMelCS that coincide with stronger CI induction in
wMel than wMelCS [70]. Furthermore increased copy
numbers in one locus correspond with increased copy
numbers in the second. Such a coincidence of intergenic
tandem repeat variation with CI phenotype was also
observed for supergroup B Wolbachia in C. pipiens[40].
Yet, these observations are not sufficiently supported by
replication to conclude about any potential links
between genotypes and phenotypes, but they warrant
further structural and functional studies of the VNTR
repeat expansions.
ANK gene variability between strains of A-group
Wolbachia
Unlike most bacteria, genes that encode proteins with
ANK repeats are extremely abundant in Wolbachia,
representing up to 2-4% of the total number of genes in
wMel [41], wRi [52] and wPip [53,71]. Some of the
variability in these genes appears to correlate with cross-
ing types in mosquitoes [72]. Several of the 23 ANK
genes initially annotated in the wMel genome are highly
variable between the CI-inducing strain wMel and the
non-CI inducing related strain wAu [36]. These differ-
ences included point mutations, frameshifts and prema-
ture stop codons, presence/absence of transmembrane
domains, disruption by insertion elements and variability
in the number of predicted ANK repeats in the encoded
proteins.
Based on earlier work [36], we performed an initial
PCR screening (data not shown) using the most variable
wMel ANK genes (WD0035, WD0294, WD0385,
WD0498, WD0514, WD0550, WD0636, WD0766 and
WD1213- also see results of TRF analysis below) in
order to look for size differences across the Wolbachia
strains used in this study. Some of the ANK genes could
not be amplified in all strains, probably due to sequence
divergence. For the ones that could be amplified, the
non-phage related ANK genes WD0550 and in
Figure 2 Diagnostic size difference for the VNTR-141 locus of Wolbachia. Lane 1: wCer1 and wCer2 doubly infected R. cerasi from Austria
(the two arrows indicate the two faint bands for wCer1 and wCer2); 2-4: wWil infected D. willistoni from populations collected recently in
Panama (Pan98), Mexico (Apa), and Equador (JS); lane 5-6: wAu infected D. simulans strain Coffs Harbor and Yaunde 6; lane 7: uninfected
(tetracycline treated) controls = D. melanogaster yw67c23T; lane 8: wTei infected D. teissieri GN53; lane 9: wMel infected D. melanogaster yw67c23;
lane 10: wSpt infected D. septentriosaltans; lane 11: wCer1 singly infected R. cerasi from Hungary; lane 12: uninfected (tetracycline treated)
control = D. melanogaster line yw67c23T; lane 13: wMel infected D. melanogaster yw67c23; lane 14: wMelCS infected D. melanogaster Canton S.
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 7 of 15

Page 8

particular WD0766 were found to be the most variable
in terms of size difference among the Wolbachia strains
and they were selected for further analysis, with
sequence data reported for WD0766 only.
In wMel, WD0766 encodes a 51.8kDa protein con-
taining eight ANK repeats and two transmembrane
domains (TMDs) in the C-terminus. When this gene
was sequenced in several Wolbachia strains, the
number of predicted ANK repeats was found to be
quite different among them, ranging from eight repeats
in wMel to 14 in wCer1 (Figure 4). The wAu, wWil
and wRi strains contained 11 ANK repeats, but the
proteins were truncated by a premature stop codon
that resulted in the elimination of the predicted TMDs
in wAu and wWil. WD0766 in wSan is disrupted by a
premature stop after the seventh ANK domain and
Figure 3 Schematic presentation of the VNTR-105 locus in seven wMel-like Wolbachia strains of Drosophila. The complete 105bp period
is shown as black arrows; the two 23bp hairpins A and B as full and empty lariats, respectively; the 15bp inverted repeat as grey boxes; and
deleted sections in grey.
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 8 of 15

Page 9

contains a 918bp IS5 insertion element in the middle
of its 10thANK repeat (Figure 4). PCR results (data
not shown) suggest that this IS5 insertion is also pre-
sent in the orthologous gene in wYak and wTei, but
these amplicons were not sequenced. The sequence of
the wSan IS5 element is identical to that of the 13 IS5
elements present in the wMel genome [41]. Disruption
of a Wolbachia ANK gene by an IS5 insertion element
has previously been observed in the WD0385 gene
from wAu (GenBank AY664873) [36], although in this
case the insertion sequence differs by 5 nucleotides
from the wMel and wSan IS5 elements. wSpt, wCer2
and wHa strains had the same structure for the
WD0766 proteins (13 ANK domains + 2 TMDs),
whereas the wCer1 protein contained 14 ANK domains
and 2 TMDs.
WD0550 was also found to be variable among the
strains analysed, although it was not as informative as
WD0766. For this reason only a subset of strains was
analysed for this locus in more detail. WD0550 codes
for a 36.4kDa protein containing six predicted ANK
repeats and has no TMDs. The protein contains six
ANK repeats in wMel and wSpt, and eight repeats in
wMelCS, wSan, wCer2, wAu and wWil (data not
shown).
Evolution of repeats in WD0766
Orthologs of WD0766 encode for proteins containing
different numbers of ANK repeats in different Wolba-
chia strains. Additional repeat copies may be gained by
the duplication or loss of single or multiple repeats, and
genes containing these repeats may also diverge due to
Figure 4 Domain architecture of the WD0766 ANK domain protein in Wolbachia strains. The location of ANK motifs (coloured boxes with
numbers) was determined using SMART v3.5 (http://smart.embl-heidelberg.de/). Transmembrane domains (black boxes) were predicted using
the TMHMM2 server. The presence of a frameshift in the wAu and wWil WD0766 gene creates a premature stop (*) that prevents the translation
of the transmembrane domains. The wSan, wYak and wTei genes also contain a premature stop (*) that prevents the translation of 6 ANK
domains and two transmembrane domains. These genes also contain an IS5 element insertion inside the 10thANK domain. Some of the ANK
repeat motifs are duplicated (d). The colour scheme corresponds to the DNA sequence similarity of the ANK repeat motifs (Figure 5).
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 9 of 15

Page 10

loss or shuffling of repeat periods. To investigate the
patterns of change in the number and order of ANK
repeats in these proteins, we aligned the amino acid
sequences of all individual repeats and performed a
maximum likelihood analysis of the phylogenetic rela-
tionships between them (Figure 5). The tree shows clus-
ters of typically six to ten repeats, separated by relatively
long internal branches. Despite the large ratio of inter-
nal to tip branch lengths, bootstrap values on this tree
are almost all extremely small, probably due to the short
length of the alignment (34 residues). However, a clear
pattern is observed wherein repeats in similar positions
within multiple orthologs cluster together. For example,
the first ANK repeat present in every ortholog clusters
in a single clade, marked in yellow in Figures 4 and 5. A
similar clustering is seen for the last repeat of every
ortholog (marked in green), and for the second repeat
in wMel and wMelPop/wMelCS with the fourth repeat
of all other orthologs (marked in blue). Figure 4 shows
the structure of each ortholog, with repeats that cluster
Figure 5 Maximum likelihood phylogeny of individual ANK repeats from WD0766 and its orthologs. Names indicate the strain of
Wolbachia and the repeat number, as labelled in Figure 4. The scale bar corresponds to nucleotide substitutions per site.
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 10 of 15

Page 11

together in the tree coloured in the same shade. Similar
to VNTRs, ANK loci of Wolbachia provide highly infor-
mative and strain-specific marker sets that allow easy
separation via PCR and high-resolution diagnosis of
host infections (Figure 6).
A number of inferences about the evolution of the
ANK repeats in these genes can be drawn from the tree
in Figure 5 and the mapping of the phylogenetic data
onto the modular structure of the genes. First, it is likely
that the ancestral copy of this gene at the base of super-
group A already contained most of the repeats seen
today, probably in a very similar linear order. Most of
the clusters in the tree contain repeats from 7 or more
of the orthologs, and the order of these orthologous
repeats along the genes is highly similar. There is only
one clear example of repeat shuffling: the eighth and
ninth repeats in the wPro/wSan/wAu groups occur in
the reverse order in wCer1 (as repeat periods 10 and 9),
while wHa may represent an intermediate stage, with
the repeats orthologous to wPro 8 and 9 followed by a
second copy of a repeat orthologous to wPro 8. Sec-
ondly, at least some variation in repeat number is due
to lineage-specific tandem duplication of a single repeat
(e.g. repeats 7 and 8 in wCer1) or of multiple repeats
(repeats 3-4 and 5-6 in wMel).
Extension of MLVA markers to other Wolbachia
supergroups
In comparison to the MLST markers, the highly poly-
morphic markers used here have a major trade-off in
the loss of universal applicability for all Wolbachia
strains. Here we have focused on Wolbachia supergroup
A and tested the primers of these markers in other
supergroups but primers did not amplify the loci or the
loci were not informative. The presence of VNTR loci
was restricted to subsets of supergroup A while genes
containing ANK domain repeats were found in all
supergroup A strains. In silico analysis of three other
completed genomes, wRi, wPip and wBm of supergroups
A, B and D, respectively, revealed though that tandem
repeated regions occur throughout these supergroups
and may be of relevance for MLVA in other super-
groups. As further genome data become available it will
be possible to extend this to an even larger group of
Wolbachia isolates. A TRF analysis of wMel revealed 93
sites with direct tandem repeats of periods ranging from
10bp to 291bp, with internal match percentages from
68% to 100% (Table 4). The larger wRi genome has a
similar number of tandem repeats while wPip has a
smaller set of tandem repeats. The tandem repeats of
wMel, wRi and wPip have similar characteristics such as
Figure 6 Diagnostic size polymorphism of the WD0766 gene. Isolates include Wolbachia of D. melanogaster (wMel, wMelCS), D. willistoni
(wWil), D. prosaltans (wPro), D. septentriosaltans (wSpt) and D. simulans transinfected with Wolbachia from R. cerasi (wCer2).
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 11 of 15

Page 12

comparable period sizes, copy numbers as well as inter-
nal match ratios (Table 4). The number of tandem
repeats in wBm is reduced by a factor of 10 when com-
pared with the supergroup A and B Wolbachia, and the
tandem periods appear to be shorter. This reduction in
wBm is in accordance with the earlier described higher
rate of secondary genome reduction in this strain [54].
Within the group of the closest relatives of the genus
Wolbachia, the sequence of E. ruminantium revealed
the highest content of tandem repeats for bacteria
reported so far (Table 4), with size polymorphism in
tandem repeats within the isolate that was used for gen-
ome sequencing the genome [66]. Our in silico analysis
predicted the presence of variable tandem repeat mar-
kers in supergroup A strains and could hence readily be
developed and tested on Wolbachia isolates from other
supergroups. Highly polymorphic markers will be useful
in population dynamic and population genetic studies
similar to the ones undertaken in wMel-like strains
[30,38,39]. We have not analysed the unfinished genome
data sets of Wolbachia (e.g. [73]). A large proportion of
tandem repeats are located in intergenic regions that
tend to be assembled in genome sequencing projects
last, yet their conserved flanking regions are required
for the isolation of VNTR markers from total genomic
extracts. A polymorphic VNTR locus has recently been
reported for a supergroup B strain after applying a simi-
lar approach to wPip isolated from different C. pipiens
populations [40].
Interestingly, our TRF analysis only detected five ANK
repeat regions (WD0294, WD0385, WD0514, WD0550
and WD0766) of the 23 annotated genes encoding ANK
repeat domains. Coincidentally, this group of genes
includes the most variable genes encoding ANK repeat
domains, suggesting that repeat extension/contraction is
a strong diversifying mechanism in these genes.
Most of the primers designed for wMel ANK genes
amplified expected PCR amplicons from supergroup A
Wolbachia, but not from the majority of supergroup B,
probably due to sequence divergence [36]. ANK domain
genes are known to be present in other Wolbachia
groups. In the B group mosquito strain wPip that infects
mosquitoes there are 60 genes encoding ANK repeats,
some of them also variable [53,71,72], whereas the fully
sequenced D group wBm strain that infects the nema-
tode Brugia malayi contains 5 ANK genes and 7 related
pseudogenes [54]. Although wMel ANK genes were
used as a reference in our study, another A group Wol-
bachia strain, wRi, contains 35 ANK genes, some of
them very distinct from the wMel genes, probably as a
result of duplications and recombination events [52].
Partial sequences of other A group strains have also
revealed high numbers of ANK genes [73]. Thus, it
seems clear that ANK genes are a signature feature in
Wolbachia that can be potentially utilised to fingerprint
closely related strains in A and other groups.
Conclusion
The identification of amplicon size polymorphic mar-
kers of Wolbachia provides a valuable addition to exist-
ing typing systems such as MLST, for the following
three reasons: (1) The MLVA markers presented here
display higher rates of evolution than the MLST loci,
which are conserved protein encoding genes. Using
MLVA, Wolbachia strains clustered in the same groups
as in MLST typing, yet with a higher resolution that
could be useful for different types of questions that
MLST has not yet been able to target. These questions
include the study of Wolbachia population genetics
within infected species [30,38,39], and will further
extend studies of horizontal transmission between host
species for which MLST was originally developed [22].
Highly polymorphic markers will also be useful for
experimental evolution of Wolbachia in order to track
small genomic changes in short time frames. This
higher resolution comes with the cost though, that mar-
kers are not universally applicable to the entire diversity
of Wolbachia. (2) The majority of Wolbachia genomes
are dotted with many different repeat regions which are
highly appropriate to be targeted for the isolation of
possible polymorphic markers. Tandem repeat markers
such as the ones developed here can be tailored to indi-
vidual studies. (3) MLVA markers are ideal for rapid
and high-throughput DNA fingerprinting, as no sequen-
cing is required. The markers are ideal to detect multi-
ple infections in single PCR reactions if strains contain
alleles with variable amplicon sizes. Our analysis of the
evolution of the tandem repeat regions shows that they
evolve by gain or loss of repeats. The variability in the
number of ANK repeats, generally constituted by 33
amino acids each, creates size differences that are multi-
ples of 99bp and, like VNTRs consisting of >100bp peri-
ods, can be clearly identified following simple PCR
screenings without the need of initial sequencing or
RFLP analyses as in the case of point mutations. The
use of 2-3 highly variable markers per strain can gener-
ate easily readable fingerprints.
List of abbreviations used
CI: cytoplasmic incompatibility; MLVA: multiple locus variable number
tandem repeat analysis; MLST: multiple locus sequence typing; VNTR:
variable number tandem repeat; ANK: ankyrin domain; TRF: tandem repeats
finder.
Acknowledgements
We thank Sylvain Charlat, Kostas Bourtzis and the School of Veterinary
Science, UQ, for supplying biological material, i.e. H. bolina, C. capitata and
D. immitis, respectively. We thank the special edition editor Greg Hurst and
two anonymous reviewers for their valuable comments. The research was
supported by grants of the Australian Research Council ARC to MR, IIO, MW
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 12 of 15

Page 13

and SLO, and from COST Action FA-0701 and the research grant P22634-B17
of the Austrian Science Fund FWF to WJM.
This article has been published as part of BMC Microbiology Volume 11
Supplement 1, 2012: Arthropod symbioses: from fundamental studies to pest
and disease mangement. The full contents of the supplement are available
online at http://www.biomedcentral.com/1471-2180/12?issue=S1.
Author details
1Hawkesbury Institute for the Environment, University of Western Sydney,
Locked Bag 1797, Penrith NSW 2751 Australia.2School of Biological Sciences,
The University of Queensland, QLD 4072, Australia.3Center of Anatomy and
Cell Biology, Medical University of Vienna, Währingerstr. 10, 1090 Vienna,
Austria.4School of Biological Sciences, Monash University, Clayton, VIC 3800,
Australia.
Authors’ contribution
MR, IIO, WJM and SLO had the initial idea for this manuscript. MR, IIO, WJM
and SLO designed the study. MR, IIO and WJM performed laboratory work.
MR, IIO, WJM, MW performed data analysis. MR, IIO, WJM, MW and SLO
wrote the manuscript. All authors approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Published: 18 January 2012
References
1.Werren JH, Windsor D, Guo LR: Distribution of Wolbachia among
neotropical arthropods. Proceedings of the Royal Society of London Series B-
Biological Sciences 1995, 262(1364):197-204.
2. West SA, Cook JM, Werren JH, Godfray HCJ: Wolbachia in two insect host-
parasitoid communities. Molecular Ecology 1998, 7(11):1457-1465.
3.Jeyaprakash A, Hoy MA: Long PCR improves Wolbachia DNA
amplification: wsp sequences found in 76% of sixty-three arthropod
species. Insect Molecular Biology 2000, 9(4):393-405.
4.Hilgenboecker K, Hammerstein P, Schlattmann P, Telschow A, Werren JH:
How many species are infected with Wolbachia? - A statistical analysis
of current data. FEMS Microbiology Letters 2008, 281(2):215-220.
5.Arthofer W, Riegler M, Avtzis DN, Stauffer C: Evidence for low-titre
infections in insect symbiosis: Wolbachia in the bark beetle Pityogenes
chalcographus (Coleoptera, Scolytinae). Environmental Microbiology 2009,
11(8):1923-1933.
6.O’Neill SL, Hoffmann AA, Werren JH: Influential passengers. Inherited
microorganisms and arthropod reproduction. Oxford: Oxford University
Press; 1997.
7.Stouthamer R, Breeuwer JAJ, Hurst GDD: Wolbachia pipientis: microbial
manipulator of arthropod reproduction. Annual Review of Microbiology
1999, 53:71-102.
8.Werren JH, Baldo L, Clark ME: Wolbachia: Master manipulators of
invertebrate biology. Nature Reviews Microbiology 2008, 6(10):741-751.
9. Schneider D, Miller WJ, Riegler M: Arthropods shopping for Wolbachia. In
Manipulative Tenants Bacteria associated with arthropods. Boca Raton: CRC
Press;Zchori-Fein E, Bourtzis K 2011:149-173.
10.Taylor MJ, Bandi C, Hoerauf A: Wolbachia bacterial endosymbionts of
filarial nematodes. Adv Parasitol 2005, 60:245-284.
11.Werren JH, Zhang W, Guo LR: Evolution and phylogeny of Wolbachia -
reproductive parasites of arthropods. Proceedings of the Royal Society of
London Series B-Biological Sciences 1995, 261(1360):55-63.
12.Zhou WG, Rousset F, O’Neill S: Phylogeny and PCR-based classification of
Wolbachia strains using wsp gene sequences. Proceedings of the Royal
Society of London Series B-Biological Sciences 1998, 265(1395):509-515.
13.Lo N, Paraskevopoulos C, Bourtzis K, O’Neill SL, Werren JH, Bordenstein SR,
Bandi C: Taxonomic status of the intracellular bacterium Wolbachia
pipientis. International Journal of Systematic and Evolutionary Microbiology
2007, 57(3):654-657.
14.Baldo L, Werren JH: Revisiting Wolbachia supergroup typing based on
wsp: spurious lineages and discordance in MLST. Current Microbiology
2007, 55(1):81-87.
15.Ros VID, Fleming VM, Feil EJ, Breeuwer JAJ: How diverse is the genus
Wolbachia? Multiple-gene sequencing reveals a putatively new
Wolbachia supergroup recovered from spider mites (Acari:
Tetranychidae). Applied and Environmental Microbiology 2009,
75(4):1036-1043.
O’Neill SL, Giordano R, Colbert AME, Karr TL, Robertson HM: 16S ribosomal
RNA phylogenetic analysis of the bacterial endosymbionts associated
with cytoplasmic incompatibility in insects. Proceedings of the National
Academy of Sciences of the United States of America 1992, 89(7):2699-2702.
Jiggins FM, von der Schulenburg JHG, Hurst GDD, Majerus MEN:
Recombination confounds interpretations of Wolbachia evolution.
Proceedings of the Royal Society of London Series B-Biological Sciences 2001,
268(1474):1423-1427.
Jiggins FM: The rate of recombination in Wolbachia bacteria. Molecular
Biology and Evolution 2002, 19(9):1640-1643.
Baldo L, Bordenstein S, Wernegreen JJ, Werren JH: Widespread
recombination throughout Wolbachia genomes. Molecular Biology and
Evolution 2006, 23(2):437-449.
Paraskevopoulos C, Bordenstein SR, Wernegreen JJ, Werren JH, Bourtzis K:
Toward a Wolbachia multilocus sequence typing system: Discrimination
of Wolbachia strains present in Drosophila species. Current Microbiology
2006, 53(5):388-395.
Baldo L, Hotopp JCD, Jolley KA, Bordenstein SR, Biber SA, Choudhury RR,
Hayashi C, Maiden MCJ, Tettelin H, Werren JH: Multilocus sequence typing
system for the endosymbiont Wolbachia pipientis. Applied and
Environmental Microbiology 2006, 72(11):7098-7110.
Baldo L, Ayoub NA, Hayashi CY, Russell JA, Stahlhut JK, Werren JH: Insight
into the routes of Wolbachia invasion: High levels of horizontal transfer
in the spider genus Agelenopsis revealed by Wolbachia strain and
mitochondrial DNA diversity. Molecular Ecology 2008, 17(2):557-569.
Zabalou S, Apostolaki A, Pattas S, Veneti Z, Paraskevopoulos C, Livadaras I,
Markakis G, Brissac T, Merçot H, Bourtzis K: Multiple rescue factors within a
Wolbachia strain. Genetics 2008, 178(4):2145-2160.
Ishmael N, Hotopp JCD, Loanidis P, Biber S, Sakamoto J, Siozios S, Nene V,
Werren J, Boutriz K, Bordenstein SR, et al: Extensive genomic diversity of
closely related Wolbachia strains. Microbiology 2009, 155(7):2211-2222.
Hoffmann AA, Clancy D, Duncan J: Naturally-occurring Wolbachia
infection in Drosophila simulans that does not cause cytoplasmic
incompatibility. Heredity 1996, 76:1-8.
Min KT, Benzer S: Wolbachia, normally a symbiont of Drosophila, can be
virulent, causing degeneration and early death. Proceedings of the
National Academy of Sciences of the United States of America 1997,
94(20):10792-10796.
McGraw EA, Merritt DJ, Droller JN, O’Neill SL: Wolbachia density and
virulence attenuation after transfer into a novel host. Proceedings of the
National Academy of Sciences of the United States of America 2002,
99(5):2918-2923.
McMeniman CJ, Lane RV, Cass BN, Fong AWC, Sidhu M, Wang YF,
O’Neill SL: Stable introduction of a life-shortening Wolbachia infection
into the mosquito Aedes aegypti. Science 2009, 323(5910):141-144.
Sun LV, Riegler M, O’Neill SL: Development of a physical and genetic map
of the virulent Wolbachia strain wMelPop. Journal of Bacteriology 2003,
185(24):7077-7084.
Riegler M, Sidhu M, Miller WJ, O’Neill SL: Evidence for a global Wolbachia
replacement in Drosophila melanogaster. Current Biology 2005,
15:1428-1433.
Achtman M, Morelli G, Zhu P, Wirth T, Diehl I, Kusecek B, Vogler AJ,
Wagner DM, Allender CJ, Easterday WR, et al: Microevolution and history
of the plague bacillus, Yersinia pestis. Proceedings of the National Academy
of Sciences of the United States of America 2004, 101(51):17837-17842.
Pourcel C, André-Mazeaud F, Neubauer H, Ramisse F, Vergnaud G: Tandem
repeats analysis for the high resolution phylogenetic analysis of Yersinia
pestis. BMC Microbiology 2004, 4.
Johansson A, Farlow J, Larsson P, Dukerich M, Chambers E, Byström M,
Fox J, Chu M, Forsman M, Sjöstedt A, et al: Worldwide genetic
relationships among Francisella tularensis isolates determined by
multiple-locus variable-number tandem repeat analysis. Journal of
Bacteriology 2004, 186(17):5808-5818.
Yazdankhah SP, Lindstedt BA: Variable number tandem repeat typing of
bacteria. In Comparative Genomics Methods in Molecular Biolgy. Volume 396.
Totowa, NJ: Humana Press;Bergman NH 2007:395-405.
Vergnaud G, Pourcel C: Multiple locus variable number of tandem
repeats analysis. Methods in molecular biology (Clifton, NJ) 2009,
551:141-158.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 13 of 15

Page 14

36.Iturbe-Ormaetxe I, Burke GR, Riegler M, O’Neill SL: Distribution, expression,
and motif variability of ankyrin domain genes in Wolbachia pipientis.
Journal of Bacteriology 2005, 187:5136-5145.
Duron O, Lagnel J, Raymond M, Bourtzis K, Fort P, Weill M: Transposable
element polymorphism of Wolbachia in the mosquito Culex pipiens:
evidence of genetic diversity, superinfection and recombination.
Molecular Ecology 2005, 14(5):1561-1573.
Miller WJ, Riegler M: Evolutionary dynamics of wAu-like Wolbachia
variants in neotropical Drosophila spp. Applied and Environmental
Microbiology 2006, 72(1):826-835.
Miller WJ, Ehrman L, Schneider D: Infectious speciation revisited: Impact
of symbiont-depletion on female fitness and mating behavior of
drosophila paulistorum. PLoS Pathogens 2010, 6(12).
Petridis M, Chatzidimitriou D: Characterization of an intergenic
polymorphic site (pp-hC1A_5) in Wolbachia pipientis (wPip). Molecular
Ecology Resources 2011, 11(4):753-756.
Wu M, Sun LV, Vamathevan J, Riegler M, Deboy R, Brownlie JC, McGraw EA,
Martin W, Esser C, Ahmadinejad N, et al: Phylogenomics of the
reproductive parasite Wolbachia pipientis wMel: a streamlined genome
overrun by mobile genetic elements. Public Library of Science Biology 2004,
2(3):327-341.
Mosavi LK, Cammett TJ, Desrosiers DC, Peng ZY: The ankyrin repeat as
molecular architecture for protein recognition. Protein Science 2004,
13(6):1435-1448.
Pan X, Lührmann A, Satoh A, Laskowski-Arce MA, Roy CR: Ankyrin repeat
proteins comprise a diverse family of bacterial type IV effectors. Science
2008, 320(5883):1651-1654.
Merçot H, Poinsot D: Infection by Wolbachia: from passengers to
residents. Comptes Rendus - Biologies 2009, 332(2-3):284-297.
Hoffmann AA, Turelli M, Simmons GM: Unidirectional incompatibility
between populations of Drosophila simulans. Evolution 1986, 40:692-701.
Riegler M, Stauffer C: Wolbachia infections and superinfections in
cytoplasmically incompatible populations of the European cherry fruit
fly Rhagoletis cerasi (Diptera, Tephritidae). Molecular Ecology 2002,
11(11):2425-2434.
Zabalou S, Riegler M, Theodorakopoulou M, Stauffer C, Savakis C, Bourtzis K:
Wolbachia-induced cytoplasmic incompatibility as a means for insect
pest population control. Proceedings of the National Academy of Sciences of
the United States of America 2004, 101:15042-15045.
Dyson EA, Hurst GD: Persistence of an extreme sex-ratio bias in natural
population. Proceedings of the National Academy of Sciences USA 2004,
101:6520-6523.
Sironi M, Bandi C, Sacchi L, DiSacco B, Damiani G, Genchi C: Molecular
evidence for a close relative of the arthropod endosymbiont Wolbachia
in a filarial worm. Molecular and Biochemical Parasitology 1995,
74(2):223-227.
Holmes DS, Bonner J: Preparation, molecular weight, base composition
and secondary structure of giant nuclear ribonucleic acid. Biochemistry
1973, 12(12):2330-2338.
Benson G: Tandem repeats finder: a program to analyse DNA sequences.
Nucleic Acid Research 1999, 27(2):573-580.
Klasson L, Westberg J, Sapountzis P, Näslund K, Lutnaes Y, Darby AC,
Veneti Z, Chen L, Braig HR, Garrett R, et al: The mosaic genome structure
of the Wolbachia wRi strain infecting Drosophila simulans. Proceedings of
the National Academy of Sciences of the United States of America 2009,
106(14):5725-5730.
Klasson L, Walker T, Sebaihia M, Sanders MJ, Quail MA, Lord A, Sanders S,
Earl J, O’Neill SL, Thomson N, et al: Genome evolution of Wolbachia strain
wPip from the Culex pipiens group. Molecular Biology and Evolution 2008,
25(9):1877-1887.
Foster J, Ganatra M, Kamal I, Ware J, Makarova K, Ivanova N,
Bhattacharyya A, Kapatral V, Kumar S, Posfai J, et al: The Wolbachia
genome of Brugia malayi: endosymbiont evolution within a human
pathogenic nematode. Public Library of Science Biology 2005, 3(4):e121.
Riegler M, O’Neill SL: The genus Wolbachia. In The Prokaryotes: A handbook
on the biology of bacteria. Volume 5. New York: Springer;Dworkin M, Falkow
S, Rosenberg E, Schleifer KH, Stackebrandt E 2006:547-561, Proteobacteria:
Alpha and Beta Subclass.
Douglas SE: DNA strider - an inexpensive sequence analysis package for
the Macintosh. Molecular Biotechnology 1995, 3(1):37-45.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.Letunic I, Copley RR, Schmidt S, Ciccarelli FD, Doerks T, Schultz J,
Ponting CP, Bork P: SMART 4.0: towards genomic data integration. Nucleic
Acids Research 2004, 32(DATABASE ISS.):D142-D144.
Schultz J, Milpetz F, Bork P, Ponting CP: SMART, a simple modular
architecture research tool: identification of signaling domains.
Proceedings of the National Academy of Sciences of the United States of
America 1998, 95(11):5857-5864.
Notredame C, Higgins DG, Heringa J: T-coffee: a novel method for fast
and accurate multiple sequence alignment. Journal of Molecular Biology
2000, 302(1):205-217.
Guindon S, Gascuel O: A simple, fast, and accurate algorithm to estimate
large phylogenies by maximum likelihood. Systematic Biology 2003,
52(5):696-704.
Arthofer W, Riegler M, Schneider D, Krammer M, Miller WJ, Stauffer C:
Hidden Wolbachia diversity in field populations of the European cherry
fruit fly, Rhagoletis cerasi (Diptera, Tephritidae). Molecular Ecology 2009,
18(18):3816-3830.
Riegler M, Charlat S, Stauffer C, Merçot H: Wolbachia transfer from
Rhagoletis cerasi to Drosophila simulans: investigating the outcomes of
host-symbiont coevolution. Applied and Environmental Microbiology 2004,
70(1):273-279.
Levinson G, Gutman GA: High frequencies of short frameshifts in poly-
CA/TG tandem repeats borne by bacteriophage M13 in Escherichia coli
K-12. Nucleic Acids Research 1987, 15(13):5323-5338.
Pâques F, Leung WY, Haber JE: Expansions and contractions in a tandem
repeat induced by double-strand break repair. Molecular and Cellular
Biology 1998, 18(4):2045-2054.
Rocha EPC: DNA repeats lead to the accelerated loss of gene order in
bacteria. Trends in Genetics 2003, 19(11):600-603.
Collins NE, Liebenberg J, De Villiers EP, Brayton KA, Louw E, Pretorius A,
Faber FE, Van Heerden H, Josemans A, Van Kleef M, et al: The genome of
the heartwater agent Ehrlichia ruminantium contains multiple tandem
repeats of actively variable copy number. Proceedings of the National
Academy of Sciences of the United States of America 2005, 102(3):838-843.
Weitzmann MN, Woodford KJ, Usdin K: DNA secondary structures and the
evolution of hypervariable tandem arrays. Journal of Biological Chemistry
1997, 272(14):9517-9523.
Dover G: Molecular drive: A cohesive mode of species evolution. Nature
1982, 299(5879):111-117.
Amos W: A comparative approach to the study of microsatellite
evolution. In Microsatellites Evolution and Applications. Oxford: Oxford
University Press;Goldstein DB, Schlötterer C 1999:66-79.
Yamada R, Floate KD, Riegler M, O’Neill SL: Male development time
influences the strength of Wolbachia-induced cytoplasmic
incompatibility expression in Drosophila melanogaster. Genetics 2007,
177(2):801-808.
Walker T, Klasson L, Sebaihia M, Sanders MJ, Thomson NR, Parkhill J,
Sinkins SP: Ankyrin repeat domain-encoding genes in the wPip strain of
Wolbachia from the Culex pipiens group. BMC Biology 2007, 5.
Sinkins SP, Walker T, Lynd AR, Steven AR, Makepeace BL, Godfray HC,
Parkhill J: Wolbachia variability and host effects on crossing type in Culex
mosquitoes. Nature 2005, 436:257-260.
Salzberg SL, Hotopp JC, Delcher AL, Pop M, Smith DR, Eisen MB,
Nelson WC: Serendipitous discovery of Wolbachia genomes in multiple
Drosophila species. Genome Biology 2005, 6(3):R23.
Werren JH: Biology of Wolbachia. Annual Review of Entomology 1997,
42:587-609.
Hoffmann AA: Partial cytoplasmic incompatibility between two Australian
populations of Drosophila melanogaster. Entomologia Experimentalis Et
Applicata 1988, 48:61-67.
Reynolds KT, Hoffmann AA: Male age, host effects and the weak
expression or nonexpression of cytoplasmic incompatibility in
Drosophila strains infected by maternally transmitted Wolbachia.
Genetical Research 2002, 80(2):79-87.
Zabalou S, Charlat S, Nirgianaki A, Lachaise D, Merçot H, Bourtzis K: Natural
Wolbachia infections in the Drosophila yakuba species complex do not
induce cytoplasmic incompatibility but fully rescue the wRi modification.
Genetics 2004, 167(2):827-834.
O’Neill SL, Karr TL: Bidirectional incompatibility between conspecific
populations of Drosophila simulans. Nature 1990, 348:178-180.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 14 of 15

Page 15

79.Merçot H, Llorente B, Jacques M, Atlan A, Montchampmoreau C: Variability
within the Seychelles cytoplasmic incompatibility system in Drosophila
simulans. Genetics 1995, 141(3):1015-1023.
Giordano R, O’Neill SL, Robertson HM: Wolbachia infections and the
expression of cytoplasmic incompatibility in Drosophila sechellia and D.
mauritiana. Genetics 1995, 140(4):1307-1317.
Hornett EA, Duplouy AMR, Davies N, Roderick GK, Wedell N, Hurst GDD,
Charlat S: You can’t keep a good parasite down: evolution of a male-
killer suppressor uncovers cytoplasmic incompatibility. Evolution 2008,
62(5):1258-1263.
Yamada R, Iturbe-Ormaetxe I, Brownlie JC, O’Neill SL: Functional test of the
influence of Wolbachia genes on cytoplasmic incompatibility expression
in Drosophila melanogaster. Insect Molecular Biology 2011, 20(1):75-85.
80.
81.
82.
doi:10.1186/1471-2180-12-S1-S12
Cite this article as: Riegler et al.: Tandem repeat markers as novel
diagnostic tools for high resolution fingerprinting of Wolbachia. BMC
Microbiology 2012 12(Suppl 1):S12.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Riegler et al. BMC Microbiology 2012, 12(Suppl 1):S12
http://www.biomedcentral.com/1471-2180/12/S1/S12
Page 15 of 15