BCR-ABL1 tyrosine kinase sustained MECOM expression in chronic myeloid leukaemia.

Abstract

MECOM oncogene expression correlates with chronic myeloid leukaemia (CML) progression. Here we show that the knockdown of MECOM (E) and MECOM (ME) isoforms reduces cell division at low cell density, inhibits colony-forming cells by 34% and moderately reduces BCR-ABL1 mRNA and protein expression but not tyrosine kinase catalytic activity in K562 cells. We also show that both E and ME are expressed in CD34(+) selected cells of both CML chronic phase (CML-CP), and non-CML (normal) origin. Furthermore, MECOM mRNA and protein expression were repressed by imatinib mesylate treatment of CML-CP CD34(+) cells, K562 and KY01 cell lines whereas imatinib had no effect in non-CML BCR-ABL1 -ve CD34(+) cells. Together these results suggest that BCR-ABL1 tyrosine kinase catalytic activity regulates MECOM gene expression in CML-CP progenitor cells and that the BCR-ABL1 oncoprotein partially mediates its biological activity through MECOM. MECOM gene expression in CML-CP progenitor cells would provide an in vivo selective advantage, contributing to CML pathogenesis.

Full text

Page 1

BCR-ABL1 tyrosine kinase sustained MECOM expression in
chronic myeloid leukaemia
Swagata Roy,1Heather G. Jørgensen,2
Poornima Roy,1Mohamed Abed El
Baky,1Junia V. Melo,3Gordon
Strathdee,4Tessa L. Holyoake2and
Chris Bartholomew1
1Department of Life Sciences, City Campus,
Glasgow Caledonian University, Glasgow, UK,
2Paul O’Gorman Leukaemia Research Centre,
Institute of Cancer Sciences, College of Medical,
Veterinary and Life Sciences, University of
Glasgow, Glasgow, UK,3Department of
Haematology, Centre for Cancer Biology, IMVS,
Adelaide, SA, Australia and4Crucible
Laboratory, Institute for Ageing and Health, Life
Knowledge Park, University of Newcastle,
Newcastle-upon-Tyne, UK
Received 29 September 2011; accepted for
publication 01 February 2012
Correspondence: Professor Chris Bartholomew,
Department of Life Sciences, City Campus,
Glasgow Caledonian University, Cowcaddens
Road, Glasgow G4 OBA, UK.
E-mail: c.bartholomew@gcu.ac.uk
Summary
MECOM oncogene expression correlates with chronic myeloid leukaemia
(CML) progression. Here we show that the knockdown of MECOM (E)
and MECOM (ME) isoforms reduces cell division at low cell density, inhib-
its colony-forming cells by 34% and moderately reduces BCR-ABL1 mRNA
and protein expression but not tyrosine kinase catalytic activity in K562
cells. We also show that both E and ME are expressed in CD34+selected
cells of both CML chronic phase (CML-CP), and non-CML (normal) ori-
gin. Furthermore, MECOM mRNA and protein expression were repressed
by imatinib mesylate treatment of CML-CP CD34+cells, K562 and KY01
cell lines whereas imatinib had no effect in non-CML BCR-ABL1 ?ve
CD34+cells. Together these results suggest that BCR-ABL1 tyrosine kinase
catalytic activity regulates MECOM gene expression in CML-CP progenitor
cells and that the BCR-ABL1 oncoprotein partially mediates its biological
activity through MECOM. MECOM gene expression in CML-CP progeni-
tor cells would provide an in vivo selective advantage, contributing to CML
pathogenesis.
Keywords: MECOM, BCR-ABL1, tyrosine kinase, imatinib, chronic mye-
loid leukaemia.
Chronic Myeloid Leukaemia (CML) is a disorder of haemo-
poietic stem cells (HSC) (Hamilton et al, 2010), character-
ized by the Philadelphia (Ph) chromosome (Kurzrock et al,
1988). The balanced translocation t(9;22) creates a novel
fusion gene BCR-ABL1 (Ben-Neriah et al, 1986) which
encodes a spatially (Wetzler et al, 1993) and functionally
(Konopka et al, 1984) de-regulated tyrosine kinase, BCR-
ABL1. BCR-ABL1 inappropriately activates the MAPK, PI3K
and JAK-STAT signal transduction pathways (Pendergast
et al, 1993; Skorski et al, 1997; Carlesso et al, 1996) contrib-
uting to abnormal myeloid cell proliferation, differentiation,
transformation and survival (Smith et al, 2003).
CML usually progresses through three stages, which are
designated as chronic (CP), accelerated (AP) and terminal
blast crisis (BC) phases (Irvine et al, 2010). CML-CP and
CML-BC resemble myeloproliferative disorder and acute leu-
kaemia respectively; the transition between stages is unpre-
dictable, non-time limited and inevitable unless treated
(Elrick et al, 2005). Imatinib mesylate (IM; Glivec®; Novartis
Pharma, Frimley, UK), a rationally designed tyrosine kinase
inhibitor (TKI) that selectively inhibits BCR-ABL1 tyrosine
kinase catalytic activity, is the currently favoured therapeutic
agent that successfully manages the majority of patients with
CML-CP (Valent, 2010), although it is much less effective
whenadministeredat advanced
(O’Hare et al, 2006).
The t(9:22) translocation is a CML disease-initiating pro-
genitor cell genetic change, the mutation being present in
cells at all stages of the disease (Melo & Barnes, 2007). Dis-
ease progression requires the acquisition of new genetic
abnormalities and various genes have been implicated in the
majority of cases (reviewed in Melo & Barnes, 2007). Indeed,
enhanced expression of MECOM (MDS1 and EVI1 complex
locus, also known as EVI1, MDS1), a proto-oncogene located
on chromosome 3q26, is frequently observed in CML-BC
(Russell et al, 1993; Carapeti et al, 1996; Ogawa et al, 1996;
De Weer et al, 2008). The MECOM gene encodes a zinc fin-
ger transcription factor with important roles both in normal
development and leukemogenesis (Wieser, 2007). MECOM
belongs to the positive regulatory (PR) domain family and is
stages (CML-AP/BC)
First published online 29 February 2012
doi: 10.1111/j.1365-2141.2012.09078.x
ª 2012 Blackwell Publishing Ltd,
British Journal of Haematology, 2012, 157, 446–456
research paper

Page 2

expressed as multiple naturally occurring alternatively spliced
variants (Huang, 1999; Alzuherri et al, 2006). One form, des-
ignated MECOM (E), encodes the originally described pro-
tein (Morishita et al, 1990a) whereas another results from
splicing of the coding region of the MDS1 gene with exon 2
of the EVI1 gene (encoding the PR domain) translating
MECOM (ME) protein (Fears et al, 1996). Both proteins
contain two domains of 7 (ZF1) and 3 (ZF2) repeats of the
zinc finger motif (Morishita et al, 1988), function as DNA
binding transcription factors (Wieser, 2007) and contribute
to the progression of acute leukaemia (Morishita et al, 1992).
Enhanced expression of MECOM in CML-BC implicates this
transcription factor in disease progression (Ogawa et al,
1996).
Previous studies have shown that normal human CD34+
haemopoietic cells express MECOM (Gerhardt et al, 1997).
Furthermore, this gene has been shown to have a role in self-
renewal, proliferation and the repopulating capacity of mur-
ine HSC in Mecom null mice (Yuasa et al, 2005). However,
MECOM’s role in CML has not been fully determined. ME-
COM over-expression in CML-BC has been found both in
the presence and absence of chromosome 3q26 abnormalities
(Morishita et al, 1990b). Some chromosome 3q26 transloca-
tions generate enhanced expression of intact MECOM (E)
including t(3:9;17;22), t(3;7), t(2;3), inv(3) and t(3;8) (De
Weer et al, 2008; Henzan et al, 2004; Stevens-Kroef et al,
2004; Suzukawa et al, 1997; Lin et al, 2009) whereas others
create novel fusion proteins involving ETV6 t(3;12) (Nakam-
ura et al, 2002) or RUNX1 t(3;21) (Mitani et al, 1994). Many
of the same genetic changes are also present in poor progno-
sis acute myeloid leukaemia.
Between 60–70% of CML-BC cells express MECOM in the
absence of detectable gross cytogenetic abnormalities but in
these cases it is unclear if expression is a marker or a driver of
disease (Ogawa et al, 1996). These and other studies suggest
that MECOM is not expressed in CML-CP mononuclear cells
from bone marrow or peripheral blood, but CML-CP CD34+
cells have not been previously examined. This study investi-
gated MECOM gene expression, the effect of IM treatment
and the biological activity of this gene in primary CML-CP
CD34+progenitor cells as well as CML-derived cell lines.
Materials and methods
Cell culture
K562 and human embryonic kidney (HEK) 293T cells were
cultured at 37°C in 5% CO2 in complete medium (CM)
comprising RPMI 1640 medium or Dulbecco’e modified
Eagle medium (DMEM) respectively, supplemented with
10% fetal calf serum (FCS), 2·5 mmol/l glutamine, 50 mg/ml
penicillin, 50 units/ml streptomycin (all sourced from Lonza
Group Ltd, Basel, Switzerland), and 200 mg/ml Geneticin®
(for HEK293T cells only; Invitrogen, Paisley, UK). Lentivi-
rus-infected cells were selected and maintained in CM and
2 lg/ml puromycin (Sigma-Aldrich, St Louis, MO, USA).
TKI-treated cells were incubated with CM supplemented with
5 lmol/l IM (LC labs, Woburn, MA, USA). Hydroxycarba-
mide (HC) treated cells were incubated in CM supplemented
with 400 lmol/l HC (Sigma-Aldrich). For colony-forming
cell (CFC) assays, 1000 cells were plated in 1·5 ml Metho-
cult®(StemCell Technologies SARL, Grenoble, France) in
30 mm petri dishes and cultured at 37°C, 5% CO2, 12 d. For
IM-treated CFC assays, Methocult®was supplemented with
5 lmol/l IM. Colonies were counted using an inverted
microscope (CK2; Olympus UK Ltd, Southend-on Sea, UK).
Preparation of total cellular RNA, cDNA synthesis and
real time quantitative reverse transcription polymerase
chain reaction (qRT-PCR)
RNA was prepared from cells at exponential growth phase
semi-confluent cultures by the Trizol method (Invitrogen).
500 ng of total cellular RNA was used to synthesize cDNA
with the Superscript®III 1st strand synthesis supermix for
qPCR according to the manufacturer’s instructions (Invitro-
gen). 5% of the cDNA reaction was used for qRT-PCR using
ABsolute Blue QPCR mix (ABgene, Epsom, UK), gene-spe-
cific oligonucleotide primers and dual labelled probes, 95°C,
15 min followed by 40 cycles 95°C, 15 s, 60°C, 1 min in an
OPTICON 2 DNA engine (MJ Research INC, Waltham, MA,
U.S.A).
The efficiencies of the qRT-PCR reactions were calculated
by using the formula Efficiency = ?1 + 10(?1/slope)against
the standard curve of each assay over a gradient of template
concentration with each gene. The efficiency for MECOM
(E), MECOM (ME) and GAPDH primers/probes were 112%,
115% and 110%. Relative expression levels of MECOM (E)
and GAPDH or MECOM (ME) and GAPDH were deter-
mined using the arithmetic comparative 2?DDCt method
(Livak & Schmittgen, 2001) and were determined relative to
the calibrators MECOM (E) or MECOM (ME) respectively in
K562 or CD34+cells as described.
Oligonucleotides
Gene specific oligonucleotides were synthesized and supplied
by Integrated DNA Technologies (Leuven, Belgium).
5′ Human MECOM (E): 5′CTTCTTGACTAAAGCCCTTGGA 3′
3′ Human MECOM (E) and MECOM (ME): 5′GTACTT-
GAGCCAGCTTCCAACA 3′
5′ Human MECOM (ME): 5′GAAAGACCCCAGTTATG-
GATGG 3′
5′ FAM, 3′ TAMRA Human MECOM (E) and MECOM
(ME) probe:
5′CTTAGACGAATTTTACAATGTGAAGTTCTGCATAG 3′
5′ Human GAPDH: 5′CACATGGCCTCCAAGGAGTAA 3′
3′ Human GAPDH: 5′TGAGGGTCTCTCTCTTCCTCTTGT 3′
5′ 6-FAM, 3′ TAMRA Human GAPDH probe: 5′CTGGAC-
CACCAGCCCCAGCA AG 3′.
Novel Mechanism of MECOM Gene Activation in CML
ª 2012 Blackwell Publishing Ltd,
British Journal of Haematology, 2012, 157, 446–456
447

Page 3

5′ Human BCR-ABL1: 5′TCCGCTGACCATCAAYAAGGA3′
3′ Human BCR-ABL1: 5′CACTCAGACCCTGAGGCTCAA3′
5′ FAM, 3′ IOWA BLACK Human BCR-ABL1 probe: 5′CCC-
TTCAGCGGCCAGTA GCATCTGA3′
Preparation of plasmid DNA
pLKO.1 plasmids (Sigma-Aldrich) HB11 (MECOM shRNA,
CCGGGCACTACGTCTTCCTTAAATACTCGAGTATTTAAG
AAGACGTAGTCTTTTT), HB14 (MECOM shRNA, CCGGTG
CAGGGTCACTCATCTAAAGCTCGAGCTTTAGATGAGTGA
CCCTGCATTTTT) and NT (MISSION®Non-target shRNA
control vector) were prepared by affinity chromatography
using Nucleobond®PC500EF gravity flow columns according
to manufacturer’s instruction (Macherey-Nagal GmbH & Co.
Kg, Du ¨ren, Germany).
Production of lentivirus and infection of K562 cells
4–5 9 106HEK293T cells were cultured in CM supple-
mented with 10% tetracycline-free FCS (Clontech Laborato-
ries Inc., Mountain View, CA, USA) as described, and 3 lg
of pLKO.1 recombinant Lentivirus plasmid DNA, Lenti-XTM
HT packaging system (Clontech Laboratories Inc.) plasmid
DNA transfected using the LentiphosTMHT system (Clon-
tech Laboratories Inc.) according to the manufacturer’s
instructions. Virus-containing cell supernatants were passed
through a 0·45 lm cellulose acetate filter (Nalgene Company,
Rochester, NY, USA) and viral titres determined using the
Lenti-XTMqRT-PCR Titration Kit (Clontech Laboratories
Inc.). 2 9 105K562 cells were transduced at a multiplicity of
infection of 40:1 with recombinant Lentivirus in CM supple-
mented with 4 lg/ml polybrene in six-well plates. Plates were
centrifuged (AllegraTMX-22R; Beckman Coulter, Inc. Brea,
CA, USA) at 1200 g, 20°C for 60 min and cultured at 37°C,
5% CO2for 24 h. Transduced cells were selected in CM sup-
plemented with 2 lg/ml puromycin (Sigma-Aldrich).
Western blotting
Protein extracts, sodium dodecyl sulphate polyacrylamide gel
electrophoresis and Western blotting were performed as
described previously (Bartholomew et al, 1997) with either
a-MECOM (C50E12; Cell Signaling Technology, New Eng-
land Biolabs, Hitchin, UK) or a-GAPDH (CA5; Fitzgerald
Industries, North Acton, MA, USA) and diluted 1/1000 or 1/
5000. a-c-ABL1 (2862), a-Phospho-CrKL (Tyr207) and
a-CrKL (32H4) were each obtained from Cell Signaling
Technology and diluted 1/1000. Anti-phosphotyrosine (4G10)
was obtained from Millipore (Temecula, CA, USA) and diluted
1/1000. Appropriate horseradish
anti-rabbit or anti-mouse (Sigma-Aldrich) IgG secondary
antibodies were used at 1/5000 dilutions and detection was
performed by enhanced chemiluminescence (Pierce, Rock-
ford, IL, USA). Relative protein quantification was deter-
peroxidase-conjugated
mined by densitometric analysis using Image LabTMSoftware
v3·0 (Bio-Rad laboratories Ltd, Hemel Hempstead, UK).
Single cell proliferation assay
1 9 106cultured cells were incubated with 1/10 diluted fluo-
rescein isothiocyanate (FITC)-labelled CD45 antibody (BD
Biosciences, San Jose, CA, USA) for 15 min, washed with
phosphate-buffered saline (PBS) (supplemented with 2%
FCS). 50 lg/ml propidium iodide (PI; Sigma-Aldrich) was
added and the cells immediately washed with PBS/2% FCS.
Washed cells were re-suspended in 500 ll of PBS and single
FITC+/PI negative cells isolated by cell sorting (BD FACS
Aria; BD Biosciences) were dispensed into each well of a 96
well tissue culture plate by the automatic cell dispensing unit.
Cells were monitored by visual inspection using an inverted
light microscope (CKX41; Olympus UK Ltd) to confirm
presence of single cells and daily for 4 days for evidence of
cell division. All cells that divided at least once were classified
as proliferating.
Preparation of primary CD34+cells
Leukapheresis samples were obtained with informed consent
as part of the routine assessment of untreated, newly diag-
nosed patients with CML-CP. Non-CML leukapheresis col-
lections were processed as Ph-negative controls. Samples
were enriched to >90% CD34+progenitors by positive selec-
tion (CliniMACS®; Miltenyi Biotec, Bergisch Gladbach, Ger-
many) and cryopreserved. CD34+cells were cultured at 37°C
in 5% CO2in Iscove’s modified Dulbecco’s medium (Invi-
trogen) supplemented with serum substitute (bovine serum
albumin, insulin and transferrin: ‘BIT’; StemCell Technolo-
gies), glutamine (Lonza Group Ltd), penicillin/streptomycin
(Lonza Group Ltd) and five growth factors (IL-3, IL-6, flt3-
L, and SCF from StemCell Technologies; G-CSF from Chugai
Pharma Europe Ltd, London, UK) as previously described
(Jørgensen et al, 2005).
Results
MECOM knock down in K562 cells
Lentiviral vectors encoding non-target (NT) control shRNA
and shRNAs targeting MECOM (HB11 and HB14), were
used to create lentivirus particles by transient transfection of
HEK293T cells as described in Materials and methods, and
generated virus titres of 6 9 108/ml (NT), 1·2 9 109/ml
(HB11) and 3 9 109/ml (HB14). HB11 is complimentary to
a section of exon 7 of MECOM that is alternatively spliced
to generate MECOM D324 and therefore should not knock-
down (KD) production of this isoform (Fig 1A). HB14 is
complimentary to sequences present in all naturally occur-
ring transcripts (3′ untranslated region) and therefore should
KD all isoforms (Fig 1A).
S. Roy et al
448
ª 2012 Blackwell Publishing Ltd,
British Journal of Haematology, 2012, 157, 446–456

Page 4

Total cellular RNA and proteins derived from puromy-
cin-selected cell populations from independent cultures of
K562 cells infected with each lentivirus were examined by
qRT-PCR and Western blot analysis to investigate the suc-
cess of MECOM KD. The results showed 60–70% KD of
MECOM gene expression (E and ME transcripts) in K562
cells with HB11, HB14 or a combination of HB11 and
HB14, relative to NT control cells (Fig 1B). Western blot
analysis showed that production of both 145 kDa MECOM
(E) and 88 kDa MECOM (D324) isoforms were significantly
repressed (80–90%) by HB14 or the HB11/HB14 combina-
tion whereas only the MECOM E protein was repressed by
HB11 (70–80%) (Fig 1C), consistent with the qRT-PCR
data and the anticipated specificity of the two shRNAs. The
MECOM (ME) protein was not detected. Western blot anal-
ysis for GAPDH detected similar levels of the 35 kDa pro-
tein showing equal loading of total cell protein lysates in
each case (Fig 1C).
MECOM KD has no significant impact on BCR-ABL1
kinase activity
To characterize MECOM KD K562 cells, we investigated if
there was an effect on BCR-ABL1 at the message, protein or
catalytic activity (via CrKL phosphorylation) levels. qRT-PCR
results showed a slight reduction of BCR-ABL1 gene expres-
sion in MECOM KD K562 with HB11, HB14 and HB11/14
infected cells but not in NT control cells (Fig 2A). The same
trend was seen by Western blot analysis of BCR-ABL1 pro-
tein levels with a-c-ABL1 antibodies (Fig 2B). However,
BCR-ABL1 tyrosine kinase catalytic activity was unaffected
by MECOM KD, as shown by uniform phosphorylation lev-
els of the BCR-ABL1 substrate CrKL in all cells examined
(Fig 2B). The abundance of total CrKL protein was similar
in all cells and equal levels of GAPDH confirmed similar
protein levels in the cell extracts examined (Fig 2B).
MECOM KD reduced K562 CFC and single cell
proliferation
To investigate the impact of MECOM KD on K562 cells, sin-
gle parental K562, NT control and HB14-infected cells were
sorted by fluorescence-activated cell sorting (FACS) into the
wells of a 96-well cell culture plate and cell division was
monitored. The results showed that a significantly reduced
proportion of the MECOM KD K562 single cells were able to
proliferate (Fig 3) and if they did divide, they turned over
less frequently than parental K562 or NT control cells (data
not shown). These data suggest the proliferation capacity of
MECOM KD K562 is reduced.
MECOM (E)
(145 kDa)
MECOM (Δ324)
(88 kDa)
GAPDH (35 kDa)
(A)
(B)
(C)
MECOM expression relative
to GAPDH (2 –ΔΔCt)
NT HB11 HB14HB
(11+14)
MECOM (ME)
3 4 5
6 7 8
9
10 11
12 13 14 15 16 2
MDS1
3 4
5
6 7 8 9a 10 11
12 13 14 15 16
9
MECOM (E)
3 4 5 6 7 8 9 10 11
12 13 14 15 16
MECOM (E+9)
HB11
HB14
3 4 5 6 7 8 9
10 11
12 13 14 15 16
7
MECOM (Δ324)
0
0·2
0·4
0·6
0·8
1
1·2
1·4
Fig 1. MECOM knockdown in K562 cells. (A) Schematic representation of the four indicated natural MECOM isoforms. The position of
shRNA homology for HB11 and HB14 are indicated by thick horizontal lines showing that HB11 is complimentary to sequences
located in exon 7 present in all transcripts except MECOM (D324), and HB14 is complimentary to sequences located in the 3′ untranslated
region of all transcripts. The coding exons 3–16 are numbered and indicated by boxes as described previously (Alzuherri et al, 2006). The
MECOM (E) exon 2 and MECOM (MDS1) are also boxed and indicated for MECOM (ME). Splice variant-deleted exons are shown as
black boxes. Both introns and 3′ untranslated regions are shown by horizontal lines that connect exons. (B) Histogram of MECOM (E)
(white bars) or MECOM (ME) (black bars) mRNA levels normalized for GAPDH mRNA for the indicated cell populations relative to the
K562 calibrator for MECOM (E) [GAPDH-normalized MECOM (E)] or MECOM (ME) [GAPDH-normalized MECOM (ME)] respectively, as
determined by qRT-PCR. Columns are the mean of an experiment performed in quadruplicate and the error bars the standard deviation.
(C) Western blot analysis of the indicated whole cell protein extracts using a-MECOM and a–GAPDH antibodies. The position of the
145 kDa MECOM (E), 88 kDa MECOM (D324) and 35 kDa GAPDH proteins are indicated by arrows.
Novel Mechanism of MECOM Gene Activation in CML
ª 2012 Blackwell Publishing Ltd,
British Journal of Haematology, 2012, 157, 446–456
449

Page 5

We next investigated the functional effect of MECOM KD
by examining the number of CFC in semi-solid culture
media. The results showed a significant reduction in CFC
(34%; P < 0·0001) in all MECOM KD cell populations
(Fig 4A) relative to NT control cell populations (Fig 4A).
Interestingly, all the colonies produced by the KD cell popu-
lations were not only fewer in number but also reduced in
size (Fig 4C, D). These data suggest that MECOM KD signif-
icantly reduces K562 CFC activity.
MECOM expression in CD34+cells
Previous studies have shown detectable MECOM gene tran-
scripts in CML-BC but not CML-CP patient cells (Ogawa
et al, 1996). To see if MECOM expression was detectable in
CML-CP, we examined CD34+selected cells derived from
the peripheral blood of three newly diagnosed patients
(demographics shown in Table I) and in one allogeneic nor-
mal donor CD34+as well as CD34+cells from two non-CML
patients (collectively designated ‘non-CML’) as controls.
MECOM (E) and MECOM (ME) expression were normalized
to GAPDH, then further scaled to GAPDH normalized ME-
COM (E) or MECOM (ME) calibrator respectively in normal
CD34+cells (sample 010). Both MECOM (E) and MECOM
(ME) isoforms were readily detected in CD34+cells, of both
CML and non-CML origin. The relative abundance of both
transcripts was similar in CML-CP CD34+cells compared to
the non-CML CD34+cells (Fig 5A, B). These data show that
MECOM (E) and MECOM (ME) gene transcripts are readily
detected in primitive CML-CP CD34+cells.
MECOM expression in CML-CP cells and CML cell
lines is repressed by IM
IM treatment has been shown to dramatically reduce the sur-
vival of p210 BCR-ABL1+ cells in vitro. As MECOM is a
putative survival factor, we were interested to know if switch-
ing off the kinase survival pathway with IM would have any
impact on the MECOM expression in CML-CP CD34+cells.
Interestingly, the results showed a time-dependent reduction
of both MECOM (E) and MECOM (ME) gene expression in
IM-treated cells relative to untreated cells (Fig 6A, B). The
results also showed that MECOM (E) and MECOM (ME)
expression was reduced independently of IM when CML-CP
CD34+cells (donor 289) were cultured for 12 h or more
(Fig 6A, B). However, there was a statistically very significant
reduction of MECOM (E) and MECOM (ME) in IM-treated
cells, relative to cells cultured in growth medium alone, at
both 12(MECOM(E)P < 0·0008,
P < 0·009) and 24 h (MECOM (E) P < 0·0001, MECOM
(ME) P < 0·0009) (Fig 6A, B). MECOM (E) and MECOM
(ME) expression was also examined in non-CML CD34+cells
(donor 019) + and ? IM. IM treatment has no effect on
MECOM expression in these BCR-ABL1 ?ve CD34+cells,
although, once again expression was slightly decreased fol-
lowing 12 h or more of cells in culture in the presence or
absence of the TKI (Fig 6C, D).
To confirm the effect of IM on MECOM gene and protein
expression we examined its impact in the CML-derived cell
MECOM(ME)
BCR-ABL1 (210 kDa)
p-CrKL (Tyr-207)
(39 kDa)
CrKL (39 kDa)
GAPDH (35 kDa)
0
0·2
0·4
0·6
0·8
1
1·2
1·4
BCR-ABL1 expression
relative to GAPDH (2–ΔΔct)
(A)
(B)
NT HB11 HB14
HB(11+14)
Fig 2. BCR-ABL1 expression and catalytic activity in K562, NT,
HB11, HB14 and HB(11 + 14) cells. (A) Histogram of BCR-ABL1
mRNA levels normalized for GAPDH mRNA relative to GAPDH-
normalized BCR-ABL1 mRNA in K562 cells (calibrator) for the
indicated cell populations, determined by qRT-PCR. Columns are
the mean of an experiment performed in quadruplicate and error
bars indicate standard deviation. (B) Western blot analysis of the
indicated whole cell protein extracts using a-c-ABL1, a-Phospho-
CrKL (Tyr207), a-CrKL and a–GAPDH antibodies. The position of
the 210 kDa BCR-ABL1, 39 kDa p-CrKL and CrKL and 35 kDa
GAPDH proteins are indicated by arrows.
% Undivided cells
0
20
40
60
80
100
120
Day0 Day1 Day2Day3Day4
Fig 3. K562 and HB14 KD single cell proliferation assay. The histo-
gram shows the percentage of undivided single cells at 0–4 d of cul-
ture. At day 0 all single cells in 96-well plates are undivided, giving a
value of 100%. Black bars, K562 cells; grey bars, NT cells; white bars,
HB14. All K562 and NT cells had divided at least once by day 4 com-
pared to only 50% of HB14 cells. The results shown are the mean of
an experiment performed twice.
S. Roy et al
450
ª 2012 Blackwell Publishing Ltd,
British Journal of Haematology, 2012, 157, 446–456

Page 6

lines K562 and KY01. Both MECOM (E) and MECOM (ME)
isoforms were dramatically reduced after 6 h and continued
to be repressed further for the time points shown (>90%
after 24 h, Fig 7A) in K562. The same IM-mediated repres-
sion of MECOM (E) and MECOM (ME) isoforms was also
observed in another CML-derived cell line, KYO1 (Fig 7B).
Western blot analysis detected the 145 kDa MECOM (E)
protein in both cell lines (Fig 7C), The abundance of the
145 kDa MECOM (E) protein rapidly diminished within 6 h
of IM treatment and further reduced after 24 h (Fig 7C, 70–
90% reduction after 24 h), consistent with the qRT-PCR
data. IM treatment for 24 h inhibited phosphorylation of
BCR-ABL1 (Fig 7D). Furthermore, inhibition of BCR-ABL1
catalytic activity was observed after 6 h IM treatment and
was sustained for at least 24 h, as observed by dramatically-
reduced phosphorylation of the CrKL substrate protein
(Fig 7E). Counting of trypan blue (Sigma-Aldrich)-treated
cells demonstrated that 5 lmol/l IM treatment inhibited
K562 proliferation but had no effect on cell viability over the
24 h period examined (data not shown).
To determine whether the impact of IM on MECOM is
specific, or a more general consequence of inhibiting cell
proliferation, we examined the effect of hydroxycarbamide
(HC) in K562 cells. Western blot analysis showed no major
change in the 145 kDa MECOM (E) protein following treat-
ment of K562 cells with HC for up to 24 h (Fig 7C).
Our data show that IM rapidly inhibited MECOM gene
expression in primary CML-CP CD34+cells and CML-
derived cell lines. Furthermore, MECOM KD significantly
reduced K562 CFC activity (Fig 4A); this compared with an
80% reduction in K562 CFC achieved following IM (5 lmol/
l) treatment (Fig 4B). Together these data suggest that ME-
COM repression could partially mediate the cellular response
to IM.
Discussion
This study showed that MECOM has a role in cell prolifera-
tion in Ph+ cells. KD of MECOM in K562 cells reduced their
No. of colonies
0
100
200
300
400
500
***
(P = 0·0001)
K562 NTHB11
HB14 HB(11+14)
(A) (B)
(D)
(C)
0
100
200
300
400
500
600
K562 K562,IM
***
(P = 0·0001)
No. of colonies
NTHB11HB14 HB(11+14) K562
0
50
100
150
200
NTHB11HB14 HB
11+14
Colony diameter
(% relative to K562)
Fig 4. Colony-forming activity of K562 and derivative MECOM KD cells. (A) The number of CFC per 1000 cells plated for the indicated cell popu-
lations is shown. Each CFC assay was performed in triplicate for the indicated cell population and the results shown are a typical example of an
experiment performed four times. ***P < 0·0001. (B) The same as (A) for K562 cells with or without 5 lmol/l IM. (C) Images of typical colo-
nies formed by the indicated cell populations. (D) Histogram showing mean colony diameter of indicated cell population as a percentage of mean
K562 colony diameter. Error bars indicate the standard deviation. n = 20 for the total number of each cell colony type analysed.
Table I. Characteristics of donor samples.
Patient ID SexAge (years)Diagnosis
010
011
012
019
249
255
257
289
Male
Female
Female
Male
N/A
Female
Male
Female
45
51
61
62
N/A
46
47
47
Normal donor
Multiple myeloma
Mantle cell lymphoma
Mantle cell lymphoma
CML
CML
CML
CML
CML, chronic myeloid leukaemia; N/A, not available.
Shows sex, age and diagnosis of donor CD34+cell samples used for
qRT-PCR analysis.
Novel Mechanism of MECOM Gene Activation in CML
ª 2012 Blackwell Publishing Ltd,
British Journal of Haematology, 2012, 157, 446–456
451

Page 7

proliferative capacity in CFC as well as single cell prolifera-
tion assays. These observations were the same for KD either
of all MECOM isoforms (with HB14-treated cells) or when
MECOM (D324) expression only was retained (HB11-treated
cells), showing this latter truncated protein, which lacks
transforming activity (Kilbey & Bartholomew, 1998) cannot
compensate for reduced MECOM (E) and MECOM (ME)
isoforms. It is possible that our studies underestimate the
impact of MECOM repression due to partial KD only
because other studies including Mecom KO mice showed a
more severe effect on HSC numbers (Yuasa et al, 2005) and
an almost complete cell cycle arrest was reported in MECOM
KD K562 cells (Lugthart et al, 2011).
The MECOM (ME) 185 kDa protein was not detected in
K562 or KY01 cells using a-MECOM antibody, despite qRT-
PCR data demonstrating RNA expression of this isoform. It
is currently unclear if the MECOM (ME) protein is not pro-
duced in K562 cells or is at levels below the detection limits
of our assays. This study might have underestimated the
abundance of MECOM (E) encoding transcripts, as there are
multiple transcription initiation sites (1a, 1b, 1c and 3L) that
are not detected by the specific primers and probe set used
here (Aytekin et al, 2005; Lugthart et al, 2008). Expression of
MECOM (E) alone is associated with poor prognosis acute
leukaemia (Barjesteh van Waalwijk van Doorn-Khosrovani
et al, 2003). Therefore higher levels of MECOM (E) relative
to MECOM (ME) would be likely to contribute to disease
progression. A similar observation has been made for another
(A) (B)
(C) (D)
MECOM expression relative
to GAPDH (2–ΔΔCt)
MECOM expression relative
to GAPDH (2–ΔΔCt)
MECOM expression relative
to GAPDH (2–ΔΔCt)
MECOM expression relative
to GAPDH (2–ΔΔCt)
h
Imatinib
12
426
–––
+++
h
Imatinib
12 426
–––
+++
0
0·2
0·4
0·6
0·8
1
1·2
1·4
h
Imatinib
12 426
–––
+++
h
Imatinib
12
42
6
–––
+++
*
P = 0·05
***
P = 0·0008
***
P = 0·0001
**
P = 0·009
***
P = 0·0009
P = 0·17
0
0·2
0·4
0·6
0·8
1
1·2
0
0·2
0·4
0·6
0·8
1
1·2
0
0·2
0·4
0·6
0·8
1
1·2
Fig 6. MECOM (E) (white bars) and MECOM (ME) (black bars) gene expression in donor 289 (Ph+ CML-CP) cells and Ph? donor 019 cells
exposed to 5 lmol/l IM for various times. Histograms indicate MECOM (E) (A, C) and MECOM (ME) (B, D) mRNA levels normalized for GAP-
DH mRNA relative to GAPDH normalized MECOM (E) (A, C) or MECOM (ME) (B, D) mRNA in calibrator cells [0 h, untreated donor 289 (A,
B) or 019 (C, D)] respectively, in the presence (+) or absence (?) of 5 lmol/l IM for 6, 12 and 24 h determined by qRT-PCR. Columns are the
mean of an experiment performed in quadruplicate and error bars indicate the standard deviation.
MECOM expression relative
to GAPDH (2–ΔΔCt)
011 012
249
255
257
0
0·5
1
1·5
2
2·5
3
Fig 5. MECOM (E) (white bars) and MECOM (ME) (black bars)
gene expression in the indicated donor Ph? CD34+non-CML cells
(donors 011, 012) and Ph+ CD34+CML-CP cells (donors 249, 255,
257). Histograms indicate MECOM (E) and MECOM (ME) mRNA
levels normalized for GAPDH mRNA relative to GAPDH normalized
MECOM (E) or MECOM (ME) mRNA respectively, of calibrator
cells (Ph? CD34+normal cells 010), determined by qRT-PCR. Col-
umns are the mean of an experiment performed in quadruplicate
and the error bars the standard deviation.
S. Roy et al
452
ª 2012 Blackwell Publishing Ltd,
British Journal of Haematology, 2012, 157, 446–456

Page 8

PR family gene, PRDM2, where the shorter PR domain-
deleted forms are always found in chromosome 1p36-linked
malignancies, consistent with the view that the long PR
domain-containing forms have tumour suppressor activity
(Huang, 1999).
We also showed here that MECOM expression is not only
seen in K562 and KY01 cell lines but also in primary CML-
CP cells, whereas previous reports have suggested it is only
observed in CML-BC (Ogawa et al, 1996). It is likely that the
discrepancy between our results and previous data are due to
increased sensitivity of detection resulting from the analysis
of a CD34+subpopulation of peripheral blood mononuclear
cells, which express the highest levels of MECOM. Both
CD34+non-CML cells and CD34+CML cells expressed simi-
lar levels of both MECOM (E) and MECOM (ME) gene tran-
scripts. Previous studies show both isoforms are present in
normal tissues (Fears et al, 1996; Wimmer et al, 1998). Only
one of the samples in this study, donor 010, was normal but
the relative abundance of both transcripts was similar here to
that of the other non-CML and CML samples examined.
Therefore, these data show: (i) that CD34+cells express high
levels of MECOM and (ii) that both transcripts are present
in CML cells at similar levels to normal and non-CML cells.
In this study we observed that MECOM KD had no effect
on BCR-ABL1 kinase activity, so the oncogenic catalytic
kinase was then switched-off by treatment with the TKI, IM.
IM mediated inhibition of BCR-ABL1 resulted in a rapid
repression of both MECOM (ME) and MECOM (E) gene
expression in CML CD34+, K562 and KY01 cells. This effect
is likely to be specific, as IM treatment had no effect on
MECOM expression in BCR-ABL1-ve non-CML CD34+cells
(Fig 6C, D). Western blot analysis showed a dramatic reduc-
tion of the 145 kDa MECOM (E) protein in IM-treated
K562 and KY01 cells. This repression was not a consequence
of general inhibition of cell proliferation but was BCR-ABL1
specific, as treatment with the anti-metabolite, HC did not
alter MECOM (E) protein levels. Furthermore, this was not
the result of general cell toxicity, as trypan blue exclusion
studies showed the cells retained viability for at least 24 h of
IM treatment and there was no impact on cellular levels of
numerous other proteins examined, including CrKL, GAP-
DH, STAT5, ERK1/2, AKT and BCR-ABL1 (data not shown).
As was seen for K562 cell line, IM-mediated inhibition of
BCR-ABL1 results in a rapid decline in MECOM gene
expression at both the mRNA and protein level in primary
CML-CP cells. MECOM expression also declined, by 50%,
following culture of primary CML-CP cells for 12–24 h. This
reduction is not as great as in the presence of IM and might
reflect maturation of cells or ex-vivo culture not adequately
replicating in vivo conditions. A similar partial decline in
MECOM expression was also observed in non-CML CD34+
cells cultured for 12 h or more.
(C)
(D)
Time (h)
(E)
Time (h) 0
+
+ + –
42) h (emi T
drug
12 6 0
MECOM (E)
(145 kDa)
GAPDH (35 kDa)
MECOM (E)
(145 kDa)
GAPDH (35 kDa)
MECOM (E)
(145 kDa)
GAPDH (35 kDa)
K562, IM
K562, HC
KY01, IM
GAPDH
IM–+
p-BCR/ABL1
BCR/ABL1
IM–+++
6 12 24
CrKL
p-CrKL
(tyr 207)
GAPDH
0 24
MECOM expression relative
to GAPDH (2–ΔΔCt)
MECOM expression relative
to GAPDH (2–ΔΔCt)
6 h 12 h
24 h
(A) (B)
24 h
12 h 6 h
0
0·1
0·2
0·3
0·4
0·5
0·6
0·7
0
0·1
0·2
0·3
0·4
0·5
0·6
0·7
Fig 7. MECOM (E) and MECOM (ME) mRNA levels in K562 (A) and KY01 (B) cell lines treated with 5 lmol/l IM for the time indicated. Anal-
ysis was as described in the legend to Fig 1 with untreated 0 h K562 (A) or KY01 (B) as calibrator. (C) Western blot analysis of whole cell pro-
tein extracts derived from cells treated with either 5 lmol/l IM (K562 and KY01) or 400 lmol/l HC for the indicated times using a-MECOM
and a–GAPDH antibodies. Also shown are Western blot analysis of whole cell protein extracts derived from IM-treated (+) or untreated (?) cells
for the indicated times with a-phosphotyrosine, a-c-ABL1 and a-GAPDH (D) and a-pCrKL, a-CrKL and a-GAPDH (E) antibodies.
Novel Mechanism of MECOM Gene Activation in CML
ª 2012 Blackwell Publishing Ltd,
British Journal of Haematology, 2012, 157, 446–456
453

Page 9

Inhibition of MECOM expression by IM demonstrates for
the first time that its expression is regulated in BCR-ABL1+
cells by the catalytic activity of this aberrant kinase. Regula-
tion of mRNA expression is rapid, suggesting it is a direct
response to inhibition of tyrosine kinase-mediated signalling
from the BCR-ABL1 protein. Several studies have previously
identified many potential BCR-ABL1 target genes
MECOM was not described (Ha ˚kansson et al, 2008; Nunoda
et al, 2007; Bianchini et al, 2007). This study represents the
first report of a signal transduction pathway that regulates
MECOM gene expression. Although BCR-ABL1 transmits an
aberrant signal, these results suggest MECOM expression is
modulated by one or more of the three major pathways,
JAK-STAT, MAPK or PI3K, activated by this promiscuous
kinase (Pendergast et al, 1993; Skorski et al, 1997; Carlesso
et al, 1996). The particular pathway involved is currently
under investigation. The molecular basis of BCR-ABL1-medi-
ated MECOM regulation should facilitate how expression of
this developmentally important gene is controlled in HSC
and other tissues where it is normally expressed (Yuasa et al,
2005; Goyama et al, 2008; Hoyt et al, 1997).
These data establish a link between BCR-ABL1 kinase cat-
alytic activity and MECOM gene expression. We propose that
BCR-ABL1 positively regulates MECOM gene expression.
The level of MECOM gene expression is not elevated by
BCR-ABL1 kinase relative to expression levels observed in
non-CML and normal primitive haemopoetic cells. However,
it is deregulated, because the mechanism regulating MECOM
gene expression in normal CD34+cells is distinct from that
in CML-CP CD34+cells, given that, in the latter, expression
is dependent upon BCR-ABL1 catalytic activity. The BCR-
ABL1 kinase might activate a pathway that normally
regulates MECOM production in primitive haemopoietic
cells. Since BCR-ABL1 kinase is constitutively active, it will
continuously stimulate the pathway leading to sustained
de-regulated MECOM gene expression. It is unlikely that
MECOM expression is repressed by inhibition of other recep-
tors (PDGFRΑ, PDGFRΒ or KIT) that are known to be inac-
tivated by IM (Fabbro et al, 1999) because IM has no effect
on BCR-ABL1 ?ve CD34+cells (Fig 6C, D).
Maintenance of MECOM expression in primitive HSC is
probably a selective advantage. Retroviral tagging studies
showed that proviral insertions are frequently seen in the
MECOM locus in dominant non-malignant HSC clones
retrieved from transplant recipients (Kustikova et al, 2005)
and primary myeloid CD34+ex-vivo cultures are enriched for
viral insertions in this gene (Sellers et al, 2010). Furthermore,
MECOM is required for the survival and proliferation of
HSC (Yuasa et al, 2005; Goyama et al, 2008). The MECOM
KD studies in K562 cells described above support this
notion, as these cells show a reduced proliferative capacity in
CFC and single cell proliferation assays. Our results suggest
but
that BCR-ABL1 tyrosine kinase catalytic activity sustains
MECOM gene expression in CML-CP CD34+cells and that
this gives cells a selective advantage in a manner analogous
to retroviral insertion. It is possible the impact of MECOM
KD in primary CML-CP cells would be even greater than
seen with K562, which is an immortal cell line with a number
of additional genetic abnormalities. We are currently investi-
gating this.
Sustained expression of MECOM could be one of the
mechanisms by which BCR-ABL1 contributes a selective
advantage to primitive haemopoietic cells in CML, resulting
in an increased production of mature cells in peripheral
blood. In this case, gross chromosome abnormalities are not
required as the BCR-ABL1 mutation causes de-regulation of
MECOM gene expression. Interestingly, MECOM transloca-
tions are frequently observed in CML patients treated with
TKI inhibitors that progress to blast crisis (Paquette et al,
2011) and enhanced MECOM expression is a predictor of
poor prognosis in TKI-resistant CML-CP (Daghistani et al,
2010). This suggests that inhibition of BCR-ABL1 kinase may
select for cells that de-regulate MECOM expression by alter-
native mechanisms. Mutations causing elevated levels of
MECOM (E) relative to MECOM (ME), or its fusion pro-
teins that can occur in CML-BC might be necessary for other
MECOM-mediated biological activities including inhibition
of terminal cell differentiation. Indeed, previous studies show
that MECOM mediated inhibition of granulocyte differentia-
tion is dependent on the level of expression (Khanna-Gupta
et al, 1996). Our results suggest BCR-ABL1-mediated MECOM
gene expression represents a novel mechanism of de-regulating
this gene in leukaemia.
Acknowledgements
We would like to thank Aubrey Thompson and Jennifer
Havens (RNA Interference Technology Resource, Mayo
Clinic, Jacksonville, FL, USA) for providing pLKO.1 recom-
binant plasmids. We would also like to thank Linda Scobie,
GlasgowCaledonian University
HEK293T cells. This work was supported by a GCU PhD
scholarship (SR) and Leukaemia & Lymphoma Research
project grant 08018 (CB, GS, TLH, JVM). This study was
also supported by the Glasgow Experimental Cancer Medi-
cine Centre (ECMC), which is funded by Cancer Research
UK and by the Chief Scientist’s Office (Scotland). SR, PR
and MAEB performed the research. CB, HJ, TH, GS and
JVM designed the study and wrote the paper.
(GCU)forproviding
Conflict of Interest
The authors declare no conflict of interest.
S. Roy et al
454
ª 2012 Blackwell Publishing Ltd,
British Journal of Haematology, 2012, 157, 446–456

Page 10

References
Alzuherri, H., McGilvray, R., Kilbey, A. & Barthol-
omew, C. (2006) Conservation and expression
of a novel alternatively spliced Evi1 exon. Gene,
384, 154–162.
Aytekin, M., Vinatzer, U., Musteanu, M., Ray-
naud, S. & Wieser, R. (2005) Regulation of the
expression of the oncogene EVI1 through the
use of alternative mRNA 5′-ends. Gene, 15, 160–
168.
Barjesteh van Waalwijk van Doorn-Khosrovani, S.,
Erpelinck, C., van Putten, W.L., Valk, P.J., van
der Poel-van de Luytgaarde, S., Hack, R., Slater,
R., Smit, E.M., Beverloo, H.B., Verhoef, G., Ver-
donck, L.F., Ossenkoppele, G.J., Sonneveld, P.,
de Greef, G.E., Lo ¨wenberg, B. & Delwel, R.
(2003) High EVI1 expression predicts poor sur-
vival in acute myeloid leukemia: a study of 319
de novo AML patients. Blood, 101, 837–845.
Bartholomew, C., Kilbey, A., Clark, A.M. &
Walker, M. (1997) The Evi-1 proto-oncogene
encodes a transcriptional repressor activity asso-
ciated with transformation. Oncogene, 14, 569–
577.
Ben-Neriah, Y., Daley, G.Q., Mes-Masson, A.M.,
Witte, O.N. & Baltimore, D. (1986) The chronic
myelogenous leukaemia-specific P210 protein is
the product of the bcr/abl hybrid gene. Science,
85, 212–214.
Bianchini, M., Martinelli, G., Renzulli, M., Gonz-
alez Cid, M. & Larripa, I. (2007) cDNA micro-
arraystudytoidentify
relevant for apoptosis in K562 cells co-treated
with amifostine and imatinib. Cancer Chemo-
therapy and Pharmacology, 59, 349–360.
Carapeti, M., Goldman, J.M. & Cross, N.C. (1996)
Overexpression of EVI-1 in blast crisis of
chronic myeloid leukemia. Leukemia, 10, 1561.
Carlesso, N., Frank, D. & Griffin, J.D. (1996)
Tyrosylphosphorylation
activity of signal transducers and activators of
transcription (STAT) proteins in hematopoietic
cell lines transformed by Bcr/Abl. The Journal of
Experimental Medicine, 183, 811–820.
Daghistani, M., Marin, D., Khorashad, J.S., Wang,
L., May, P.C., Palliompeis, C., Milojkovic, D.,
De Melo, V.A., Gerrard, G., Goldman, J.M., Ap-
perley, J.F., Clark, R.E., Foroni, L. & Reid, A.G.
(2010) EVI-1 oncogene expression predicts sur-
vival in chronic-phase CML patients resistant to
imatinib treated with second-gneration tyrosine
kinase inhibitors. Blood, 116, 6014–6017.
De Weer, A., Poppe, B., Cauwelier, B., Carlier, A.,
Dierick, J., Verhasselt, B., Philippe ´, J., Van Roy,
N. & Speleman, F. (2008) EVI1 activation in
blast crisis CML due to juxtaposition to the rare
17q22 partner region as part of a 4-way variant
translocation t(9;22). BMC Cancer, 8, 193.
Elrick, L.J., Jørgensen, H.G., Mountford, J.C. &
Holyoake, T.L. (2005) Punish the parent not the
progeny. Blood, 105(5), 1862–1866.
expressionchanges
and DNAbinding
Fabbro, D., Buchdunger, E., Wood, J., Mestan, J.,
Hofmann, F., Ferrari, S., Mett, H., O’Reilly, T.
& Meyer, T. (1999) Inhibitors of protein kinas-
es: CGP 41251, a protein kinase inhibitor with
potential as an anticancer agent. Pharmacology
and Therapeutics, 82, 293–301.
Fears, S., Mathieu, C., Zeleznik-Le, N., Huang, S.,
Rowley, J.D. & Nucifora, G. (1996) Intergenic
splicing of MDS1 and EVI1 occurs in normal
tissues as well as in myeloid leukemia and
produces a new member of the PR domain
family. Proceedings of the National Academy of
Sciences of the United States of America, 93,
1642–1647.
Gerhardt, T.M., Schmahl, G.E., Flotho, C., Rath,
A.V. & Niemeyer, C.M. (1997) Expression of the
Evi-1 gene in haemopoietic cells of children
with juvenile myelomonocytic leukaemia and
normal donors. British Journal Haematology, 99,
882–887.
Goyama, S., Yamamoto, G., Shimabe, M., Sato, T.,
Ichikawa, M., Ogawa, S., Chiba, S. & Kurokawa,
M. (2008) Evi-1 is a critical regulator for hema-
topoietic stem cells and transformed leukemic
cells. Cell Stem Cell, 3, 207–220.
Ha ˚kansson,P., Nilsson,
Lassen, C., Gullberg, U. & Fioretos, T. (2008)
Gene expression analysis of BCR/ABL1-depen-
dent transcriptional response reveals enrich-
ment for genes involved in negative feedback
regulation. Genes Chromosomes Cancer, 47,
267–275.
Hamilton, A., Gallipoli, P., Nicholson, E. & Holy-
oake, T.L. (2010) Targeted therapy in haemato-
logical malignancies. Journal of Pathology, 220,
404–418.
B., Andersson,A.,
Henzan, H., Yoshimoto, G., Okeda, A., Nagasaki,
Y., Hirano, G., Takase, K., Tanimoto, T., Mi-
yamoto, T., Fukuda, T., Nagafuji, K. & Harada,
M. (2004) Myeloid/natural killer cell blast crisis
representing an additional translocation, t(3;7)
(q26;q21) in Philadelphia-positive chronic mye-
logenous leukemia. Annals of Hematology, 83,
784–788.
Hoyt, P.R., Bartholomew, C., Davis, A.J., Yutzey,
K., Gamer, L.W., Potter, S.S., Ihle, J.N. & Mu-
censki, M.L. (1997) The Evi1 proto-oncogene is
required at midgestation for neural, heart, and
paraxial mesenchyme development. Mechanisms
of Development, 65, 55–70.
Huang, S. (1999) The retinoblastoma protein-
interacting zinc finger gene RIZ in 1p36-linked
cancers. Frontiers in bioscience, 4, D528–D532.
Irvine, D.A., Heaney, N.B. & Holyoake, T.L.
(2010) Optimising chronic myeloid leukaemia
therapy in the face of resistance to tyrosine
kinase inhibitors–a synthesis of clinical and lab-
oratory data. Blood Reviews, 24, 1–9.
Jørgensen, H.G., Allan, E.K., Graham, S.M., God-
den, J.L., Richmond, L., Elliott, M.A., Mount-
ford, J.C., Eaves, C.J. & Holyoake, T.L. (2005)
Lonafarnib reduces the resistance of primitive
quiescent CML cells to imatinib mesylate
in vitro. Leukemia, 19, 1184–1191.
Khanna-Gupta, A., Lopingco, M.C., Savinelli, T.,
Zibello, T., Berliner, N. & Perkins, A.S. (1996)
Retroviral insertional activation of the EVI1
oncogene does not prevent G-CSF-induced mat-
uration of the murine pluripotent myeloid cell
line 32Dcl3. Oncogene, 12, 563–569.
Kilbey, A. & Bartholomew, C. (1998) Evi-1 ZF1
DNA binding activity and a second distinct
transcriptionalrepressor
required for optimal transformation of Rat1
fibroblasts. Oncogene, 16, 2287–2291.
Konopka, J.B., Watanabe, S.M. & Witte, O.N.
(1984) An alteration of the human c-abl protein
in K562 leukaemia cells unmasks associated
tyrosine kinase activity. Cell, 37, 1035–1042.
region are both
Kurzrock, R., Gutterman, J.U. & Talpaz, M.
(1988) The molecular genetics of Philadelphia
chromosome positive leukaemias. New England
Journal of Medicine, 319, 990–998.
Kustikova, O., Fehse, B., Modlich, U., Yang, M.,
Du ¨llmann, J., Kamino, K., von Neuhoff, N.,
Schlegelberger, B., Li, Z. & Baum, C. (2005)
Clonal dominance of hematopoietic stem cells
triggered by retroviral gene marking. Science,
308, 1171–1174.
Lin, P., Lennon, P.A., Yin, C.C. & Abruzzo, L.V.
(2009) Chronic myeloid leukemia in blast phase
associated with t(3;8)(q26;q24). Cancer Genetics
and Cytogenetics, 193, 119–122.
Livak, K.J. & Schmittgen, T.D. (2001) Analysis of
relative gene expression data using real-time
quantitative PCR and the 2(?Delta Delta C(T))
Method. Methods, 25, 402–408.
Lugthart, S., van Drunen, E., van Norden, Y., van
Hoven, A., Erpelinck, C.A., Valk, P.J., Beverloo,
H.B., Lo ¨wenberg, B. & Delwel, R. (2008) High
EVI1 levels predict adverse outcome in acute
myeloid leukemia: prevalence of EVI1 over
expression and chromsome 3q26 abnormalities
underestimated. Blood, 111, 4329–4337.
Lugthart, S., Figueroa, M.E., Bindels, E., Skra-
banek, L., Valk, P.J.M., Li, Y., Meyer, S., Erpe-
linck-Verschueren, C., Greally, J., Lo ¨wenberg, B.,
Melnick, A. & Delwel, R. (2011) Aberrant DNA
hypermethylation signature in acute myeloid
leukaemia directed by EVI1. Blood, 117, 234–
241.
Melo, J.V. & Barnes, D.J. (2007) Chronic myeloid
leukaemia as a model of disease evolution in
human cancer. Nature Reviews Cancer, 7, 441–
453.
Mitani, K., Ogawa, S., Tanaka, T., Miyoshi, H.,
Kurokawa, M., Mano, H., Yazaki, Y., Ohki, M.
& Hirai, H. (1994) Generation of the AML1-
EVI-1 fusion gene in the t(3;21)(q26;q22) causes
blastic crisis in chronic myelocytic leukemia.
EMBO Journal, 13, 504–510.
Morishita, K., Parker, D.S., Mucenski, M.L., Jen-
kins, N.A., Copeland, N.G. & Ihle, J.N. (1988)
Retroviral activation of a novel gene encoding a
zinc finger protein in IL-3-dependent myeloid
leukemia cell lines. Cell, 54, 831–840.
Morishita, K., Parganas, E., Douglass, E.C. & Ihle, J.
N. (1990a) Unique expression of the human Evi-
1 gene in an endometrial carcinoma cell line:
sequence of cDNAs and structure of alternatively
spliced transcripts. Oncogene, 5, 963–971.
Morishita, K., Parganas, E., Bartholomew, C., Sac-
chi, N., Valentine, M.B., Raimondi, S.C., Le
Novel Mechanism of MECOM Gene Activation in CML
ª 2012 Blackwell Publishing Ltd,
British Journal of Haematology, 2012, 157, 446–456
455

Page 11

Beau, M.M. & Ihle, J.N. (1990b) The human
Evi-1 gene is located on chromosome 3q24-q28
but is not rearranged in three cases of acute
nonlymphocyticleukemias
(q25;q34) translocations. Oncogene Research, 5,
221–231.
Morishita, K., Parganas, E., William, C.L., Whit-
taker, M.H., Drabkin, H., Oval, J., Taetle, R.,
Valentine, M.B. & Ihle, J.N. (1992) Activation of
EVI1 gene expression in human acute myeloge-
nous leukemias by translocations spanning 300–
400 kilobaseson chromosome
Proceedings of the National Academy of Sciences
of the United States of America, 89, 3937–3941.
Nakamura, Y., Nakazato, H., Sato, Y., Furusawa, S.
& Mitani, K. (2002) Expression of the TEL/EVI1
fusion transcript in a patient with chronic mye-
logenous leukemia with t(3;12)(q26;p13). Ameri-
can Journal of Hematology, 69, 80–82.
Nunoda, K., Tauchi, T., Takaku, T., Okabe, S.,
Akahane, D., Sashida, G., Ohyashiki, J.H. &
Ohyashiki, K. (2007) Identification and func-
tional signature of genes regulated by structur-
ally different ABL kinase inhibitors. Oncogene,
26, 4179–4188.
Ogawa, S., Kurokawa, M., Tanaka, T., Tanaka, K.,
Hangaishi, A., Mitani, K., Kamada, N., Yazaki,
Y. & Hirai, H. (1996) Increased Evi-1 expression
is frequently observed in blastic crisis of chronic
myelocytic leukemia. Leukemia, 10, 788–794.
O’Hare, T., Corbin, A.S. & Druker, B.J. (2006)
Targeted CML therapy: controlling drug resis-
tance, seeking cure. Current Opinion in Genetics
and Development, 16, 92–99.
Paquette, R.L., Nicoll, J., Chalukya, M., Elashoff,
D., Shah, N.P., Sawyers, C., Spiteri, E., Nanan-
gud, G. & Rao, P.N. (2011) Frequent EVI1
containingt(3;5)
band3q26.
translocations in myeloid blast crisis CML that
evolves through tyrosine kinase inhibitors. Can-
cer Genetics, 204, 392–397.
Pendergast, A.M., Quilliam, L.A., Cripe, L.D., Bas-
sing, C.H., Dai, Z., Li, N., Batzer, A., Rabun, K.
M., Der, C.J., Schlessinger, J. & Gishizky, M.L.
(1993) BCR-ABL-induced oncogenesis is medi-
ated by direct interaction with the SH2 domain
of the GRB-2 adaptor protein. Cell, 75, 175–185.
Russell, M., Thompson, F., Spier, C. & Taetle, R.
(1993) Expression of the EVI1 gene in chronic
myelogenous leukemia in blast crisis. Leukemia,
7, 1654–1657.
Sellers, S., Gomes, T.J., Larochelle, A., Lopez, R.,
Adler, R., Krouse, A., Donahue, R.E., Childs, R.
W. & Dunbar, C.E. (2010) Ex vivo expansion of
retrovirally transduced primate CD34(+) cells
results in overrepresentation of clones with
MDS1/EVI1 insertion sites in the myeloid line-
age after transplantation. Molecular Therapy, 18,
1633–1639.
Skorski, T., Bellacosa, A., Nieborowska- Skorska, M.
N., Majewski, M., Martinez, R., Choi, J.K., Trotta,
R., Wlodarski, P., Perrotti, D., Chan, T.O., Wasik,
M.A., Tsichlis, P.N. & Calabretta, B. (1997)
Transformation of hematopoietic cells by BCR/
ABL requires activation of a PI-3k/Akt-dependent
pathway. EMBO Journal, 16, 6151–6161.
Smith, D.L., Burthem, J. & Whetton, A.D. (2003)
Molecular pathogenesis of chronic myeloid leu-
kaemia. Expert Reviews in Molecular Medicine, 5,
1–27.
Stevens-Kroef, M., Poppe, B., van Zelderen-Bhola,
S., van den Berg, E., van der Blij-Philipsen, M.,
Geurts van Kessel, A., Slater, R., Hamers, G.,
Michaux, L., Speleman, F. & Hagemeijer, A.
(2004) Translocation t(2;3)(p15-23;q26-27) in
myeloid malignancies: report of 21 new cases,
clinical, cytogenetic and molecular genetic fea-
tures. Leukemia, 18, 1108–1114.
Suzukawa, K., Taki, T., Abe, T., Asoh, H., Kamada,
N., Yokota, J. & Morishita, K. (1997) Identifica-
tion of translocational breakpoints within the
intron region before the last coding exon (exon
12) of the EVI1 gene in two cases of CML-BC
with inv(3)(q21q26). Genomics, 42, 356–360.
Valent, P. (2010) Standard treatment of Ph+ CML
in 2010: how, when and where not to use what
BCR/ABL1 kinase inhibitor? European Journal of
Clinical Investigation, 40, 918–931.
Wetzler, M., Talpaz, M., Van Etten, R.A., Hirsch-
Ginsberg, C., Beran, M. & Kuzrock, R. (1993)
Subcellular localisation of Bcr, Abl and Bcr-Abl
proteins in normal and leukemic cells and
correlation of expression with myeloid differen-
tiation. Journal of Clinical Investigation, 92,
1925–1939.
Wieser, R. (2007) The oncogene and developmen-
talregulatorEVI1:
properties, and biological functions. Gene, 396,
346–357.
Wimmer, K., Vinatzer, U., Zwirn, P., Fonatsch, C.
& Wieser, R. (1998) Comparative expression
analysis of the antagonistic transcription factors
EVI1 and MDS1-EVI1 in murine tissues and
during in vitro hematopoietic differentiation.
Biochemical and Biophysical Research Communi-
cations, 252, 691–696.
Yuasa, H., Oike, Y., Iwama, A., Nishikata, I., Sug-
iyama, D., Perkins, A., Mucenski, M.L., Suda, T.
& Morishita, K. (2005) Oncogenic transcription
factor Evi1 regulates hematopoietic stem cell
proliferation through
EMBO Journal, 24, 1976–1987.
expression, biochemical
GATA-2 expression.
S. Roy et al
456
ª 2012 Blackwell Publishing Ltd,
British Journal of Haematology, 2012, 157, 446–456