Transcriptional activity and nuclear localization of Cabut, the Drosophila ortholog of vertebrate TGF-β-inducible early-response gene (TIEG) proteins.

Abstract

Cabut (Cbt) is a C(2)H(2)-class zinc finger transcription factor involved in embryonic dorsal closure, epithelial regeneration and other developmental processes in Drosophila melanogaster. Cbt orthologs have been identified in other Drosophila species and insects as well as in vertebrates. Indeed, Cbt is the Drosophila ortholog of the group of vertebrate proteins encoded by the TGF-ß-inducible early-response genes (TIEGs), which belong to Sp1-like/Krüppel-like family of transcription factors. Several functional domains involved in transcriptional control and subcellular localization have been identified in the vertebrate TIEGs. However, little is known of whether these domains and functions are also conserved in the Cbt protein.
To determine the transcriptional regulatory activity of the Drosophila Cbt protein, we performed Gal4-based luciferase assays in S2 cells and showed that Cbt is a transcriptional repressor and able to regulate its own expression. Truncated forms of Cbt were then generated to identify its functional domains. This analysis revealed a sequence similar to the mSin3A-interacting repressor domain found in vertebrate TIEGs, although located in a different part of the Cbt protein. Using β-Galactosidase and eGFP fusion proteins, we also showed that Cbt contains the bipartite nuclear localization signal (NLS) previously identified in TIEG proteins, although it is non-functional in insect cells. Instead, a monopartite NLS, located at the amino terminus of the protein and conserved across insects, is functional in Drosophila S2 and Spodoptera exigua Sec301 cells. Last but not least, genetic interaction and immunohistochemical assays suggested that Cbt nuclear import is mediated by Importin-α2.
Our results constitute the first characterization of the molecular mechanisms of Cbt-mediated transcriptional control as well as of Cbt nuclear import, and demonstrate the existence of similarities and differences in both aspects of Cbt function between the insect and the vertebrate TIEG proteins.

Full text

Page 1

Transcriptional Activity and Nuclear Localization of
Cabut, the Drosophila Ortholog of Vertebrate TGF-b-
Inducible Early-Response Gene (TIEG) Proteins
Yaiza Belacortu1, Ron Weiss2, Sebastian Kadener2, Nuria Paricio1*
1Departamento de Gene ´tica, Facultad CC Biolo ´gicas, Universidad de Valencia, Burjasot, Spain, 2Department of Biological Chemistry, The Alexander Silberman Institute of
Life Sciences, Hebrew University of Jerusalem, Edmond J. Safra Campus, Givat-Ram, Jerusalem, Israel
Abstract
Background: Cabut (Cbt) is a C2H2-class zinc finger transcription factor involved in embryonic dorsal closure, epithelial
regeneration and other developmental processes in Drosophila melanogaster. Cbt orthologs have been identified in other
Drosophila species and insects as well as in vertebrates. Indeed, Cbt is the Drosophila ortholog of the group of vertebrate
proteins encoded by the TGF-ß-inducible early-response genes (TIEGs), which belong to Sp1-like/Kru ¨ppel-like family of
transcription factors. Several functional domains involved in transcriptional control and subcellular localization have been
identified in the vertebrate TIEGs. However, little is known of whether these domains and functions are also conserved in
the Cbt protein.
Methodology/Principal Findings: To determine the transcriptional regulatory activity of the Drosophila Cbt protein, we
performed Gal4-based luciferase assays in S2 cells and showed that Cbt is a transcriptional repressor and able to regulate its
own expression. Truncated forms of Cbt were then generated to identify its functional domains. This analysis revealed a
sequence similar to the mSin3A-interacting repressor domain found in vertebrate TIEGs, although located in a different part
of the Cbt protein. Using b-Galactosidase and eGFP fusion proteins, we also showed that Cbt contains the bipartite nuclear
localization signal (NLS) previously identified in TIEG proteins, although it is non-functional in insect cells. Instead, a
monopartite NLS, located at the amino terminus of the protein and conserved across insects, is functional in Drosophila S2
and Spodoptera exigua Sec301 cells. Last but not least, genetic interaction and immunohistochemical assays suggested that
Cbt nuclear import is mediated by Importin-a2.
Conclusions/Significance: Our results constitute the first characterization of the molecular mechanisms of Cbt-mediated
transcriptional control as well as of Cbt nuclear import, and demonstrate the existence of similarities and differences in both
aspects of Cbt function between the insect and the vertebrate TIEG proteins.
Citation: Belacortu Y, Weiss R, Kadener S, Paricio N (2012) Transcriptional Activity and Nuclear Localization of Cabut, the Drosophila Ortholog of Vertebrate TGF-b-
Inducible Early-Response Gene (TIEG) Proteins. PLoS ONE 7(2): e32004. doi:10.1371/journal.pone.0032004
Editor: Andreas Bergmann, University of Massachusetts Medical School, United States of America
Received November 14, 2011; Accepted January 17, 2012; Published February 16, 2012
Copyright: ? 2012 Belacortu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: YB was supported by a predoctoral fellowship from the Gobierno de La Rioja. This work was supported in part by grants from Ministerio de Educacio ´n y
Ciencia (BFU2004-00498 and BFU2007-63213) and Consellerı ´a d’Empresa, Universitat i Ciencia (PROMETEO/2010/081 and ACOMP/2010/242) to NP, and by the
Career Development Award (HFSP) and Israel Science Foundation personal grant to SK. The funders had no role in study design, data collection and analysis,
decision to publish, or preparation of the manuscript. No additional external funding received for this study.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: nuria.paricio@uv.es
Introduction
cabut (cbt) encodes a Drosophila transcription factor (TF)
containing three C2H2 zinc finger motifs at the carboxy (C)
terminus and a serine-rich (SR) region at the amino (N) terminus
[1]. This protein is involved in dorsal closure during Drosophila
embryogenesis [1], but it is also required for other developmental
processes such as the ecdysone response [2], neuroendocrine cell
remodeling [3], epithelial regeneration [4], circadian rhythms [5],
axon guidance and synaptogenesis [6,7], pole cell formation [8],
cell growth [9,10], autophagic cell death [11], cell cycle
progression (A.J. Katzaroff and E.A. Bruce, personal communi-
cation) and cell proliferation and patterning [12]. Experiments in
Drosophila embryos and S2 cells have shown that Cbt is a nuclear
protein, although it is also present in axons in the central and
peripheral nervous systems [13]. Cbt orthologs have been
identified in other Drosophila species and insects, including the
mosquito (Anopheles gambiae and Aedes aegypti), red flour beetle
(Tribolium castaneum), honeybee (Apis mellifera) and silkworm (Bombyx
mori), as well as in other invertebrate organisms such as ascidians,
echinoderms and crustaceans [14,15]. The expression patterns of
cbt transcripts and proteins during embryonic development are
highly conserved among Drosophilidae [13,14]. Interestingly, Cbt
also presents high similarity to the vertebrate proteins encoded by
the TGF-b-inducible early-response genes (TIEGs) [14,16] and
has also been named Drosophila TIEG (dTIEG) [12].
TIEG proteins belong to subgroup III of the Sp1-like/Kru ¨ppel-
like family of TFs, which contain three highly conserved C-
terminal C2H2-type zinc finger motifs that mediate binding to GC-
rich promoter sequences [17,18,19,20,21]. Their expression is
regulated by a plethora of growth factors (e.g., TGF-ß superfam-
ily), cytokines (e.g., BMP family and activin A) and hormones (e.g.,
PLoS ONE | www.plosone.org1 February 2012 | Volume 7 | Issue 2 | e32004

Page 2

estrogens) (reviewed in [20]). Several proteins of this family have
been characterized, including TIEG1 (Kru ¨ppel-like factor 10,
KLF10) and TIEG3 (KLF11) in humans and mice, and and
TIEG2/3 (KLF11) in mice (17,19,20,21, reviewed in [18]). They
have been also identified in rat, monkey, pig and zebrafish genomes
[14,22]. TIEG proteins are involved in numerous processes,
including, among others, proliferation, apoptosis, differentiation,
cancer and circadian rhythms [17,23,24,25,26,27,28,29,30]. These
proteins can function as either transcriptional repressors [31,32] or
activators [32,33,34,35], depending on the cellular context, the
promoter to which they bind and the coregulators with which they
interact [33,34,35]. Several studies have identified and character-
ized functional domains in TIEG proteins. One proline-rich (PR)
region and three repression domains (R1, R2 and R3) were
identified at the N-terminal region of TIEG proteins [19,31].
Interestingly, a mammalian mSin3A-interacting domain (SID) was
identified in the R1 domain of the TIEG3 protein and shown to be
essential for TIEG3-mediated transcriptional repression in cell
culture [31,32]. This domain interacts with the co-repressor
mSin3A, which inhibits transcriptional activation of target genes
by histone deacetylation and subsequent remodeling of chromatin
structure [36]. Different sequences are found in the R2 and R3
domains [31]. Moreover, theC-terminal end ofTIEG3contains the
DNA-binding domain (DBD) and an additional downstream
domain, both of which are able to activate transcription in OLI-
neu and HeLa cells [31,32]. More recently, other domains involved
in transcriptional regulation have been identified in TIEG proteins,
including an N-terminal domain in TIEG1 which interacts with the
enzyme Jumonji AT-rich interactive domain 1B/lysine-specific
demethylase 5B (JARID1B/KDM5B) and mediates transcriptional
repression [37], and a C-terminal domain in TIEG2 that interacts
with the p300 co-activator to activate expression of the Pdx1 gene
[33]. Regarding their nuclear localization, TIEGs and other KLF
proteins, contain a bipartite NLS within the zinc finger domains,
that is required for transport to the nucleus [32,38,39]. In general,
NLSs consist of either one (monopartite) or two (bipartite) stretches
of basic amino acids (usually arginine (R) and lysine (K)) separated
by an intervening region of 10–12 residues and recognized by
protein carriers called importins [40]. The NLSs frequently overlap
with DBDs [41], as occurs in the TIEG3 protein [32]. Because
nuclear transport of TFs is essential for cellular function, regulation
of TF nuclear availability through NLSs directly affects gene
expression, cell growth and proliferation [42].
Cbt is the Drosophila ortholog of vertebrate TIEG proteins
[14,16] and shares functions with several family members, e.g., rat
TIEG1 and murine TIEG3, as it is involved in circadian rhythms
as well as cell proliferation and positive regulation of TGF-b
signaling [5,12]. Regarding its transcriptional activity, previous
results suggested that Cbt may function as an activator of gene
expression. We showed that decapentaplegic (dpp) expression was
downregulated at the leading edge of the lateral epidermal sheets
during dorsal closure in cbt mutant embryos [1]. Cbt also positively
regulates the expression of STAT92E, spalt (sal) and optomotorblind
(omb) genes in wing imaginal discs [12]. Although these results
suggest that Cbt may activate gene expression in embryos and
wing discs, it is not clear whether the transcriptional regulation of
these target genes is direct or indirect. In the present study, we
performed a functional characterization of the Cbt protein by
examining its transcriptional regulatory potential and identifying
its functional domains. Gal4-based transcriptional assays in S2
cells demonstrated that Cbt is a transcriptional repressor and
contains a SID similar to the one identified in TIEG proteins
[31,32]. We also report that Cbt can downregulate its own
expression, probably by directly binding to a sequence located
1 kb upstream of the gene’s transcription start site. Finally, we
provide evidence that Cbt nuclear localization is mediated by a
monopartite NLS located at the N-terminal region of the protein
(71PNKKPRL77), which is conserved in Cbt orthologs from other
Drosophila species and insects. Genetic interaction assays and
immunostaining using importin-a mutant strains suggested that the
Importin-a2 protein is involved in Cbt nuclear import in
Drosophila. Together, these results expand our understanding of
the mechanisms of Cbt transcriptional regulation and nuclear
import, which reveal the biochemical similarities and differences
between vertebrate TIEG proteins and Cbt.
Materials and Methods
Plasmid constructs
pIE-b-GalCbt1–428, peGFP-Cbt1–428and pIE-Gal4 constructs
were generated by in-frame cloning of the cbt and Gal4 coding
regions, obtained by PCR amplification using the Pwo Polymerase
(Roche diagnostics GmbH, Mannheim, Germany) and the oligos
described in Table 1, into the pIE-b-Gal vector without b-Gal stop
using the SalI- BamHI sites [43], the peGFP-C3 vector (Clontech
Laboratories, Mountain View, CA) using the EcoRI-Asp718I sites
and the pIE1-3 vector (Novagen, Madison, WI, USA) using the
NotI-Asp718I sites, respectively. Other constructs used in this
work were obtained by PCR amplification using pIE-b-GalCbt1–
428and peGFPCbt1–428as templates and the oligos described in
Table 1, followed by cloning into the pIE-b-Gal, peGFP-C3 and
pIE-Gal4 vectors. All of the constructs were confirmed by DNA
sequencing. The pG5DE5tkLuc plasmid, which contains the
luciferase gene under the control of the UAS sequence, was a gift of
Dr. Courey (UCLA, Los Angeles, CA, USA). Site-directed
mutagenesis was carried out on the pIE-b-GalCbt1–77construct
to mutate lysines 73 and 74 (K73 and K74) to asparagine (N).
Mutagenesis was performed by GenScript (NJ, USA).
Fly stocks.
For genetic interaction assays, a sev-Gal4.UAS-
CbtFLline was generated via recombination. The following lines
were obtained from the Bloomington Stock Center (http://
flystocks.bio.indiana.edu/): y1w*; P{EP}kapa1G4113, y1w67c23;
P{EPgy2}penEY09095, w1118; P{EP}kapa3CG8397/TM6C, Sb1and
71B-Gal4. The w;impa2D14/Cyo Actin-GFP stock [44] was a gift of
Dr. Schwarz (Harvard Medical School, Boston, MA, USA). The
following importin RNAi lines were obtained from the Vienna
Drosophila RNAi Center (http://stockcenter.vdrc.at/control/main):
w1118;P {GD13960}v28920/Cyo, w1118;P {GD10665}v34265 and
w1118;P {GD14213}v36104. AllDrosophilastrains were maintained at
25uC.
Cell culture and transfection conditions
Drosophila melanogaster Schneider 2 cells (S2) and Spodoptera exigua
cells (Sec301) were grown at 25uC in Schneider’s Drosophila
Medium with L-Glutamine (Biological Industries, Jerusalem,
Israel/Invitrogen, Carlsbad, CA, USA) supplemented with 10%
fetal bovine serum (FBS, Invitrogen) and 1% penicillin/strepto-
mycin (Invitrogen). Chinese hamster ovary (CHO-K1) cells from
Cricetulus griseus were grown at 37uC and 5% CO2in DMEM/F-12
medium (Gibco/Invitrogen) supplemented with 10% FBS and 1%
penicillin/streptomycin. For subcellular localization assays, 16106
cells/ml were seeded onto coverslips in 24-well plates. After 24 h,
cells were transfected with 0.5–1 mg of DNA for 5 h using 8 ml of
Cellfectine reagent (Invitrogen) for insect cells and 6 ml of
FugeneHD (Roche) for CHO-K1 cells.
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org2February 2012 | Volume 7 | Issue 2 | e32004

Page 3

Table 1. PCR-generated constructs and associated primers.
ConstructOligonucleotides 59-39
pIE-b-GalCbt1–428
F (SalI):ACGCGTCGACGGGCGGCGGCATGGACATGGATACCTTGC
R (BamHI):CGCGGATCCCGTCATCATCGCTGCAGTTGAAG
pIE-b-GalCbt262–428
F(SalI):GTCGACGCGGCCGCCCAGGCGGCGGCCA
R (BamHI):CGCGGATCCCGTCATCATCGCTGCAGTTGAAG
pIE-b-GalCbt1–141
F (SalI):ACGCGTCGACGGGCGGCGGCATGGACATGGATACCTTGC
R (BamHI):CGCGGATCCCGTCAGTTGACCCGCATGATGAC
pIE-b-GalCbt1–108
F (SalI):ACGCGTCGACGGGCGGCGGCATGGACATGGATACCTTGC
R (BamHI): CGGATCCCGTCACAGTGGGTGGTACTGAAC
pIE-b-GalCbt1–77
F (SalI):ACGCGTCGACGGGCGGCGGCATGGACATGGATACCTTGC
R (BamHI): CGCGGATCCCGTCACAAACGGGGTTTCTT
pIE-b-GalCbt1–70
F (SalI):ACGCGTCGACGGGCGGCGGCATGGACATGGATACCTTGC
R (BamHI): CGCGGATCCCGTCAAACCGCTATTTCGGGAGCCTCGTCTT
pIE-b-GalCbt1–70KKPR
F (SalI):ACGCGTCGACGGGCGGCGGCATGGACATGGATACCTTGC
R (BamHI):CGCGGATCCCGTCAACGGGGTTTCTTAACCGCTATTCG
pIE-b-Gal-PNKKPRL
F (NotI):GCGGCCGCATGAGCGAAAAATACATCG
R (SalI):CGCGTCGACTCAGTTTGCCCCAAAGAACAACCCTTTTTGACACCAGA
pIE-PNKKPRL-b-Gal F (NotI):GCGGCCGCATGCCCAACAAGAAACCCCGTTTGAGCGAAAAATACATCGTC
R(BamHI):GGATCCTTATTACGTCGACCCTTTTGACACCAGACCAAC
pIE-b-GalCbt37–77
F (SalI):ACGGGTCGACGAAGGCAAAGCTCAAG
R (Bam-HI):CGCGGATCCCGTCACAAACGGGGTTTCTT
peGFPCbt1–428
F (EcoRI): CCGGAATTCCGATGGACATGGATACCTTGC
R (EcoRI):TATGAATTCATGGACATGGATACCTTGC
peGFPCbt1–292
F (EcoRI): CCGGAATTCCGATGGACATGGATACCTTGC
R (KpnI/Asp718I):CGGGGTACCCTCAGGGTCGCTCGCCGGTGTG
peGFPCbt1–322
F (EcoRI): CCGGAATTCCGATGGACATGGATACCTTGC
R (KpnI/Asp718I): CGGGTACCCTCATTTCTTTTCACCGGTGTG
PeGFPCbt1–262
F (EcoRI): CCGGAATTCCGATGGACATGGATACCTTGC
R (KpnI/Asp718I):CGGGGTACCCTCAGATGCGACTTCTGGTGGC
PeGFPCbt262–428
F (KpnI/Asp718I):CCGGAATTCCGACGGCCGCCCAGGCGGCGGCCA
R (EcoRI):TATGAATTCATGGACATGGATACCTTGC
pIE-Gal4STOP
F(NotI):AATGCGGCCGCAGACATGAAGCTACTGTCTTCT
R (BamHI):CGCGGATCCGTACAGTCAACTGTCTTTGACCTT
pIE-Gal4DStop
F(NotI):AATGCGGCCGCAGACATGAAGCTACTGTCTTCT
R (BamHI):CGCGGATCCGTACAGACTGTCTTTGACCTT
pIE-Gal4Cbt1–428
F (BamHI): CGCGGATCCGCATGGACATGGATACC
R (BamHI):CGCGGATCCGTCATCGCTGCACTTGAAGCAG
pIE-Gal4Cbt1–262
F(BamHI):CGCGGATCCGCATGGACATGGATACC
R (BamHI):CGCGGATCCGTCAGTAGATGCGACTTCTGGTGG
pIE-Gal4Cbt1–182
F (BamHI): CGCGGATCCGCATGGACATGGATACC
R (BamHI):CGCGGATCCGTCATGGTGTCTCGGGTGTTT
pIE-Gal4Cbt1–165
F (BamHI): CGCGGATCCGCATGGACATGGATACC
R (BamHI):CGCGGATCCGAGGAGGTCATCGCGAGTTCATTTTGAACTTGAGATT
pIE-Gal4Cbt173–428
F (BamHI):CGCGGATCCGAGGAGGTCGCGAATGGCCGCCCAGGCGGCGG
R (BamHI):CGCGGATCCGTCATCGCTGCACTTGAAGCAG
pIE-Gal4Cbt261–347
F (BamHI):CGCGGATCCGCATGATCTACGAGTGCAGT
R (BamHI): CGCGGATCCGCTCAGTCCTTGTTGTGCCG
pIE-Gal4Cbt345–428
F (BamHI):CGCGGATCCGCATGAACAAGGACAAGGCG
R (BamHI):CGCGGATCCGTCATGGACATGGATACCTTGC
pIE-Gal4Cbt261–389
F (BamHI):CGCGGATCCGCATGATCTACGAGTGCAGT
R (BamHI):CGCGGATCCGCTCAAGCGCTGGAGCCCGC
Sequences recognized by restriction enzymes (in parentheses) are underlined. The start and stop codons are in bold. F, forward primer; R, reverse primer.
doi:10.1371/journal.pone.0032004.t001
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org3 February 2012 | Volume 7 | Issue 2 | e32004

Page 4

Repression and UAS/Gal4-based transcriptional assays
For the repression assay, S2 cells were transfected with 0.5 mg of
the pMT-Cbt-V5 plasmid, 0.5 mg of the pHStinger-Prom1-2
plasmid (see [13]) and 0.1 mg of the PAC-cherry vector (to
normalize for transfection efficiency) in 6-well plates at 70–90%
confluence according to supplier’s recommendations (Transfection
Custom Insect Reagent, Mirus Bio Corp, Madison, WI).
Expression of the recombinant protein was induced by incubation
in medium containing 0.25/0.75 mM copper sulfate for 48 h.
Fluorescence was measured using a TECAN infinitH 200 plate
reader. For the UAS/Gal4 assays, S2 cells were co-transfected in
24-well plates with 0.075 mg of each construct, 0.1 mg of the
pG5DE5tkLuc vector and 0.1 mg of the PAC-Renilla vector to
normalize for transfection efficiency. The transfection protocol
was the same as for the repression assay. After 48 h, cells were
lysed and incubated with the Dual Luciferase Assay Kit (Promega,
Madison, WI, USA) following the manufacturer’s instructions.
Luciferase activity was measured using a Modulus single tube
multimode reader.
Immunochemistry and scanning electron microscopy
Cells were washed with phosphate-buffer saline (PBS) 16–24 h
after transfection, fixed in freshly prepared 4% paraformaldehyde/
PBS for 20 min, permeabilized with 0.1% Triton-X-100/PBS for
5 min,andblockedwith1%BSA/PBSfor30 min.Afterincubation
with rabbit anti-b-Gal (1:1000, Cappel/ICN Biomedicals, Ohio,
USA) and mouse monoclonal anti-Lamin (1:200) (Developmental
Studies Hybridoma Bank, Iowa, USA) antibodies for 2 h, cells were
washed three times with 0.5% BSA/PBS, incubated with anti-
rabbit-FITC (1:200, Calbiochem EMD Biosciences Inc., La Jolla,
CA) and anti-mouse-Cy3 (1:200, Invitrogen) antibodies for 1 h,
washed three times with PBS, mounted in Vectashield (Vector
Laboratory, Peterborough, UK) and examined under a Leica TCS
SP1 confocal microscope. Ovaries were dissected as described [45]
and stained using the anti-CbtDZn antibody [13]. Scanning
electron microscopy analysis of adult eyes was performed following
the critical point dry method using a Hitachi S4100 microscope, as
previously described [46].
Western blotting
Cells were collected 16–24 h after transfection, washed with
PBS and scraped into 50 ml of sodium dodecyl sulfate-polyacryl-
amide gel electrophoresis (SDS-PAGE) loading buffer. After
boiling, aliquots were subjected to 10% SDS-PAGE. Subsequent-
ly, proteins were electrotransferred to PDVF membranes (Roche)
and detected with rabbit anti-b-Gal (1:5000, Cappel) or anti-eGFP
(1:2000, Roche) primary antibodies. The secondary antibody was
peroxidase-labeled anti-rabbit (1:3000, Calbiochem). The ECL
western blotting detecting reagent (Pierce, Rockford, IL, USA) was
then used to reveal the chemiluminescence.
Computational analyses
PSORT II (http://psort.nibb.ac.jp/form2.html) and cNLS
Mapper (http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_
form.cgi) software programs were used to predict NLSs and nuclear
export signal (NESs). Multiple alignments of protein sequences were
performed with the ClustalW algorithm [47]. The automated
protein structure homology-modeling server SWISS-MODEL
(http://swissmodel.expasy.org/) was used to analyze secondary
structure.NetPhos (http://www.cbs.dtu.dk/services/NetPhos/)
and NetPhosK (http://www.cbs.dtu.dk/services/NetPhosK/) pro-
grams were used to predict putative phosphorylation sites and
specific kinase-binding sites. The GENPEPT database (invertebrate
and vertebrate sections; GenBank) was searched with the PX(K/
R)KX(R/L) string (where X=any or no amino acid) using the
Scansite program (http://scansite.mit.edu; Quick matrix method).
Results
Cabut acts as a potent transcriptional repressor and
regulates its own transcription
The UAS/Gal4 fusion system [48] was used in Drosophila S2
cells to determine the transcriptional repression and/or activation
activity of Cbt. Gal4 fusion proteins have little transcriptional
background interference in Drosophila cells because of their yeast
origin. For these experiments, we generated the pIE-Gal4Cbt1–428
construct, in which the full-length Cbt protein was fused to the
Gal4 DBD. This construct was cotransfected into S2 cells with a
reporter construct containing Gal4-binding sites upstream of the
firefly luciferase gene (the UAS-Luciferase vector). A significant
repression of luciferase transcription (,6-fold) was observed in this
experiment as compared to transfection with the Gal4 DBD alone
(Figure 1A). This result indicates that the Cbt full-length protein is
able to repress transcription. Interestingly, preliminary results
Figure 1. Cabut functions as a transcriptional repressor in S2 cells and regulates its own transcription. (A) Expression of Gal4Cbt1–428
led to repression of luciferase activity levels relative to a control Gal4 protein. Luciferase activity was measured 48 h after transfection. pRENILLA was
used to normalize for cell number, transfection efficiency, and general effects on transcription (luciferase activity=firefly luciferase/renilla luciferase).
(B) S2 cells transfected with Prom1-2-GFP as a control or co-transfected with Prom1-2-GFP and MT-cbt. The MT promoter was induced by exposing the
cells to medium containing copper (upper picture, no copper; lower picture, plus copper). Fluorescence levels were reduced following transcriptional
induction of Cbt by copper in cells co-transfected with Prom1-2-GPF and MT-cbt (left panels). Fluorescence was measured 48 h after induction (right
panel). pCHERRY was used for normalization (Fluorescence levels=GFP/CHERRY). In A and B, data are presented as the mean 6 SD of three replicates.
doi:10.1371/journal.pone.0032004.g001
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org4 February 2012 | Volume 7 | Issue 2 | e32004

Page 5

obtained in chromatin immunoprecipitation assays combined with
genomic microarrays (ChIP-on-chip) in Canton-S embryos during
dorsal closure (Y.B. and N.P. in collaboration with the
modENCODE Project, unpublished results) suggested that Cbt
was able to bind to a GC-rich genomic region 1 kb upstream of
the cbt transcriptional start site (2 L: 479789,480740, Figure S1).
Previous electrophoretic mobility shift assays (EMSAs) performed
using the Cbt DBD region have demonstrated Cbt binding to GC-
rich regions [49]. To confirm this result, we co-transfected
Drosophila S2 cells with a construct in which the expression of a
Cbt-V5 fusion protein was controlled by the methalotionein
promoter (MT-Cbt) and a plasmid containing that region (named
as Prom1-2 in [13]) fused to GFP (Prom1-2-GFP). To induce Cbt-
V5 expression, the transfected cells were grown in Cu-supple-
mented medium. Indeed, induction of Cbt expression led to a
significant reduction in GFP levels (Figure 1B). Taken together,
these results show that Cbt acts as a transcriptional repressor,
similar to the mammalian TIEG proteins, at least in S2 cells.
Moreover, these experiments also demonstrate that the cbt gene
autoregulates its own expression via a negative autoregulatory
feedback mechanism, as has been shown for several genes involved
in circadian rhythms [50,51,52]. However, this mechanism has
not been previously reported for vertebrate TIEG proteins.
Identification of transcriptional repressor domains in the
Cbt protein
Previous studies showed that the repressor activity of the human
TIEG1, TIEG2 and murine TIEG3 proteins in CHO-K1 and
OLI-neu cells is mediated by a Sin3A-interacting domain (SID)
(with an EAVEAL consensus sequence), which is required for its
interaction with the Sin3A co-repressor and is located at the N-
terminal region of the proteins within an a-helix motif [31,32].
Site-mutagenesis analyses revealed that the first alanine (A) residue
and the a-helical structure are important for the recognition of this
domain by the Sin3A co-repressor [53]. Because Cbt is able to
repress transcription in S2 cells, we decided to determine whether
the SID is conserved in the Drosophila protein. Multiple alignments
of Cbt and several vertebrate TFs such as MAD and members of
the Sp1 family (TIEG, BTEB), revealed that a similar domain,
with equivalent residues, is present in Cbt but in a different region
of the protein (168AAEVAL173in Figure 2A). Secondary structure
analysis of the Cbt protein using the SWISS-MODEL server [54]
Figure 2. Identification of domains required for Cabut’s transcriptional repressor activity. (A) Multiple alignment of the Sin3A interacting
domains (SID) from Drosophila Cbt and several vertebrate TFs such as the MAD protein and mebers of the Sp1 family (TIEG, BTEB). Note that this
domain is highly conserved in sequence (marked by a pink rectangle and residues in bold) but not with respect to location within the protein. (B)
Schematic representation of the CbtGal4 fusion constructs transfected into S2 cells to identify transcriptional regulatory domains in the Cbt protein.
The AAEVAL sequence is indicated in red and the C2H2zinc fingers in blue. (C) Degree of luciferase repression obtained in UAS/Gal4 assay in S2 cells
transiently transfected with the constructs shown in (B). Repression rate=luciferase activity of pIE-Gal4/luciferase activity of tested construct.
pRENILLA was used for normalization as in Fig. 1. Data are presented as the mean 6 SE (n$5). Note that removal of the AAEVAL sequence completely
abolishes the repressor activity of the Cbt protein (asterisks indicate p-value,0.01, t-Student’s test).
doi:10.1371/journal.pone.0032004.g002
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org5 February 2012 | Volume 7 | Issue 2 | e32004

Page 6

confirmed the conservation of an a-helix motif in the Cbt
AAEVAL sequence (Figure S2). The presence of this domain
could explain the transcriptional repressor activity of Cbt in S2
cells described above. Interestingly, this sequence is also conserved
in all Drosophila species analyzed (Figure S2), suggesting that Cbt
orthologs in these species may present a similar transcriptional
activity. To determine whether this sequence is responsible for
Cbt’s repressor activity and to identify other possible transcrip-
tional repression and/or activation domains in the protein, we
generated a collection of Cbt Gal4 DBD fusion proteins
(Figure 2B). Plasmids expressing these fusion proteins were
cotransfected with the UAS-Luciferase vector (as described in
Materials and Methods) into S2 cells, which endogenously express
the dSin3A co-repressor [55]. Our results show that fusion
proteins containing the AAEVAL sequence (pIE-Gal4Cbt1–428,
pIE-Gal4Cbt1–262, pIE-Gal4Cbt1–182) strongly repressed luciferase
expression (up to 5-fold) in transfected cells (Figure 2C). This
repressive effect is completely dependent on that sequence, as
cotransfection with the pIE-Gal4Cbt1–165construct fails to repress
the UAS-Luciferase reporter (Figure 2C). Thus, this result
indicates that the AAEVAL sequence is essential for Cbt-mediated
repression in S2 cells. In addition, we found that the C-terminal
region of the Cbt protein, which does not contain the SID (pIE-
Gal4173–428), was able to reduce luciferase expression by ,1.5-fold
(Figure 2C), thereby indicating that this region of the protein may
contain one or more repression domains close to the DBD.
Multiple alignments of the Drosophila Cbt orthologs revealed the
presence of two regions in the Cbt C terminus that were highly
conserved in all proteins analyzed (C4 and C5 in Figure S2). To
confirm this possibility and test the transcriptional activity of both
the DBD and the C4 and C5 conserved sequences, different
constructs were generated in which truncated Cbt proteins
containing only the Cbt DBD (pIE-Gal4Cbt261–347), the Cbt C-
terminal region including the C4 and C5 sequences (pIE-
Gal4Cbt345–428), and the Cbt DBD plus the C4 sequence (pIE-
Gal4Cbt261–389) were fused to the Gal4 DBD (Figure 2B) and
cotransfected with the UAS-Luciferase vector into Drosophila S2
cells. Our results show that the DBD of Cbt by itself is not able to
activate luciferase expression (Figure 2C). In addition, we found that
the C-terminal region of Cbt without the zinc finger domains
(compare pIE-Gal4 to Gal4Cbt345–428) can significantly repress
luciferase expression (,1.5-fold) (Figure 2C). Thus, our results show
that the conserved sequence 379LRAIAPA385, which we have
called REP1/C4 (Figure 2D and Figure S2) and which is not
present in the TIEG proteins, appears to have a mild repressive
effect on luciferase expression (Figure 2C) in the UAS/Gal4 assays
and could be in part responsible for the transcriptional repressor
activity of the Cbt protein.
The Cys2His2-zinc finger domains of Drosophila Cabut are
not essential for its nuclear localization in S2 cells but
function as an NLS in mammalian CHO-K1 cells
Proteins larger than 45 kDa in size are unable to pass the nuclear
membrane by passive diffusion [56]. Because we recently showed
that Cbt is a nuclear protein with a theoretical molecular weight of
48 kDa [13], we assumed that it contains at least one functional
NLS, although it could also be transported to the nucleus via an
interaction with another NLS-containing protein. Indeed, four
potential NLSs were identified in the Cbt protein using PSORT II
[57] and cNLSMapper [58] programs (Figure 3A). Two of these
Figure3.TheCabutzinc fingerregion isnotessentialfornuclear
localization in S2 cells. (A) Schematic representation of the Drosophila
Cbtprotein,inwhichthelocationsoftheSer-rich(SR)regionandtheDBD
are indicated. Sequences, coordinates and locations (arrows) of the
predicted NLSs are also indicated. (B) Multiple alignment of the second
andthird zinc fingers of murineTIEG1 andTIEG3,humanTIEG1andTIEG2
and Drosophila Cbt. Red lines below the alignment indicate the amino
acids included in the murine and human TIEG NLSs. (C) Schematic
representation of the b-GalCbt fusion constructs used to transfect S2
cells. The locations of the SR region and the DBD are indicated by boxes.
(D–F) Localization of b-Gal fusion proteins in S2 cells transiently
transfected with the constructs shown in (C). Cells were stained with
anti-b-Gal (red; first panel) and anti-Lam (green; second panel) to mark
nuclear membranes. The overlay panel depicts double staining of cells
with both antibodies, and the localization of the fusion proteins is shown
in the fourth panel (C, cytoplasmic; N, nuclear). Wild-type b-Gal was
locatedinthecytoplasm(D),but theb-GalCbtfusionproteintranslocated
to the nucleus (E). However, the Cbtzincfinger regionalonewas not able
to translocate b-Gal to the nucleus (F). Scale bar: 10 mm. (G) Western blot
of protein extracts from S2 cells transfected with the constructs shown in
(C) and stained with anti-b-Gal. (1) Non-transfected cells, (2) empty pIE-b-
Gal vector (,122 kDa), (3) pIE-b-GalCbt1–428(,160 kDa) and (4) pIE-b-
GalCbt262–428(,140 kDa). Cells transfected with the pIE-b-GalCbt1–428
construct presented some degradation that did not affect the subcellular
localization of the fusion protein.
doi:10.1371/journal.pone.0032004.g003
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org6 February 2012 | Volume 7 | Issue 2 | e32004

Page 7

putative NLSs were73KKPR76and71PNKKPRL77, which were
predicted by both programs and located in the N-terminal region.
The third sequence was a bipartite NLS, 162KMNRKRAAE-
VALPPVQTPETPVAKLVTPP190, which yielded the highest
score in the cNLSMapper program. The fourth sequence was
312RHKR315, which is located within the second Cbt zinc finger
domain and predicted by both programs. A similar sequence
(RHRR) was also found in the second zinc finger domain of the
murine TIEG3 protein and is included within a functional bipartite
NLS that is essential for TIEG3 nuclear import (Figure 3B) [19,32].
Because the zinc finger domains are highly conserved between Cbt
and the TIEG proteins (Figure 3B and [14]), we decided to test the
role of this putative NLS in Cbt nuclear localization. For doing so,
we transiently transfected Drosophila S2 cells with the pIE-b-
GalCbt262–428construct, in which the C-terminal region of Cbt
containing the zinc finger region was fused to the E. coli b-
Galactosidase (b-Gal, 116 kDa) cytoplasmic protein (Figure 3C, D).
The pIE-b-GalCbt1–428construct, in which b-Gal is fused in frame
to the full-length Cbt protein (Figure 3C), was used as a control. In
these experiments, anti-Lamin (Lam) immunostaining was used to
define the nuclear region. Double staining of the transfected cells
with anti-b-Gal and anti-Lam antibodies showed that while the b-
GalCbt1–428 protein was exclusively localized in the nucleus
(Figure 3E), b-GalCbt262–428was completely excluded from this
cellular compartment, remaining in the cytoplasm (Figure 3F).
Western blot analyses of transfected cell extracts were performed to
confirm the integrity ofthe fusion proteins (Figure 3G).These assays
showed that while the full-length Cbt protein appears to be partially
degraded in S2 cells extracts (without affecting the NLS), the b-
GalCbt262–428protein appears to be stable (Figure 3G). This result
demonstrates that the putative NLS identified in the Cbt zinc finger
region does not play a role in the protein’s nuclear localization and
suggests that the Cbt NLS is probably located at its N terminus.
However,dueto the high similaritybetween theCbtand TIEG zinc
finger domains, where essential basic amino acids are conserved
(Figure 3B and [32]), we tested whether this region of the Cbt
protein could function as an NLS in mammalian cells. Several
expression constructs were generated: truncated Cbt proteins
lacking the N-terminal region of Cbt (peGFPCbt262–428), the
complete zinc finger region (peGFPCbt1–262), the third zinc finger
(peGFFCbt1–322), and both the second and third zinc fingers
(peGFPCbt1–292) were fused to eGFP (Figure 4A) and used to
transiently transfect mammalian CHO-K1 cells. We found that the
eGFP protein alone localizes to both the cytoplasm and the nucleus
bypassivediffusionduetoitsmolecularweight(30 kDa)(Figure4B).
Cells transfected with the peGFPCbt1–428 or peGFPCbt262–428
construct showed exclusively nuclear eGFP localization (Figure 4C,
D). However, cells transfected with deletion constructs affecting the
zinc finger domains presented both cytoplasmic and nuclear eGFP
signals (Figure 4E–G).Western blot analysis of cell extracts showed
no degradation of the fusion proteins (Figure 4H). These results are
in agreement with those obtained for the TIEG3 protein in HeLa
and OLI-neu cells [32] and indicate that the Cbt bipartite NLS
within the second and third zinc fingers is functional in mammalian
cells, suggesting that different nuclear import mechanisms for this
protein are being used in Drosophila and mammalian cells.
The PNKKPRL motif is necessary for Cbt nuclear
localization
Our results indicate that a functional NLS is located within the
N-terminal region of the Cbt protein. To test whether any of the
predicted sequences in that region are required for Cbt nuclear
localization (Figure 3A), we transiently transfected S2 cells with
several deletion constructs. First, we generated pIE-bGalCbt1–141
Figure 4. The Cabut zinc finger region is not essential for
nuclear localization in CHO-K1 cells. (A) Schematic representation
of the eGFPCbt fusion constructs used to transfect CHO-K1 cells. The
locations of the SR region (black rectangle) and the zinc fingers (1, 2, 3,
grey rectangles) are indicated. (B–G) Localization of eGFP fusion
proteins in CHO-K1 cells transiently transfected with the constructs
shown in (A). Cells were immunostained with anti-eGFP (green, first
panel) and DAPI (blue; second panel). Differential interference contrast
(DIC) was used to visualize cell boundaries (third panel). The overlay
panel shows DIC and anti-eGFP staining. The localization of the fusion
proteins is shown in the fourth panel (C, cytoplasmic; N, nuclear). Wild-
type eGFP was located in the cytoplasm and the nucleus (B), but the
eGFPCbt fusion protein translocates to the nucleus (C). With the
exception of the peGFPCbt262–428fusion protein, which lacks the N-
terminal region of the Cbt protein (G), all Cbt deletions affecting the
zinc finger region showed cytoplasmic localization (D–F). Scale bar:
10 mm. (H) Western blots of protein extracts from CHO-K1 cells
transfected with the constructs shown in (A) and stained with anti-
GFP. (1) Non-transfected cells, (2) empty peGFP vector (,27 kDa), (3)
peGFPCbt1–428(,70 kDa), (4) peGFPCbt1–322(,60 kDa), (5) peGFPCbt1–
292(,60 kDa) and (6) peGFPCbt1–262(,50 kDa).
doi:10.1371/journal.pone.0032004.g004
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org7 February 2012 | Volume 7 | Issue 2 | e32004

Page 8

and pIE-bGalCbt1–108 constructs, encoding b-Gal fused to
truncated Cbt proteins lacking either the bipartite NLS,
162KMNRKRAAEVALPPVQTPETPVAKLVTPP190,
sequence plus the SR domain (Figure 5A). Our results showed
that both b-GalCbt fusion proteins were able to translocate to the
nucleus (Figure 5B–C), thus indicating that neither the predicted
bipartite NLS nor the SR region plays any role in Cbt nuclear
localization and that an active NLS sequence is still retained in the
truncated proteins. We next wanted to determine whether the
overlapping73KKPR76and71PNKKPRL77sequences could act
as functional NLSs. To do so, we generated constructs in which b-
Gal was fused to Cbt N termini with (pIE-b-GalCbt1–77) or
without these sequences (pIE-b-GalCbt1–70) (Figure 5A) and used
them to transfect S2 cells. Immunostaining revealed that the
removal of both sequences completely abolished the nuclear
transport of the fusion proteins (Figure 5D, E), thus indicating that
a functional NLS is present in this region. We next wanted to
determine whether the KKPR residues, which are included within
the PNKKPRL sequence and predicted as an NLS by the PSORT
II program, were sufficient to target Cbt to the nucleus. Therefore,
we generated the pIE-b-GalCbt1–70KKPRconstruct (Figure 5A), in
which only the KKPR sequence is present. Immunostaining of
transfected S2 cells showed that the fusion protein was localized in
both the nucleus and the cytoplasm (Figure 5F). Because the
integrity of the protein was confirmed by western blot analysis
(Figure 5K), this observation indicates that the nuclear transport of
b-GalCbt1–70KKPRis not efficient and suggests that the additional
residues in the long NLS are necessary to increase the efficiency/
rate of nuclear transport (compare Figure 5D to Figure 5F). We
next wanted to determine whether the PNKKPRL sequence
was sufficient to translocate a reporter protein to the nuc-
leus. Therefore, we generated the pIE-b-Gal-PNKKPRL and
pIE-PNKKPRL-b-Gal constructs, in which the PNKKPRL sequence
was fused in frame to either the C- or the N-terminal region of the
b-Gal protein (Figure 5A). Immunostaining of transfected S2 cells
revealed that the b-Gal protein was transported to the nucleus in
both cases (Figure 5H–I), indicating that the PNKKPRL sequence
is sufficient for nuclear import. Interestingly, this sequence is very
similar to the SV40 large T antigen NLS (PKKKRKV) [59]. To
determine which residues within the PNKKPRL sequence are
important for Cbt nuclear transport, we performed site-directed
mutagenesis of the basic lysine 73 and lysine 74 (K73 and K74)
residues to asparagine (N) in the pIE-b-GalCbt1–76 construct
(designated pIE-b-GalCbtK73N–K74Nin Figure 5A). Immunostain-
ing of transfected S2 cells revealed that mutation of both K
residues abolished Cbt nuclear transport (Figure 5J), indicating
that they are essential for this process. Nuclear transport of the b-
orthat
Figure 5. The71PNKKPRL77sequence is the NLS of the Cabut
protein. (A) Schematic representation of the b-GalCbt fusion
constructs transfected into S2 cells to determine whether the
162KMNRKRAAEVALPPVQTPETPVAKLVTPP190 and/or
71PNKKPRL77 se-
quences are functional NLSs. The Serine-rich (SR) domain is shown in
black and the PNKKPRL sequence in fuchsia. (B–J) Localization of b-Gal
fusion proteins in S2 cells transiently transfected with the constructs
shown in (A). Cells were stained with anti-b-Gal (red; first panel) and
anti-Lam (green; second panel) to mark nuclear membranes. The
overlay panel depicts double staining of cells with both antibodies, and
the localization of the fusion proteins is shown in the fourth panel (C,
cytoplasmic; N, nuclear). Note that fusion proteins lacking or containing
a mutated 71PNKKPRL77 sequence (E and J) were cytoplasmic. The
71PNKKPRL77sequence was able to translocate b-Gal to the nucleus
when fused to either the N- or the C-terminus of the protein (H and I).
Scale bar: 10 mm. (K) Western blots of protein extracts from S2 cells
transfected with the constructs shown in (A) and stained with anti-b-
Gal. (1) pIE-b-GalCbt1–141(,140 kDa), (2) pIE-b-GalCbt1–108(,140 kDa),
(3) and (7) pIE-b-GalCbt1–77 (,135 kDa), (4) pIE-b-GalCbt1–70
(,135 kDa), (5) pIE-PNKKPRL-b-Gal (,120 kDa), (6) pIE-b-Gal-PNKKPRL
(,120 kDa) and (8) pIE-b-Gal-CbtK73N–K74N(,135 kDa).
doi:10.1371/journal.pone.0032004.g005
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org8February 2012 | Volume 7 | Issue 2 | e32004

Page 9

Gal protein fused to the PNKKPRL sequence was not perfectly
efficient, as some of the protein remained in the cytoplasm. It is
therefore likely that either additional regions of the Cbt protein or
other factors must be involved in its nuclear transport. Because no
other NLSs in the Cbt protein were predicted by the utilized
bioinformatic programs, it is possible that other sequences in the
N-terminal region of the protein could be required together with
the NLS for Cbt nuclear import. Multiple alignments of the Cbt
Drosophila orthologs allowed us to identify three highly conserved
regions in that part of the protein (C1, C2 and C3 in Figure S2).
To determine whether these regions could act cooperatively with
the PNKKPRL sequence in Cbt nuclear import, we generated a
construct in which the b-Gal protein was fused to a Cbt fragment
encompassing residues 37–77 (pIE- b-GalCbt37–77) (Figure 5A),
which lacked C1 and part of C2 and only contained C3 and the
NLS. Immunostaining of transfected S2 cells revealed exclusive
nuclear localization of the fusion protein, suggesting that the C3
region, but not the C1 or C2 region, may be required for Cbt
nuclear translocation and could act cooperatively with the NLS
(Figure 5G). It has been shown that post-translational modifica-
tions involving phosphorylation/dephosphorylation of NLSs and
adjacent residues represent one of the mechanisms used to regulate
nuclear import kinetics (reviewed in [60,61]). It is therefore
possible that Cbt nuclear import could be regulated by despho-
sphorylation/phosphorylation events (see Discussion).
Taken together, these results demonstrate that the PNKKPRL
sequence in the Cbt protein is a functional NLS motif in which the
central K residues are essential for nuclear transport and the P, N,
R and leucine (L) residues are probably required to increase
efficiency. We also speculate that the C3 region located upstream
of the NLS might regulate this process and thus confirm previous
observations regarding the regulatory roles of sequences flanking
classical NLSs.
The PNKKPRL NLS is conserved and functional in Cbt
insect orthologs
To determine whether the Cbt NLS and other residues
important for its nuclear import are conserved in other Drosophila
species and insects, we performed multiple alignments of the
amino acid sequences of their Cbt orthologs. Our results showed
that the PNKKPRL sequence was conserved in the twelve
Drosophila species analyzed (Figure 6A and Figure S2). Consistent
with this, we have recently demonstrated the nuclear localization
of Cbt proteins in several Drosophila species [13]. Moreover, P and
basic residues in the PNKKPRL sequence were also found in the
Cbt proteins of several other insects, including Apis mellifera, Culex
quinquefasciatus, Aedes aegyti and Tribolium castaneum, although they
present a divergent N-terminal region (Figure 6A). Similar
analyses in other Cbt orthologs of Ciona intestinalis, Strongylocentrotus
purpuratus, Daphnia pulex and vertebrate TIEGs revealed that the
PNKKPRL sequence is not present in these proteins (data not
shown). Thus, the consensus NLS of insect Cbt orthologs may be
PX(K/R)KX(R/L) (X=any residue). To test whether the Cbt
NLS is functional in other insects, we used the pIE-b-GalCbt1–
428, pIE-b-GalCbt1–77 and pIE-b-GalCbtK73N–K74N constructs
(Figure 5A) to transiently transfect Sec301 cells from the beet
armyworm Spodoptera exigua. Immunostaining revealed that both
the full-length Cbt protein and a truncated form containing the
PNKKPRL NLS but lacking the zinc finger domains and the
predicted bipartite NLS were able to translocate the b-GalCbt
fusion protein to the nucleus in S. exigua cells (Figure 6B–C).
However, when the construct encoding b-Gal fused to a Cbt N-
terminal region (1–77) with a mutated PNKKPRL sequence
(pIE- b-GalCbtK73N–K74N) was transfected, the fusion protein was
exclusively localized in the cytoplasm, as in Drosophila S2 cells
(compare Figure 6D to Figure 5J). Western blot analyses
confirmed that the proteins expressed in the transfected cells
were of the correct size (Figure 6E). Taken together, these results
indicate that the PX(K/R)KX(R/L) consensus motif is evolu-
tionarily conserved and probably functional in insect Cbt
orthologs. Its absence from TIEG proteins suggests that it
evolved after the divergence between vertebrates and inverte-
brates.
Further searches in the GENPEPT protein database using the
SCANSITE software [62] revealed a total of 57 proteins
containing the PX(K/R)KX(R/L) sequence, 32 from invertebrates
and 25 from vertebrates (data not shown). Among the identified
invertebrate proteins, 53% were nuclear, including the Drosophila
C2H2-zinc finger TFs Kru ¨ppel, Snail, Escargot and Scratch and
the A. gambiae reverse transcriptase protein (Q868R2), suggesting
that this sequence could be involved in the nuclear localization of
other proteins, as predicted by the PSORT II program.
Interestingly, the PX(K/R)KX(R/L) sequence is conserved and
functional in the human BRCA1 (BReast CAncer Type 1) protein,
a tumor suppressor protein involved in damaged DNA repair [63].
A606PKKNRLRRKS615sequence that is similar to the Cbt NLS
is involved in BRCA1 nuclear transport and interacts with the
hSRP1a/importin-a2 protein [64].
Importin-a2 is involved in Cbt nuclear import in ovaries
Next, we aimed to identify the molecular mechanism that
regulates Cbt nuclear import. The Cbt PNKKPRL motif presents
features of classical monopartite NLSs, matching the K(K/
R)X(K/R) consensus sequence required for importin-a/impor-
tin-b-based nuclear transport. Importin-a binds to NLS-bearing
proteins and functions as an adapter to access the importin-b-
dependent import pathway [65]. In Drosophila, three importin-a
proteins have been identified (reviewed in [66]): importin-a1
(impa1, Kapa1 or CG8548), importin-a2 (impa2, Kapa2, Pen or
CG4799) and importin-a3 (impa3, Kapa3 and CG9423) [67]. In
vitro binding studies and nuclear import assays revealed that both
NLSs and protein context mediate importin-a specificity for
substrate nuclear import [68]. It has been shown that most tissues
express all importin-a proteins, which probably perform redun-
dant functions. Indeed, all three importin-a proteins are required
for male and female germline development [69,70,71,72,73]. To
identify which importin-a is involved in Cbt nuclear transport, we
first searched in the BioGrid, DrosID and DpiM interaction
databases for reported interactions between importin-a proteins
and Cbt [74,75,76]. Because no known interactions were found,
other experimental approaches were used to determine possible
functional relationships between Cbt and each of these proteins.
First, we performed genetic interaction assays using the rough eye
phenotype caused by Cbt overexpression with the sev-Gal4 driver
[1] (Figure 7B). Using this assay, we tested whether dosage
reduction of any of the impa genes was able to dominantly modify
that phenotype. Crosses of a recombinant sev-Gal4.UAS-CbtFL
line with impa1, impa2 and impa3 mutant alleles (impa1G4113,
penEY0909and impa3CG397, respectively) were performed, and the
progeny were scored for eye roughness modification. Although no
modification was observed with the impa1 or impa3 mutant alleles
(Figure 7C, E), there was a mild enhancement of the eye
phenotype when impa2 function was reduced (Figure 7D). We
validated this interaction using an independent impa2 allele
(impa2D14, Figure 7F). This result suggested that Cbt and Impa2
are functionally related. To confirm these results, we used UAS-
impa RNAi lines to deplete Impa expression in larval salivary
glands and then assessed whether Cbt nuclear localization was
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org9 February 2012 | Volume 7 | Issue 2 | e32004

Page 10

disrupted. A similar approach was previously applied to
demonstrate that the Naked cuticle (Nkd) protein requires Impa3
for nuclear localization [77]. Immunostaining of salivary glands
from 71B.impa1RNAi, 71B.impa2RNAiand 71B.impa3RNAilarvae
revealed no changes in Cbt nuclear localization (Figure S3A–D).
However, only the impa3RNAiline has been shown to reduce Impa3
immunoreactivity [77].
Previous work has shown that impa2 is expressed during
embryonic development in the male and female germline
[69,70,78], the nervous system [79] and larval muscles [44] and
Figure 6. The PNKKPRL sequence is conserved and functional in insect Cabut orthologs. (A) Multiple alignment of Cbt proteins from
Drosophila species and other insects, showing that the PNKKPRL motif is highly conserved. A consensus sequence for the putative NLS is shown
below (X=any amino acid). (B–D) Localization of b-Gal fusion proteins in Spodoptera exigua Sec301 cells transiently transfected with the constructs
shown in (A). Cells were stained with anti-b-Gal (red; first panel) and anti-Lam (green; second panel) to mark nuclear membranes. The overlay panel
depicts double staining of cells with both antibodies, and the localization of the fusion proteins is shown in the fourth panel (C, cytoplasmic; N,
nuclear). Note that all b-Gal fusion proteins containing the wild-type PNKKPRL sequence were translocated to the nucleus. Scale bar: 10 mm. (E)
Western blots of protein extracts from Sec301 cells transfected with constructs shown in (A) and stained with anti-b-Gal. (1) Non-transfected Sec301
cells, (2) pIE-b-Gal-Cbt1–428(,160 kDa), (3) pIE-b-Gal-Cbt1–77(,135 kDa) and (4) pIE-b-Gal-Cbt1–K73N–K74N(,135 kDa).
doi:10.1371/journal.pone.0032004.g006
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org 10February 2012 | Volume 7 | Issue 2 | e32004

Page 11

may be involved in cell proliferation and cell cycle progression
[80,81]. However, it is not required for general development or cell
viability because impa2 mutants survive to adulthood, possibly due
to functional redundancy with other importins. Therefore, to
determine whether Impa2 is required for nuclear Cbt import, we
analyzed Cbt expression in the larval central nervous system (CNS)
and in ovaries of wild-type and impa2D14mutants. Previously, we
and others described that Cbt was a maternal factor that was
expressed in the CNS during embryonic development [8,13]. Our
results show that Cbt nuclear localization is not altered in the larval
brain hemispheres of impa2 mutants (Figure S3E–F). In the ovary,
Cbt is normally localized to the nuclei of follicular cells in the
germarium. We observed that the nuclear localization of Cbt in
these cells was significantly reduced in impa2 mutants (Figure 7G–
H). These results indicate that Impa2 may be involved in Cbt
nuclearimportinovariesbutnotthe larvalCNSand suggest that no
functional redundancy exists between Impa2 and the other
importins during oogenesis, as previously proposed [70]. However,
our results can not exclude the possibility that other Impa proteins
may be required for Cbt nuclear localization in other tissues. This is
supported by the fact that Cbt has a complex expression pattern
during Drosophila embryogenesis [13].
Discussion
Cbt is an evolutionarily conserved C2H2zinc finger TF involved
in the regulation of different developmental processes in Drosophila
[1,2,3,4,5,6,7,8,9,10,12,13]. Indeed, it is the Drosophila ortholog of
the vertebrate TIEG proteins, which belong to the Sp1-KLF
family of TFs) [14,16]. However, little is known about the
molecular mechanisms that regulate Cbt function. To fully
characterize the function of a TF, it is important to identify at
least three domains in its sequence: the DBD, the NLS and the
transcriptional regulatory domain(s). The aims of the present study
were to determine its role in transcriptional regulation as well as
characterize in detail the molecular mechanisms of Cbt nuclear
import by identifying the relevant functional domains. Our
experiments were also designed to test the functional conservation
between Cbt and its vertebrate orthologs, based on previous results
obtained from functional studies of the TIEG proteins. Although it
is generally accepted that evolutionarily conserved sequences will
perform the same molecular function, this is not always true, and
evidence for functional conservation must come from functional
studies and not from sequence similarity analyses.
Transcriptional repressor/activator activity of Cbt
In the present study we have demonstrated for the first time that
Cbt acts as a transcriptional repressor in Drosophila S2 cells.
However, previous studies suggested that it might function as a
transcriptional activator. We first showed that dpp expression was
downregulated at the leading edge of the lateral epidermal sheets
in cbt mutant embryos during dorsal closure [1]. Furthermore, it
has been recently shown that Cbt acts as positive regulator of
TGF-b signaling during wing imaginal disc development [12].
Figure 7. Importin-a2 is required for Cabut nuclear import in the Drosophila ovary. (A–F) Scanning electron micrographs of adult eyes of
the indicated genotypes. Note that eye roughness in Cbt-overexpressing flies was dominantly enhanced when the impa2 dosage was reduced
(compare B to D and F), but was not modified in the presence of impa1 or impa3 mutant alleles. (G–H) Representative confocal images of ovarian
follicle cells stained with an anti-Cbt antibody (green) and DAPI (blue). High-magnification images of ovarioles are shown on the right. Note that
whereas the Cbt protein is detected in follicle cell nuclei (G) from wild-type flies, its nuclear localization is reduced in impa2D14mutant ovaries. Scale
bars: 10 mm and 8 mm for regular and high-magnification images, respectively.
doi:10.1371/journal.pone.0032004.g007
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org11February 2012 | Volume 7 | Issue 2 | e32004

Page 12

This latter study suggested that the function of Cbt as a
transcriptional activator was consistent with the fact that repressor
domains identified in the TIEG proteins (R1, R2 and R3 domains)
were not conserved in Cbt [12]. However, our results clearly show
that Cbt acts as a transcriptional repressor in S2 cells and that this
activity is mediated in part by a conserved SID located in its N-
terminal region. This domain was found within the R1 region of
the TIEG proteins and was shown to be essential for human and
murine TIEGs-mediated transcriptional repression in cell culture
[31,32]. It is interesting to note that the putative SID in the Cbt
protein is also located in an a-helix but in a different part of the
protein. In addition, we found that the REP1 sequence located in
the C-terminal region of Cbt could also account for its
transcriptional repressor activity. Supporting this observation,
the REP1 sequence contains charged, hydrophobic A and P
residues, as has been shown for other transcriptional repressor
domains [82,83]. However, no information about similar sequenc-
es in TIEGs or other repressor proteins has been found in the
literature. Interestingly, the C-terminal region of murine TIEG3
protein presents transcriptional activator activity, althought the
domain(s) responsible of that function has not been characterized
yet [32]. Transcriptional repression is crucial for the regulation of
gene expression and morphogenesis. Hairy-related proteins play
critical roles during development by repressing target genes at
multiple stages of neurogenesis [84]. Similarly, early patterning of
the Drosophila embryo requires multiple genes encoding transcrip-
tional repressor proteins [83,84,85].
TIEG proteins were originally described as transcriptional
repressors, but several studies have demonstrated that these
proteins and other Sp1/KLF family members can be repressors or
activators depending on the cellular and binding site context
[31,32,33,34,35]. Indeed, it has been shown that phosphorylation
of S/T residues adjacent to the SID may disrupt the mSin3A
interaction, thus inhibiting TIEG2 repressor activity [86]. Besides,
the KLF13 protein presents a SID overlapping with an activation
domain, and its activator/repressor activity depends on the
acetylation state of its DBD or its target promoters [87]. Although
we do not know whether this double function is conserved in the
Drosophila Cbt protein, it is also interesting to consider that the SR
region is conserved in most of the Drosophila Cbt orthologs (Figure
S2). SR domains have been shown to be involved in transactiva-
tion, e.g., in the v-Rel protein [88]. Maybe phosphorylations in S/
T residues within the SR domain could be involved in the
regulation of the transcriptional activity of Cbt. Moreover, it is
important to note that despite the high similarity in the zinc finger
domain between Cbt and the TIEG proteins, our results show that
this region is not able to activate transcription as it does in the
murine TIEG3 protein [31,32]. Further experiments are necessary
to determine whether Cbt can act as a transcriptional activator in
Drosophila.
Cbt regulates its own expression: negative feedback?
We also show that Cbt is able to recognize its own promoter and
negatively regulate its own expression in S2 cells. This report is the
first of a direct Cbt target. These data are supported by ChIP-on-
chip assay results in which Cbt was found to bind to its promoter
region (Figure S1). Negative feedback loops are used to regulate
the levels of signaling molecules and contribute to signal
homeostasis. In many cases, the molecular component that
executes the feedback-mediated inhibition is transcriptionally
targeted by the pathway that it regulates. This mechanism ensures
an interdependence of signaling activity and feedback regulation
and is often viewed as an inherent means of downregulating
signaling pathways during development [89,90]. One interesting
observation that is consistent with the existence of Cbt negative
feedback is that cbt overexpression in different tissues during
embryonic dorsal closure, where it acts downstream of the JNK
pathway, does not cause embryonic lethality [1] (Y.B and N.P,
unpublished results), as occurs when other components of that
pathway are overexpressed [91]. Cbt likely acts to negatively
regulate its own expression and modulate JNK signaling levels.
This negative feedback is also consistent with a role for Cbt in
regulating circadian rhythms [5], as most transcriptional circadian
regulators have a strong transcriptional effect (often direct) on their
own synthesis in both mammals and Drosophila [92,93,94].
Interestingly, several TFs of the KLF family can regulate their
own expression as well as the expression of other family members.
KLF4, for example, can activate its own expression in the
intestinal epithelium, while KLF5 represses KLF4 expression
through competitive interaction with the same cis-element [95].
Currently, no evidence of such an autoregulatory mechanism has
been demonstrated in vertebrate TIEG proteins. Several studies
are being performed to identify other direct Cbt target genes and
to further analyze how they are transcriptionally regulated by this
protein.
Molecular mechanism of Cbt nuclear import
NLSs of proteins belonging to the KLF family of TFs are diverse
in different organisms although most are either within or nearby
their DBDs [32,38,39,96]. Indeed, the murine TIEG3 protein
contains a bipartite NLS within the zinc finger region conserved in
other TIEG proteins in mice and humans [31,32]. In this work, we
demonstrate that Cbt nuclear import is mediated by a monopartite
NLS (PNKKPRL) located within the N-terminal region of the
protein. This NLS is not conserved in vertebrate KLF family
members but is present in insect Cbt orthologs as well as in other
unrelated proteins from invertebrates and vertebrates. We also
demonstrate that this NLS is functional in S. exigua Sec301 cells,
suggesting that it is probably functional in all insect Cbt orthologs.
Interestingly, Cbt also contains a second NLS, which resembles
that described in the TIEG3 protein [31,32]. Importantly,
experiments investigating Cbt localization in hamster CHO-K1,
Drosophila S2 and S. exigua Sec301 cells confirmed that this second
NLS is functional in mammalian but not insect cells. This finding
clearly demonstrates that protein sequence conservation among
different species does not always indicate functional conservation
and indicates that additional factors such as cellular context are
also important and must be considered when ascribing molecular
functions to certain sequences. A similar situation has been found
in the Aspergillus nidulans HapB protein, a subunit of CCAAT-
binding factor [97]. A likely explanation for the results obtained in
our studies is that in insects, the sequence at the N terminus of the
Cbt protein is recognized as an NLS by the importin-a/importin-
b-based nuclear transport machinery, whereas that contained in
the second and third finger domains is not [65].
Experiments using b-GalCbt fusion proteins also demonstrated
the relevance of the central K residues (K73 and K74) in Cbt
nuclear import as well as the existence of putatively critical
residues, such as the flanking P, N, P, R and L residues and maybe
residues within the C3 region (Figures 5 and S2). Nuclear
transport can be regulated at multiple levels, via a diverse range of
mechanisms that include (1) accessibility or masking of the NLS
and availability of import factors; (2) existence of cytoplasmic or
nucleoplasmic retention signals; (3) regulation of the NLS affinity
for its import receptor, e.g., by phosphorylation; (4) regulation of
nuclear pore complex permeability; and (5) possible regulation of
cargo affinity to the hydrophobic central channel. Among these
mechanisms, post-translational modification of proteins through
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org12February 2012 | Volume 7 | Issue 2 | e32004

Page 13

phosphorylation/dephosphorylation is the best understood mech-
anism regulating nuclear transport (reviewed in [42]). To analyze
this possibility, we used the NetPhos software [98] to perform in
silico predictions of putative S, T and tyrosine (Y) phosphorylation
sites around the Cbt NLS and to identify the kinases putatively
responsible for the predicted phosphorylation events. These
analyses showed that although the71PNKKPRL77sequence is
not probably modified, the conserved S59 and T61 residues could
be phosphorylated by Casein Kinase II (CKII) and the T85
amino acid could be targeted by the p38 Mitogen-activated
protein kinase (p38 MAPK) (Figures S2 and S4). Because the b-
GalCbt1–76 fusion protein, which lacks S83 and T85, can be
translocated to the nucleus (Figure 5D), the S59 and T61 residues
are better candidates for phosphorylation sites that affect Cbt
nuclear transport. Interestingly, we found that the S59 and T61
residues near the PNKKPRL sequence were conserved in the
twelve Drosophila species analyzed (Figure S2). This finding could
explain why the b-Gal protein is not efficiently transported to the
nucleus when fused to the PNKKPRL sequence (Figure 5H–I).
Similar results have been reported for proteins fused to the SV40
NLS and in the KLF8 protein [99,100]. Phosphorylation of
residues flanking the NLS can affect nuclear trafficking in
different ways, e.g., enhancing the binding affinity of importins to
cargo or enhancing the docking of cargo to the nuclear pore
complex as well as causing conformational changes that expose
the NLS to the protein surface (reviewed in [61]). Additional
experiments will be necessary to confirm that Cbt nuclear
translocation is regulated by the phosphorylation/desphosphor-
ylation of these residues.
Regarding Cbt, previous studies revealed that this protein is
expressed as a Pumilio target in central and peripheral nervous
system axons [13] and probably synapses [101] of the Drosophila
embryo. Although we have not yet identified a nuclear export
signal (NES) in the Cbt sequence (data not shown), these findings
suggest that Cbt nuclear import might be tightly regulated either
by post-translational modifications (such as phosphorylation of S59
and T61 residues) or conformational changes that prevent NLS
recognition by importins. Cbt has also been reported to be
involved in circadian rhythms [5], a process in which the control of
nuclear trafficking has been demonstrated [102]. Indeed, several
clock proteins contain NLSs that facilitate their cellular trafficking
[20,103]. This control of trafficking is key for the generation and
maintenance of robust and coherent circadian rhythms. Although
the mechanisms of nuclear transport regulation mentioned above
have been previously described for other proteins (reviewed in
[104]), further analyses will be required to confirm whether they
also regulate Cbt nuclear trafficking
Finally, genetic interaction assays and Cbt immunostaining in
impa mutants suggest that the Impa2 protein may interact with
Cbt, probably recognizing the PNKKPRL sequence, and seems to
be required to transport Cbt to the nucleus in several tissues,
including the Drosophila ovary, where a reduction of Cbt nuclear
localization was observed in impa2 mutant flies. In support of this
hypothesis, the human BRCA protein contains an NLS similar to
the one detected in Cbt; this NLS is recognized by the Impa2
protein and is responsible for the protein’s nuclear localization
[64]. These data suggest that the nuclear transport mechanism
mediated by the PX(K/R)KX(R/L) sequence may be conserved
between vertebrates and invertebrates. Drosophila Impa2 was
recently shown to be involved in Frizzled regulation in muscle
and in the central and peripheral nervous systems of embryos and
larvae [44,79]. However, we do not exclude the possibility that
other Impa proteins (a1 or a3) may be involved in Cbt nuclear
transport in other tissues because Cbt presents a ubiquitous
expression pattern at embryonic and larval stages [13]. Co-
immunoprecipitation assays will be necessary to determine
whether other importin proteins interact with Cbt in different
contexts.
Supporting Information
Figure S1
Integrate Genome Browser (IGB) [105] overview of the cabut
genomic region on chromosome 2L identified in the ChIP-on-chip
analysis. From top to bottom: signal represents the log2 of
normalized ratios of IP/input, p-value is on a 210log10 scale
(based on Wilcoxon test), coordinates of the genomic fragment and
structure of the cabut gene. (B) Nucleotide sequence of the cabut
Prom1-2 region. The GC-rich sequences that might be recognized
by the Cbt protein are boxed.
(TIF)
Cabut binds to its own promoter region. (A)
Figure S2
twelve Drosophila species, showing conserved domains
and secondary structure. C1, C2, C3, C4/Rep1 and C5
boxes contain conserved regions in the N and C termini of
Drosophila Cbt proteins; the NLS box indicates the position of the
sequence required for Cbt nuclear localization in D. melanogaster.
The AAEVAL and Rep1 boxes mark the transcriptional repressor
motifs identified in this work. The positions of the serine-rich (SR)
region and the three zinc fingers (Zn1, Zn2 and Zn3) are also
indicated. Black diamonds mark the position of S and T residues
that are potentially phosphorylatable (according to NetPhos
program) and putatively required for regulation of Cbt nuclear
import. Red arrows and yellow helixes indicate the positions of
predicted b-sheet motifs and a-helixes, respectively. The second-
ary structure topology was obtained using the SWISS-MODEL
program.
(TIF)
Multiple alignment of Cabut orthologs from
Figure S3
protein in importin-a mutants. (A–C) Immunostaining of
salivary glands from (A) wild-type, (B) 71B.impa3RNAi, (C)
71B.impa1RNAi, and (D) 71B.impa2RNAithird instar larvae with
anti-Cbt (red) and anti-Lamin (green) antibodies. Note that Cbt
was still detected in the nuclei of salivary gland cells (arrow) and fat
cells (arrowhead) in all genotypes. Scale bar: 15 mm. (E–F)
Immunostaining of brain hemispheres from (E) wild-type and (F)
impa2D14mutant larvae with an anti-Cbt (green) antibody. Note
that Cbt nuclear localization was not reduced in brains of impoa2
mutants. Scale bar: 10 mm.
(TIF)
Immunohistochemical detection of the Cabut
Figure S4
table residues in the Cabut sequence. The positions of S
and T residues predicted to be susceptible to phosphorylation by
different kinases (indicated in pink: CK II and p38-MAPK) and
adjacent to the PNKKPRL sequence (whose position is marked by
a red arrow) are shown. Putative phosphorylatable residues and
responsible kinases were determined using the NetPhos and
NetPhosK programs, respectively.
(TIF)
in silico prediction of putative phosphoryla-
Acknowledgments
We are grateful to JM. Ferna ´ndez-Costa for the pIE-b-Gal vector, to Drs.
S. Herrero and A.K. Jakubowska for the Sec301 cells, to Drs. M.D. Molto
and J.V. Llorens for the CHO-K1 cells, to Dr. F.Gebauer for the S2 cells,
to Dr. Schwarz for the impa2D14stock and to Dr. Courey for the
pG5DE5tkLuc plasmid. We are also grateful to the Developmental Studies
Hybridoma Bank for the anti-Lamin antibody, to the Bloomington Stock
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org 13 February 2012 | Volume 7 | Issue 2 | e32004

Page 14

Center and the Vienna Drosophila RNAi Center for fly stocks and to
ENCODE project members at UCSC for the ChIP-on-chip assay
Author Contributions
Conceived and designed the experiments: YB NP. Performed the
experiments: YB RW. Analyzed the data: YB RW SK NP. Contributed
reagents/materials/analysis tools: YB RW SK NP. Wrote the paper: YB
NP.
References
1. Munoz-Descalzo S, Terol J, Paricio N (2005) Cabut, a C2H2 zinc finger
transcription factor, is required during Drosophila dorsal closure downstream
of JNK signaling. Dev Biol 287: 168–179.
2. Beckstead RB, Lam G, Thummel CS (2005) The genomic response to 20-
hydroxyecdysone at the onset of Drosophila metamorphosis. Genome Biol 6:
R99.
3. Zhao T, Gu T, Rice HC, McAdams KL, Roark KM, et al. (2008) A
Drosophila gain-of-function screen for candidate genes involved in steroid-
dependent neuroendocrine cell remodeling. Genetics 178: 883–901.
4. Blanco E, Ruiz-Romero M, Beltran S, Bosch M, Punset A, et al. (2010) Gene
expression following induction of regeneration in Drosophila wing imaginal
discs. Expression profile of regenerating wing discs. BMC Dev Biol 10: 94.
5. Kadener S, Stoleru D, McDonald M, Nawathean P, Rosbash M (2007)
Clockwork Orange is a transcriptional repressor and a new Drosophila
circadian pacemaker component. Genes Dev 21: 1675–1686.
6. Kraut R, Menon K, Zinn K (2001) A gain-of-function screen for genes
controlling motor axon guidance and synaptogenesis in Drosophila. Curr Biol
11: 417–430.
7. Mindorff EN, O’Keefe DD, Labbe A, Yang JP, Ou Y, et al. (2007) A gain-of-
function screen for genes that influence axon guidance identifies the NF-
kappaB protein dorsal and reveals a requirement for the kinase Pelle in
Drosophila photoreceptor axon targeting. Genetics 176: 2247–2263.
8. Yatsu J, Hayashi M, Mukai M, Arita K, Shigenobu S, et al. (2008) Maternal
RNAs encoding transcription factors for germline-specific gene expression in
Drosophila embryos. Int J Dev Biol 52: 913–923.
9. Bulow MH, Aebersold R, Pankratz MJ, Junger MA (2010) The Drosophila
FoxA ortholog Fork head regulates growth and gene expression downstream of
Target of rapamycin. PLoS One 5: e15171.
10. Guertin DA, Guntur KV, Bell GW, Thoreen CC, Sabatini DM (2006)
Functional genomics identifies TOR-regulated genes that control growth and
division. Curr Biol 16: 958–970.
11. Gorski SM, Chittaranjan S, Pleasance ED, Freeman JD, Anderson CL, et al.
(2003) A SAGE approach to discovery of genes involved in autophagic cell
death. Curr Biol 13: 358–363.
12. Rodriguez I (2011) Drosophila TIEG is a modulator of different signalling
pathways involved in wing patterning and cell proliferation. PLoS One 6:
e18418.
13. Belacortu Y, Weiss R, Kadener S, Paricio N (2011) Expression of Drosophila
Cabut during early embryogenesis, dorsal closure and nervous system
development. Gene Expr Patterns 11: 190–201.
14. Munoz-Descalzo S, Belacortu Y, Paricio N (2007) Identification and analysis of
cabut orthologs in invertebrates and vertebrates. Dev Genes Evol 217:
289–298.
15. Seetharam A, Bai Y, Stuart GW (2010) A survey of well conserved families of
C2H2 zinc-finger genes in Daphnia. BMC Genomics 11: 276.
16. Suske G, Bruford E, Philipsen S (2005) Mammalian SP/KLF transcription
factors: bring in the family. Genomics 85: 551–556.
17. Cook T, Gebelein B, Mesa K, Mladek A, Urrutia R (1998) Molecular cloning
and characterization of TIEG2 reveals a new subfamily of transforming growth
factor-beta-inducible Sp1-like zinc finger-encoding genes involved in the
regulation of cell growth. J Biol Chem 273: 25929–25936.
18. Kaczynski J, Cook T, Urrutia R (2003) Sp1- and Kruppel-like transcription
factors. Genome Biol 4: 206.
19. Wang Z, Peters B, Klussmann S, Bender H, Herb A, et al. (2004) Gene
structure and evolution of Tieg3, a new member of the Tieg family of proteins.
Gene 325: 25–34.
20. Spittau B, Krieglstein K (2011) Klf10 and Klf11 as mediators of TGF-beta
superfamily signaling. Cell Tissue Res;DOI 10.1007/s00441-011-1186-6.
21. Subramaniam M, Harris SA, Oursler MJ, Rasmussen K, Riggs BL, et al.
(1995) Identification of a novel TGF-beta-regulated gene encoding a putative
zinc finger protein in human osteoblasts. Nucleic Acids Res 23: 4907–4912.
22. Chen Z, Lei T, Chen X, Zhang J, Yu A, et al. (2010) Porcine KLF gene family:
Structure, mapping, and phylogenetic analysis. Genomics 95: 111–119.
23. Cook T, Urrutia R (2000) TIEG proteins join the Smads as TGF-beta-
regulated transcription factors that control pancreatic cell growth. Am J Physiol
Gastrointest Liver Physiol 278: G513–521.
24. Subramaniam M, Gorny G, Johnsen SA, Monroe DG, Evans GL, et al. (2005)
TIEG1 null mouse-derived osteoblasts are defective in mineralization and in
support of osteoclast differentiation in vitro. Mol Cell Biol 25: 1191–1199.
25. Bender H, Wang Z, Schuster N, Krieglstein K (2004) TIEG1 facilitates
transforming growth factor-beta-mediated apoptosis in the oligodendroglial cell
line OLI-neu. J Neurosci Res 75: 344–352.
26. Chalaux E, Lopez-Rovira T, Rosa JL, Pons G, Boxer LM, et al. (1999) A zinc-
finger transcription factor induced by TGF-beta promotes apoptotic cell death
in epithelial Mv1Lu cells. FEBS Lett 457: 478–482.
27. Gohla G, Krieglstein K, Spittau B (2008) Tieg3/Klf11 induces apoptosis in
OLI-neu cells and enhances the TGF-beta signaling pathway by transcriptional
repression of Smad7. J Cell Biochem 104: 850–861.
28. Hirota T, Kon N, Itagaki T, Hoshina N, Okano T, et al. (2010) Transcriptional
repressor TIEG1 regulates Bmal1 gene through GC box and controls circadian
clockwork. Genes Cells 15: 111–121.
29. Subramaniam M, Hawse JR, Johnsen SA, Spelsberg TC (2007) Role of TIEG1
in biological processes and disease states. J Cell Biochem 102: 539–548.
30. Tachibana I, Imoto M, Adjei PN, Gores GJ, Subramaniam M, et al. (1997)
Overexpression of the TGFbeta-regulated zinc finger encoding gene, TIEG,
induces apoptosis in pancreatic epithelial cells. J Clin Invest 99: 2365–2374.
31. Cook T, Gebelein B, Belal M, Mesa K, Urrutia R (1999) Three conserved
transcriptional repressor domains are a defining feature of the TIEG subfamily
of Sp1-like zinc finger proteins. J Biol Chem 274: 29500–29504.
32. Spittau B, Wang Z, Boinska D, Krieglstein K (2007) Functional domains of the
TGF-beta-inducible transcription factor Tieg3 and detection of two putative
nuclear localization signals within the zinc finger DNA-binding domain. J Cell
Biochem 101: 712–722.
33. Fernandez-Zapico ME, van Velkinburgh JC, Gutierrez-Aguilar R, Neve B,
Froguel P, et al. (2009) MODY7 gene, KLF11, is a novel p300-dependent
regulator of Pdx-1 (MODY4) transcription in pancreatic islet beta cells. J Biol
Chem 284: 36482–36490.
34. Neve B, Fernandez-Zapico ME, Ashkenazi-Katalan V, Dina C, Hamid YH, et
al. (2005) Role of transcription factor KLF11 and its diabetes-associated gene
variants in pancreatic beta cell function. Proc Natl Acad Sci U S A 102:
4807–4812.
35. Noti JD, Johnson AK, Dillon JD (2004) The zinc finger transcription factor
transforming growth factor beta-inducible early gene-1 confers myeloid-specific
activation of the leukocyte integrin CD11d promoter. J Biol Chem 279:
26948–26958.
36. Zhang JS, Moncrieffe MC, Kaczynski J, Ellenrieder V, Prendergast FG, et al.
(2001) A conserved alpha-helical motif mediates the interaction of Sp1-like
transcriptional repressors with the corepressor mSin3A. Mol Cell Biol 21:
5041–5049.
37. Kim J, Shin S, Subramaniam M, Bruinsma E, Kim TD, et al. (2010) Histone
demethylase JARID1B/KDM5B is a corepressor of TIEG1/KLF10. Biochem
Biophys Res Commun 401: 412–416.
38. Pandya K, Townes TM (2002) Basic residues within the Kruppel zinc finger
DNA binding domains are the critical nuclear localization determinants of
EKLF/KLF-1. J Biol Chem 277: 16304–16312.
39. Quadrini KJ, Bieker JJ (2002) Kruppel-like zinc fingers bind to nuclear import
proteins and are required for efficient nuclear localization of erythroid
Kruppel-like factor. J Biol Chem 277: 32243–32252.
40. Boulikas T (1993) Nuclear localization signals (NLS). Crit Rev Eukaryot Gene
Expr 3: 193–227.
41. Cokol M, Nair R, Rost B (2000) Finding nuclear localization signals. EMBO
Rep 1: 411–415.
42. Poon IK, Jans DA (2005) Regulation of nuclear transport: central role in
development and transformation? Traffic 6: 173–186.
43. Fernandez-Costa JM, Artero R (2010) A conserved motif controls nuclear
localization of Drosophila Muscleblind. Mol Cells 30: 65–70.
44. Mosca TJ, Schwarz TL (2010) Drosophila Importin-alpha2 is involved in
synapse, axon and muscle development. PLoS One 5: e15223.
45. Wong LC, Schedl P (2006) Dissection of Drosophila ovaries. J Vis Exp. pp 52.
46. Munoz-Soriano V, Belacortu Y, Durupt FC, Munoz-Descalzo S, Paricio N
(2011) Mtl interacts with members of Egfr signaling and cell adhesion genes in
the Drosophila eye. Fly (Austin) 5: 88–101.
47. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice. Nucleic
Acids Res 22: 4673–4680.
48. Brand AH, Perrimon N (1993) Targeted gene expression as a means of altering
cell fates and generating dominant phenotypes. Development 118: 401–415.
49. Brown JL, Grau DJ, DeVido SK, Kassis JA (2005) An Sp1/KLF binding site is
important for the activity of a Polycomb group response element from the
Drosophila engrailed gene. Nucleic Acids Res 33: 5181–5189.
50. Lowrey PL, Takahashi JS (2004) Mammalian circadian biology: elucidating
genome-wide levels of temporal organization. Annu Rev Genomics Hum
Genet 5: 407–441.
51. Reppert SM, Weaver DR (2002) Coordination of circadian timing in
mammals. Nature 418: 935–941.
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org 14 February 2012 | Volume 7 | Issue 2 | e32004

Page 15

52. Wager-Smith K, Kay SA (2000) Circadian rhythm genetics: from flies to mice
to humans. Nat Genet 26: 23–27.
53. Pang YP, Kumar GA, Zhang JS, Urrutia R (2003) Differential binding of Sin3
interacting repressor domains to the PAH2 domain of Sin3A. FEBS Lett 31:
108–12.
54. Schwede T, Kopp J, Guex N, Peitsch MC (2003) SWISS-MODEL: An
automated protein homology-modeling server. Nucleic Acids Res 31:
3381–3385.
55. Spain MM, Caruso JA, Swaminathan A, Pile LA (2010) Drosophila SIN3
isoforms interact with distinct proteins and have unique biological functions.
J Biol Chem 285: 27457–27467.
56. Miller M, Park MK, Hanover JA (1991) Nuclear pore complex: structure,
function, and regulation. Physiol Rev 71: 909–949.
57. Nakai K, Horton P (1999) PSORT: a program for detecting sorting signals in
proteins and predicting their subcellular localization. Trends Biochem Sci 24:
34–36.
58. Kosugi S, Hasebe M, Tomita M, Yanagawa H (2009) Systematic identification
of cell cycle-dependent yeast nucleocytoplasmic shuttling proteins by prediction
of composite motifs. Proc Natl Acad Sci U S A 106: 10171–10176.
59. Kalderon D, Roberts BL, Richardson WD, Smith AE (1984) A short amino
acid sequence able to specify nuclear location. Cell 39: 499–509.
60. Boulikas T (1994) Putative nuclear localization signals (NLS) in protein
transcription factors. J Cell Biochem 55: 32–58.
61. Nardozzi JD, Lott K, Cingolani G (2010) Phosphorylation meets nuclear
import: a review. Cell Commun Signal 8: 32.
62. Obenauer JC, Cantley LC, Yaffe MB (2003) Scansite 2.0: Proteome-wide
prediction of cell signaling interactions using short sequence motifs. Nucleic
Acids Res 31: 3635–3641.
63. Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, et al. (1994)
A strong candidate for the breast and ovarian cancer susceptibility gene
BRCA1. Science 266: 66–71.
64. Chen CF, Li S, Chen Y, Chen PL, Sharp ZD, et al. (1996) The nuclear
localization sequences of the BRCA1 protein interact with the importin-alpha
subunit of the nuclear transport signal receptor. J Biol Chem 271:
32863–32868.
65. Lange A, Mills RE, Lange CJ, Stewart M, Devine SE, et al. (2007) Classical
nuclear localization signals: definition, function, and interaction with importin
alpha. J Biol Chem 282: 5101–5105.
66. Mason DA, Stage DE, Goldfarb DS (2009) Evolution of the metazoan-specific
importin alpha gene family. J Mol Evol 68: 351–365.
67. Dockendorff TC, Tang Z, Jongens TA (1999) Cloning of karyopherin-alpha3
from Drosophila through its interaction with the nuclear localization sequence
of germ cell-less protein. Biol Chem 380: 1263–1272.
68. Friedrich B, Quensel C, Sommer T, Hartmann E, Kohler M (2006) Nuclear
localization signal and protein context both mediate importin alpha specificity
of nuclear import substrates. Mol Cell Biol 26: 8697–8709.
69. Giarre M, Torok I, Schmitt R, Gorjanacz M, Kiss I, et al. (2002) Patterns of
importin-alpha expression during Drosophila spermatogenesis. J Struct Biol
140: 279–290.
70. Mason DA, Fleming RJ, Goldfarb DS (2002) Drosophila melanogaster
importin alpha1 and alpha3 can replace importin alpha2 during spermato-
genesis but not oogenesis. Genetics 161: 157–170.
71. Mason DA, Mathe E, Fleming RJ, Goldfarb DS (2003) The Drosophila
melanogaster importin alpha3 locus encodes an essential gene required for the
development of both larval and adult tissues. Genetics 165: 1943–1958.
72. Mathe E, Bates H, Huikeshoven H, Deak P, Glover DM, et al. (2000)
Importin-alpha3 is required at multiple stages of Drosophila development and
has a role in the completion of oogenesis. Dev Biol 223: 307–322.
73. Ratan R, Mason DA, Sinnot B, Goldfarb DS, Fleming RJ (2008) Drosophila
importin alpha1 performs paralog-specific functions essential for gametogen-
esis. Genetics 178: 839–850.
74. Stark C, Breitkreutz BJ, Chatr-Aryamontri A, Boucher L, Oughtred R, et al.
(2011) The BioGRID Interaction Database: 2011 update. Nucleic Acids Res
39: D698–704.
75. Murali T, Pacifico S, Yu J, Guest S, Roberts GG, 3rd, et al. (2011) DroID
2011: a comprehensive, integrated resource for protein, transcription factor,
RNA and gene interactions for Drosophila. Nucleic Acids Res 39: D736–43.
76. Yu J, Pacifico S, Liu G, Finley RL, Jr. (2008) DroID: the Drosophila
Interactions Database, a comprehensive resource for annotated gene and
protein interactions. BMC Genomics 9: 461.
77. Chan CC, Zhang S, Rousset R, Wharton KA, Jr. (2008) Drosophila Naked
cuticle (Nkd) engages the nuclear import adaptor Importin-alpha3 to
antagonize Wnt/beta-catenin signaling. Dev Biol 318: 17–28.
78. Gorjanacz M, Adam G, Torok I, Mechler BM, Szlanka T, et al. (2002)
Importin-alpha 2 is critically required for the assembly of ring canals during
Drosophila oogenesis. Dev Biol 251: 271–282.
79. Mosca TJ, Schwarz TL (2010) The nuclear import of Frizzled2-C by
Importins-beta11 and alpha2 promotes postsynaptic development. Nat
Neurosci 13: 935–943.
80. Kussel P, Frasch M (1995) Pendulin, a Drosophila protein with cell cycle-
dependent nuclear localization, is required for normal cell proliferation. J Cell
Biol 129: 1491–1507.
81. Torok I, Strand D, Schmitt R, Tick G, Torok T, et al. (1995) The overgrown
hematopoietic organs-31 tumor suppressor gene of Drosophila encodes an
Importin-like protein accumulating in the nucleus at the onset of mitosis. J Cell
Biol 129: 1473–1489.
82. Hanna-Rose W, Hansen U (1996) Active repression mechanisms of eukaryotic
transcription repressors. Trends Genet 12: 229–234.
83. Gray S, Levine M (1996) Transcriptional repression in development. Curr
Opin Cell Biol 8: 358–364.
84. Fisher AL, Caudy M (1998) Groucho proteins: transcriptional corepressors for
specific subsets of DNA-binding transcription factors in vertebrates and
invertebrates. Genes Dev 12: 1931–1940.
85. Carroll SB (1990) Zebra patterns in fly embryos: activation of stripes or
repression of interstripes? Cell 60: 9–16.
86. Ellenrieder V, Zhang JS, Kaczynski J, Urrutia R (2002) Signaling disrupts
mSin3A binding to the Mad1-like Sin3-interacting domain of TIEG2, an Sp1-
like repressor. EMBO J 21: 2451–2460.
87. Song CZ, Keller K, Chen Y, Stamatoyannopoulos G (2003) Functional
interplay between CBP and PCAF in acetylation and regulation of
transcription factor KLF13 activity. J Mol Biol 329: 207–215.
88. Chen C, Agne `s F, Ge ´linas C (1999) Mapping of a serine-rich domain essential
for the transcriptional, antiapoptotic, and transforming activities of the v-Rel
oncoprotein. Mol Cell Biol 19: 307–16.
89. Perrimon N, McMahon AP (1999) Negative feedback mechanisms and their
roles during pattern formation. Cell 97: 13–16.
90. Freeman M (2000) Feedback control of intercellular signalling in development.
Nature 408: 313–319.
91. Harden N (2002) Signaling pathways directing the movement and fusion of
epithelial sheets: lessons from dorsal closure in Drosophila. Differentiation 70:
181–203.
92. Hardin PE, Hall JC, Rosbash M (1990) Feedback of the Drosophila period
gene product on circadian cycling of its messenger RNA levels. Nature 343:
536–540.
93. Allada R, Chung BY (2010) Circadian organization of behavior and physiology
in Drosophila. Annu Rev Physiol 72: 605–624.
94. Hogenesch JB, Ueda HR (2011) Understanding systems-level properties: timely
stories from the study of clocks. Nat Rev Genet 12: 407–416.
95. Dang DT, Zhao W, Mahatan CS, Geiman DE, Yang VW (2002) Opposing
effects of Kruppel-like factor 4 (gut-enriched Kruppel-like factor) and Kruppel-
like factor 5 (intestinal-enriched Kruppel-like factor) on the promoter of the
Kruppel-like factor 4 gene. Nucleic Acids Res 30: 2736–2741.
96. Rodrı ´guez E, Martignetti JA (2009) The Kru ¨ppel traffic report: cooperative
signals direct KLF8 nuclear transport. Cell Res 19: 1041–3.
97. Tuncher A, Sprote P, Gehrke A, Brakhage AA (2005) The CCAAT-binding
complex of eukaryotes: evolution of a second NLS in the HapB subunit of the
filamentous fungus Aspergillus nidulans despite functional conservation at the
molecular level between yeast, A.nidulans and human. J Mol Biol 352:
517–533.
98. Blom N, Gammeltoft S, Brunak S (1999) Sequence and structure-based
prediction of eukaryotic protein phosphorylation sites. J Mol Biol 294:
1351–1362.
99. Rihs HP, Peters R (1989) Nuclear transport kinetics depend on phosphory-
lation-site-containing sequences flanking the karyophilic signal of the Simian
virus 40 T-antigen. EMBO J 8: 1479–1484.
100. Mehta TS, Lu H, Wang X, Urvalek AM, Nguyen KH, et al. (2009) A unique
sequence in the N-terminal regulatory region controls the nuclear localization
of KLF8 by cooperating with the C-terminal zinc-fingers. Cell Res 19:
1098–109.
101. Chen G, Li W, Zhang QS, Regulski M, Sinha N, et al. (2008) Identification of
synaptic targets of Drosophila pumilio. PLoS Comput Biol 4: e1000026.
102. Tamanini F, Yagita K, Okamura H, van der Horst GT (2005) Nucleocyto-
plasmic shuttling of clock proteins. Methods Enzymol 393: 418–435.
103. Miyazaki K, Mesaki M, Ishida N (2001) Nuclear entry mechanism of rat PER2
(rPER2): role of rPER2 in nuclear localization of CRY protein. Mol Cell Biol
21: 6651–6659.
104. Jans DA, Hubner S (1996) Regulation of protein transport to the nucleus:
central role of phosphorylation. Physiol Rev 76: 651–685.
105. Nicol JW, Helt GA, Blanchard SG, Jr., Raja A, Loraine AE (2009) The
Integrated Genome Browser: free software for distribution and exploration of
genome-scale datasets. Bioinformatics 25: 2730–2731.
Cbt Transcriptional Activity and Nuclear Transport
PLoS ONE | www.plosone.org15 February 2012 | Volume 7 | Issue 2 | e32004