Solexa sequencing identification of conserved and novel microRNAs in backfat of Large White and Chinese Meishan pigs.

Abstract

The domestic pig (Sus scrofa), an important species in animal production industry, is a right model for studying adipogenesis and fat deposition. In order to expand the repertoire of porcine miRNAs and further explore potential regulatory miRNAs which have influence on adipogenesis, high-throughput Solexa sequencing approach was adopted to identify miRNAs in backfat of Large White (lean type pig) and Meishan pigs (Chinese indigenous fatty pig). We identified 215 unique miRNAs comprising 75 known pre-miRNAs, of which 49 miRNA*s were first identified in our study, 73 miRNAs were overlapped in both libraries, and 140 were novelly predicted miRNAs, and 215 unique miRNAs were collectively corresponding to 235 independent genomic loci. Furthermore, we analyzed the sequence variations, seed edits and phylogenetic development of the miRNAs. 17 miRNAs were widely conserved from vertebrates to invertebrates, suggesting that these miRNAs may serve as potential evolutional biomarkers. 9 conserved miRNAs with significantly differential expressions were determined. The expression of miR-215, miR-135, miR-224 and miR-146b was higher in Large White pigs, opposite to the patterns shown by miR-1a, miR-133a, miR-122, miR-204 and miR-183. Almost all novel miRNAs could be considered pig-specific except ssc-miR-1343, miR-2320, miR-2326, miR-2411 and miR-2483 which had homologs in Bos taurus, among which ssc-miR-1343, miR-2320, miR-2411 and miR-2483 were validated in backfat tissue by stem-loop qPCR. Our results displayed a high level of concordance between the qPCR and Solexa sequencing method in 9 of 10 miRNAs comparisons except for miR-1a. Moreover, we found 2 miRNAs, miR-135 and miR-183, may exert impacts on porcine backfat development through WNT signaling pathway. In conclusion, our research develops porcine miRNAs and should be beneficial to study the adipogenesis and fat deposition of different pig breeds based on miRNAs.

Full text

Page 1

Solexa Sequencing Identification of Conserved and
Novel microRNAs in Backfat of Large White and Chinese
Meishan Pigs
Chen Chen1, Bing Deng1, Mu Qiao1, Rong Zheng1, Jin Chai1, Yi Ding1, Jian Peng2*, Siwen Jiang1*
1Key Laboratory of Swine Genetics and Breeding of Agricultural Ministry, and Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of
Education, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan, People’s Republic of China, 2Department of Animal Nutrition and Feed
Science, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan, People’s Republic of China
Abstract
The domestic pig (Sus scrofa), an important species in animal production industry, is a right model for studying
adipogenesis and fat deposition. In order to expand the repertoire of porcine miRNAs and further explore potential
regulatory miRNAs which have influence on adipogenesis, high-throughput Solexa sequencing approach was adopted to
identify miRNAs in backfat of Large White (lean type pig) and Meishan pigs (Chinese indigenous fatty pig). We identified 215
unique miRNAs comprising 75 known pre-miRNAs, of which 49 miRNA*s were first identified in our study, 73 miRNAs were
overlapped in both libraries, and 140 were novelly predicted miRNAs, and 215 unique miRNAs were collectively
corresponding to 235 independent genomic loci. Furthermore, we analyzed the sequence variations, seed edits and
phylogenetic development of the miRNAs. 17 miRNAs were widely conserved from vertebrates to invertebrates, suggesting
that these miRNAs may serve as potential evolutional biomarkers. 9 conserved miRNAs with significantly differential
expressions were determined. The expression of miR-215, miR-135, miR-224 and miR-146b was higher in Large White pigs,
opposite to the patterns shown by miR-1a, miR-133a, miR-122, miR-204 and miR-183. Almost all novel miRNAs could be
considered pig-specific except ssc-miR-1343, miR-2320, miR-2326, miR-2411 and miR-2483 which had homologs in Bos
taurus, among which ssc-miR-1343, miR-2320, miR-2411 and miR-2483 were validated in backfat tissue by stem-loop qPCR.
Our results displayed a high level of concordance between the qPCR and Solexa sequencing method in 9 of 10 miRNAs
comparisons except for miR-1a. Moreover, we found 2 miRNAs, miR-135 and miR-183, may exert impacts on porcine backfat
development through WNT signaling pathway. In conclusion, our research develops porcine miRNAs and should be
beneficial to study the adipogenesis and fat deposition of different pig breeds based on miRNAs.
Citation: Chen C, Deng B, Qiao M, Zheng R, Chai J, et al. (2012) Solexa Sequencing Identification of Conserved and Novel microRNAs in Backfat of Large White
and Chinese Meishan Pigs. PLoS ONE 7(2): e31426. doi:10.1371/journal.pone.0031426
Editor: Alfons Navarro, University of Barcelona, Spain
Received May 23, 2011; Accepted January 8, 2012; Published February 15, 2012
Copyright: ? 2012 Chen et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This research was supported by grants from the Chinese Ministry of Science and Technology, the Major Projects of Genetically Modified Animals
(2009ZX08009-161B, 2009ZX08009-151B). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the
manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: jswhzau@163.com (SJ); pengjianhzau@163.com (JP)
Introduction
MicroRNAs (miRNAs), the small non-coding RNAs (typically
19–23 nucleotides), were firstly discovered in C. elegans [1] and play
important roles in regulating post-transcriptional translation [2].
These small non-coding RNAs extensively exist in the cells of
plants, animals and some viruses [3–5]. Increasing evidence
demonstrates that miRNAs have evolved as a major class of gene-
regulatory molecules critical for diverse biological processes, such
as development, differentiation, proliferation and diabetes in
eukaryotes [6–9].
miRNAs are initially transcribed from miRNA genes located
mainly in the intergenic genomic region. By RNA polymerase II,
they yield transcripts called primary miRNAs (pri-miRNAs),
which are processed to generate miRNA precursors (pre-miRNAs)
by a complex containing Drosha and then by Dicer to excise
miRNA:miRNA-star (miR:miR*) duplexes. Of which one strand is
more stable and preferentially incorporated into an RNA-induced
silencing complex (RISC), while the other strand (miRNA*) is
usually discarded [10]. The miRNA then guides the RISC to bind
the UTRs and CDS of target mRNAs, where it downregulates the
gene expression, often by blocking protein production or by
degrading the target mRNA [11,12].
The pig (Sus scrofa), an important species in animal production
industry, is a right model for studying adipogenesis and fat
deposition. Increasing evidences suggest that miRNAs contribute
to the regulation of fat development [13–15]. However, rare reports
could be read about the porcine miRNAs that effect the adipocyte
differentiation and adipogenesis. The total number of porcine
miRNA genes discovered by human beings so far is much lower,
which affects the study on pigs. Therefore, finding more miRNAs in
pigs can be contribute to various and further studies on pigs. Some
recent articles have depicted miRNAs in pigs [16–19], but most of
these researches concentrated on miRNAs of porcine skeletal
muscle. Backfat is another important tissue, however, there have
been scarce reports on miRNAs identified from this tissue.
Solexa sequencing technology is a convincing strategy for
identifying miRNAs and has been utilized by several laboratories
PLoS ONE | www.plosone.org1February 2012 | Volume 7 | Issue 2 | e31426

Page 2

Table 1. The expression profile of all known miRNAs in Large White and Meishan small RNA libraries.
miRNA-name LW expressedMS expressedLW-std MS-std
fold change
(log2 MS/LW)p-value sig -lable
ssc-let-7c87758570248145536.791535816.4719
20.346409410
ssc-let-7f82124970856742613.586736126.7708
20.238245170
ssc-let-7i52800462072739.72622355.8953
20.21775632.1299E-124
ssc-miR-101a 113825 1138975906.23735807.1161
20.02441744 5.38434E-05
ssc-miR-103 1919741724799961.29158793.9592
20.179819960
ssc-miR-106a 47255424.491528.24610.20577055 0.022686026
ssc-miR-107652872 33.8315 44.45950.394124581.1522E-07
ssc-miR-122 3921678 20.3404 85.5542.07248726 3.8728E-184**
ssc-miR-125b70520507883659.19492589.4607
20.49887460
ssc-miR-12852959727.4492 30.43850.149133160.083386279
ssc-miR-130a 21381264110.9382 64.4459
20.783595751.06424E-54
ssc-miR-133a 126 8496.538 43.28682.72700587 8.7333E-130**
ssc-miR-135262 1.34910.102
23.72535622 1.3011E-06**
ssc-miR-136293 42315.203421.5669 0.504424823.59769E-06
ssc-miR-13911581478 60.087275.35680.326680017.08989E-09
ssc-miR-14011884 11133616.6459 567.6236
20.11950771 3.3378E-10
ssc-miR-140* 1771561461699192.4047452.526
20.302712710
ssc-miR-145 5863 6830304.2238348.23220.19491659 2.99995E-14
ssc-miR-146b44691714 231.890887.3895
21.407913744.1842E-289**
ssc-miR-148a96952968397850307.65134873.0839
20.528663870
ssc-miR-15a52385325271.7933271.4987
20.0015646 0.955478867
ssc-miR-15b1074 89355.728545.5302
20.29159152 7.74903E-06
ssc-miR-1624506237341271.58581210.0941
20.07150957 5.23792E-08
ssc-miR-1757036089295.9216310.45180.069154290.009280647
ssc-miR-1828745214.892123.04550.629937864.84017E-09
ssc-miR-181a 83735717124344.9048 3656.2851
20.2489466.3469E-253
ssc-miR-181b14048 11933728.9332608.4121
20.26073777 6.49187E-48
ssc-miR-181c1055 77954.742639.7178
20.46287825 8.46657E-12
ssc-miR-183519134226.9303 68.42281.34524684 8.87706E-81**
ssc-miR-18422481273116.6459 64.9048
20.84573852 3.25294E-65
ssc-miR-18544484947230.8012252.2262 0.12806742 1.72089E-05
ssc-miR-18628047370581455.32391889.4274 0.37660881 9.0493E-241
ssc-miR-19617472974 90.6497 151.63140.742194391.69018E-67
ssc-miR-199b* 261685 22915513578.508411683.6237
20.21683720
ssc-miR-19a19618810.17029.5853
20.085452560.561914591
ssc-miR-1a21904 1980621136.571310098.3259 3.151356050**
ssc-miR-2013192 17233684.5164878.63620.360180843.7558E-104
ssc-miR-20410300.51891.52961.55962599 0.00175365**
ssc-miR-205681083.52845.50650.64212149 0.003710943
ssc-miR-21 71060958766636872.61529962.551
20.29938928 0
ssc-miR-210 106 1255.5002 6.37320.212533850.265328125
ssc-miR-21422182191115.0893111.7096
20.043000530.322383625
ssc-miR-2153618128187.73356.5262
24.846299030**
ssc-miR-21617280.88211.4276 0.694577680.117088654
ssc-miR-2175841 3.0095 2.0904
20.525744790.073374517
ssc-miR-22119311784 100.1972 90.9585
20.139561820.00321048
ssc-miR-22463821533.105 10.9619
21.59455124 3.44467E-51 **
ssc-miR-23a9821 9749509.5994497.0594
20.03594530.081373414
ssc-miR-24159722177278 8287.77549038.6395 0.125120721.2767E-139
Solexa Sequencing Identified Porcine miRNAs
PLoS ONE | www.plosone.org 2February 2012 | Volume 7 | Issue 2 | e31426

Page 3

to identify miRNAs [10,20,21]. To enrich the repertoire of
miRNAs in pigs, we constructed and sequenced two small RNA
libraries prepared from the backfat tissue of 150-day-old Large
White (LW) and Meishan (MS) pigs. The former is a lean type
pig, and the latter is a Chinese indigenous fatty pig. As the spatial
distribution of miRNAs may contribute to the mechanistic
understanding of adipocyte differentiation and adipogenesis, this
study intended to provide deeper insights into dynamic regulation
of the conserved and novel miRNA levels during different breeds
of pigs.
Results and Discussion
Solexa sequencing data between the two small RNA
libraries
Small RNAs (18–30 nt) were obtained from the total RNA, 59
and 39 RNA adaptors were ligated to the RNA pool, and the
adaptor-ligated small RNAs were then subsequently subjected to
RT-PCR to produce sequencing libraries. PCR products were
purified and small RNA libraries were sequenced using Solexa.
Primary analysis was performed on the 35 nt tags. First, we got rid
of the 59 adaptor, the low quality tags to obtain clean tags. The
length distribution of the clean tags was subsequently summarized.
Then, the clean tags were annotated into different categories, and
finally those tags which couldn’t be annotated to any category
were used to predict the novel miRNAs. The work flow of Solexa
sequencing is shown in Figure S1. The flow results of raw sequence
data for the two libraries are shown in Table S1. The clean reads
in the small RNA library of Large White was more than 19
million, and it was the same for Meishan small RNA library. Small
RNA annotation is presented in Table S1, A-B. The distribution of
sequence lengths was similar between both small RNA libraries by
following the law of normal distribution, and the majority of
sequences were 22 nt in length (Table S1, C–D). miRNA had a
much tighter length distribution, centering on 21–24 nt. The
number of 21–23 nt sequences was significantly greater than those
shorter or longer sequences, and almost half of the sequences in
Large White (49.79%) and Meishan (46.28%) are canonical 22 nt
miRNA, which coincided with the known specificity for Dicer
processing and the features of mature miRNAs [22,23]. Nearly 10
million reads of Large White and Meishan small RNA libraries
were respectively screened as miRNA candidates and used for
further analysis. The common and specific tags of two libraries,
including the summary of unique tags and total tags were listed in
Table S1, E in which the total number of unique sRNAs reads in
Large White and Meishan small RNA libraries was almost 0.38
million and 0.49 million, respectively. These unique sRNAs
sequences contained 0.1 million common sequences between the
two libraries. The common sequences of total sRNAs between the
two libraries were much higher (accounted for 97.75%) than that
of unique sRNAs (accounted for 13.63%), this indicated that the
number of Large White-specific and Meishan-specific sequences
was much smaller than that of common sequences between the
two libraries.
Identification of conserved porcine miRNAs
After successive filtering of these data sets, we identified 215
unique miRNAs comprising 75 pre-miRNAs, of which 49
miRNA*s were first identified, 73 miRNAs were overlapped in
both libraries, and 140 were novel predicted miRNAs and 215
miRNA-nameLW expressed MS expressedLW-stdMS-std
fold change
(log2 MS/LW) p-valuesig -lable
ssc-miR-26a1668681600838658.57258161.9407
20.085216975.70634E-64
ssc-miR-27a68858 549313572.9558 2800.6944
20.3513335 0
ssc-miR-29b 1093172756.714488.05230.63464561.00582E-30
ssc-miR-29c20093691104.2445188.18810.852204133.1889E-105
ssc-miR-30a31129523423016152.709411942.376
20.435686280
ssc-miR-30b46216932 239.7779353.4327 0.55973683 1.41568E-94
ssc-miR-30c 1032310848 535.6476553.0927 0.046237130.01975291
ssc-miR-3212731498 66.0544 76.37650.20947414 0.000136849
ssc-miR-32616270.8302 1.37660.729578580.108360144
ssc-miR-34a1446180775.0311 92.13110.29619953 5.39272E-09
ssc-miR-4501018 67952.822834.6193
20.60958423 7.00986E-18
ssc-miR-503 64760933.572 31.0503
20.11265128 0.166634817
ssc-miR-7 463595 24.024530.33650.33654824 0.000159445
ssc-miR-9-114801459 76.795474.3881
20.04594805 0.387961957
ssc-miR-9-214801459 76.795474.3881
20.04594805 0.387961957
ssc-miR-951295 1502 67.195976.5805 0.18860388 0.000558833
ssc-miR-99b64674536303355.8532 2734.3621
20.29547531.1759E-270
Note: (1) LW-std: The result of Solexa sequencing exhibited, presented the normalized expression level of miRNA in Large White library. (2) MS-std: The result of Solexa
sequencing exhibited, presented the normalized expression level of miRNA in Meishan library. (3) fold-change(log2 MS-std/LW-std): Fold change of miRNAs in both
samples. (4) p-value: p value manifests the significance of miRNA differential between two samples. Less p value indicates more significance of difference of miRNA. (5)
sig-lable: significance label.
*: fold change(log2).1 or fold change(log2),21, and 0.01#p-value,0.05.
**: fold change(log2).1 or fold change(log2),21, and p-value,0.01. None: Others.
doi:10.1371/journal.pone.0031426.t001
Table 1. Cont.
Solexa Sequencing Identified Porcine miRNAs
PLoS ONE | www.plosone.org3 February 2012 | Volume 7 | Issue 2 | e31426

Page 4

unique miRNAs were collectively corresponding to 235 indepen-
dent genomic loci (Table S2). However, 13 miRNA/miRNA*
were detected in only one small RNA library. For example,
ssc-miR-153, miR-325, miR-135-1*, miR-135-2*, miR-146b*,
miR-15a*, miR-215* and miR-323* were only identified in Large
White, contrary to the patterns displayed by ssc-miR-101a-1*,
miR-103*, miR-183*, miR-1a* and miR-210*, indicating that
these miRNAs may function in the physiology or development of
the backfat tissue.
The known miRNAs expression profiles between two libraries
are shown in Table 1. The expression of the known miRNAs in
the two samples was demonstrated by plotting Log2-ratio and
Scatter Plot (Figure 1). The results showed that 9 miRNAs were
significantly different between the two libraries, such as the
expression of miR-215, miR-135 and miR-146b was higher in
Large White pigs, opposite to the patterns shown by miR-1a, miR-
133a, miR-122, miR-204 and miR-183 (Table 1), suggesting that
these miRNAs may have effects on the development of backfat
tissue. Detailed information of known miRNAs in both libraries,
including sequence reads and hairpin structures are shown in
Table S3. Lots of miRNAs were found to have end variants,
differing by one or several nucleotides most commonly in the 39
end. For example, miR-204 and miR-450 only had 39 end
variants. miR-107, miR-122 and miR-19a were respectively
differed by only one nucleotide in the 59 end, but they had
several 39 end variants. Such variants may come from altered
miRNA processing, preferential degradation at the miRNA ends,
or post-transcriptional modifications, including RNA editing
[24,25].
miR-1a and miR-133a had been reported to be exclusively
expressed in muscle [7]. In our analysis, we identified that they
also expressed in porcine backfat tissue, the reads number of miR-
1a and miR-133a was 0.2 million and 1028, respectively,
indicating that these two miRNAs may be effective in adipogen-
esis. A number of miRNAs (miR-136, miR-140, miR-204, miR-
221, and miR-325) originated from the 59 and 39 arms of the
miRNA hairpin precursors, exhibited a similar number of
sequence reads. The approximate equivalent expression rates of
miRNA and miRNA* (miR-136:293, miR-136*:107 in Large
White library) may be due to the similar 59 end stability which
results to equal incorporation of either strand into the RISC and
protection from degradation [26]. Accordingly, this miRNA
precursor may produce functional molecules on both arms.
Identification of novel porcine miRNAs
Base on the Solexa sequencing, we identified 140 novel porcine
miRNAs, which corresponding to 156 genomic loci. 87 in Large
White pigs, 102 novel miRNAs in Meishan pigs. Their secondary
structures are shown respectively in Table S4. 2 of the 156
genomic loci were located in the exons of protein-coding genes, 35
in introns, 11 in the introns and exons of single protein-coding
genes, 3 in the introns and exons of two protein-coding genes,
others were in intergenic regions (Table S2). Almost all these
miRNAs could be considered pig-specific except ssc-miR-1343,
Figure 1. The differentital expressions of porcine conversed miRNAs between Large White and Meishan were shown. Each point in
the figure represents a miRNA. Red points represent miRNAs with fold change.2, blue points represent miRNAs with 1/2,fold change #2, green
points represent miRNAs with fold change #1/2.
doi:10.1371/journal.pone.0031426.g001
Solexa Sequencing Identified Porcine miRNAs
PLoS ONE | www.plosone.org4 February 2012 | Volume 7 | Issue 2 | e31426

Page 5

miR-2320, miR-2326, miR-2411 and miR-2483 which had
homologs in Bos taurus (Table 2).
The read number for each novel miRNA was much lower than
that for the majority of conserved miRNAs. For instance, ssc-miR-
2411 and ssc-un0012, both were novel miRNAs, the total reads
were only 131 and 5, respectively. However, the total reads of two
conserved miRNAs (ssc-miR-148a and ssc-let-7c) were striking,
almost 1.7 million and 1.6 million, respectively (Table S2). This
might suggest a specific role for these novel miRNAs during
developmental stages. Since this study investigated the miRNAs of
backfat tissue from female Large White and Meishan pigs, whether
these low-abundant miRNAs are expressed at higher levels in other
tissues and organs remains to be investigated. Future experiments
could provide more insight into the function of these miRNAs.
Validation of porcine miRNAs
We adopted stem-loop qPCR to validate our sequencing data
[27]. A total of 4 novel miRNAs were cloned and validated in
backfat tissue by qPCR, and they all could express (Figure 2,
A). The expressions of miR-1343, miR-2320 and miR-2411
were slightly higher in Meishan samples; miR-2483 higher in
large White samples (Table S2). And our qPCR results showed
the consistency (Figure 2, B). In addition, the qPCR results
suggested that 6 miRNAs which were sequenced by Solexa and
displayed significantly differential expressions were expressed in
porcine backfat tissue, but the expression levels of different
miRNAs varied (Figure 3). In general, the results of qPCR
validated the sequencing results and they were consistent. The
expression of miR-135, miR-224 was significantly higher in
Large White pigs, opposite to the expression of miR-133a,
miR-122. The expression of miR-204, higher in Meishan pigs,
was significant between the two samples (Figure 3). However,
miR-1a was an exception, its expression level was higher in
Large White pigs, which was inconsistent with the sequencing
results, and no significant difference was observed. The
discrepancy in the miRNA expression may because of
Table 2. Comparison of predicted novel miRNAs in pigs with their homologs in Bos taurus.
miRNA-name precusor-miRNA
Minimum free
energy(kcal/mol)
bta-mir-1343GGCTTCGGTGCTGGGGAGCGGCCCCCGGGCGGGCCTCTGCTCTGGCCCCTCCTGGGGCCCGCACTCTCGCTCCGGGCC
ssc-mir-1343GGCTTCGGTGCTGGGGAGCGGCCCCCGGGCGGGCCTCTGCTCTGGCCCCTCCTGGGGCCCGCACTCTCGCTCCGGGTC
250.3
bta-mir-2320 TGTCCCCATGGCACAGGGTCCAGCTGTCGGCCGTGATACCCGATGGGTCGATGATGGTCCCTGTGTTTTGGGGCG
ssc-mir-2320TGTCCCCATGGCACAGGGTCCAGCTGTCGGCTGTAATACCCGATGGGTCGATGATGGTCCCTGTGTTTGGGGCG
237.7
bta-mir-2366CCCCGGGGTCCTCTTGTCTGAGCCCCAGAAAGAGGAGAGAGTGCTGGGTCACAGAAGAGGGTCTGGGGG
ssc-mir-2366CCCCAGGGTCCTCTTGTCTGAGCCCCAGAAAGAGGAGAGAGCGCTGGGTCACAGAAGAGGGTCTGGGGG
231.6
bta-mir-2411 GAGGAAATGTGGAGTGACTGTCAGATGCAGCCAGCAGAATAAGTGGTTTGGCTGAACTGTCTTACTCCCACATCCTC
ssc-mir-2411 GAGGCAATGTGGAGTGACTGTCAGATGCAGCCATCAGAATAGGTGATTTGGCTGAACTGTCATACTCCCACATCCTC
229.2
bta-mir-2483 GAGTGAAAAGTTCCGTCAACCATCCAGCTGTTTGAGGTGATGCAAACAAACATCTGGTTGGTTGAGAGAATTTTTTACTT
ssc-mir-2483GAGTGAAAAGTTCCGTCAACCATCCAGCTGTTTGGGGTGATGCAAACAAACATCTGGTTGGTTGAGAGAATTTTTTACTT
237.3
Note: The bold are the mature miRNA sequences.
doi:10.1371/journal.pone.0031426.t002
Figure 2. Four novel miRNAs were cloned and validated in porcine backfat tissue by stem-loop qPCR. A. miR-1343, miR-2320, miR-2411
and miR-2483 were cloned in porcine backfat tissue of Large White and Meishan samples. M represents DNA size marker, DL700 and DL2000. Large
White samples (lane 1–3) and Meishan (lane 4–6) samples. U6 snRNA was used as an internal control. A 3% agarose gel, stained by ethidium bromide,
was run to indicate the cloned miRNA because of the small product size, and the 1.5% agarose gel was used to indicate U6. B. The four novel miRNAs
were validated by stem-loop qPCR. All experiments were performed three times. The data shown in Y-axis were calculated using the expression
values of 22DDCtand expressed as means 6 standard error. The significance of differences for the expression between samples was calculated by
one-way ANOVA. The corresponding significance value (p) was listed above their respective columns. 0.01,p,0.05 was considered to be significant.
doi:10.1371/journal.pone.0031426.g002
Solexa Sequencing Identified Porcine miRNAs
PLoS ONE | www.plosone.org5February 2012 | Volume 7 | Issue 2 | e31426