Aurora Kinase-A Inactivates DNA Damage-Induced Apoptosis and Spindle Assembly Checkpoint Response Functions of p73

Department of Molecular Pathology, The University of Texas M.D. Anderson Cancer Center, Houston, TX 77054, USA.
Cancer cell (Impact Factor: 23.52). 02/2012; 21(2):196-211. DOI: 10.1016/j.ccr.2011.12.025
Source: PubMed


Elevated Aurora kinase-A expression is correlated with abrogation of DNA damage-induced apoptotic response and mitotic spindle assembly checkpoint (SAC) override in human tumor cells. We report that Aurora-A phosphorylation of p73 at serine235 abrogates its transactivation function and causes cytoplasmic sequestration in a complex with the chaperon protein mortalin. Aurora-A phosphorylated p73 also facilitates inactivation of SAC through dissociation of the MAD2-CDC20 complex in cells undergoing mitosis. Cells expressing phosphor-mimetic mutant (S235D) of p73 manifest altered growth properties, resistance to cisplatin- induced apoptosis, as well as premature dissociation of the MAD2-CDC20 complex, and accelerated mitotic exit with SAC override in the presence of spindle damage. Elevated cytoplasmic p73 in Aurora-A overexpressing primary human tumors corroborates the experimental findings.

Download full-text


Available from: Jin Wang, Oct 08, 2015
1 Follower
72 Reads
  • Source
    • "For ROCK1 and ROCK2 RNAi, RNA duplexes (siROCK1: GCCAAUGACUUACUUAGGATT, siROCK2: GCAAAUCUGUUAAUACUCGTT) [15] were transfected using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions. For p73 RNAi in Jurkat cell line, RNA duplex (CGGAUUCCAGCAUGGACGUUU) [16] was transfected using Neon transfection system (Invitrogen) according to manufacturer’s instructions. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Accurate chromosome segregation is vital for cell viability. Many cancer cells show chromosome instability (CIN) due to aberrant expression of the genes involved in chromosome segregation. The induction of massive chromosome segregation errors in such cancer cells by small molecule inhibitors is an emerging strategy to kill these cells selectively. Here we screened and characterized small molecule inhibitors which cause mitotic chromosome segregation errors to target cancer cell growth. We screened about 300 chemicals with known targets, and found that Rho-associated coiled-coil kinase (ROCK) inhibitors bypassed the spindle assembly checkpoint (SAC), which delays anaphase onset until proper kinetochore-microtubule interactions are established. We investigated how ROCK inhibitors affect chromosome segregation, and found that they induced microtubule-dependent centrosome fragmentation. Knockdown of ROCK1 and ROCK2 revealed their additive roles in centrosome integrity. Pharmacological inhibition of LIMK also induced centrosome fragmentation similar to that by ROCK inhibitors. Inhibition of ROCK or LIMK hyper-stabilized mitotic spindles and impaired Aurora-A activation. These results suggested that ROCK and LIMK are directly or indirectly involved in microtubule dynamics and activation of Aurora-A. Furthermore, inhibition of ROCK or LIMK suppressed T cell leukemia growth in vitro, but not peripheral blood mononuclear cells. They induced centrosome fragmentation and apoptosis in T cell leukemia cells. These results suggested that ROCK and LIMK can be a potential target for anti-cancer drugs.
    PLoS ONE 03/2014; 9(3):e92402. DOI:10.1371/journal.pone.0092402 · 3.23 Impact Factor
  • Source
    • "Bhatia et al. [8] reported that mitotic DNA damage targeted Aurora-A. Further, a coincidence of the expression of elevated Aurora-A and the suspension of a DNA damage-induced cell death response was observed in the study conducted by Katayama et al. [19]. These results led us to investigate the expression of Aurora-A protein in the skin tissue of diabetic patients. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Aurora kinase A (Aurora-A) plays an important role in the regulation of mitosis and cytokinesis. Dysregulated Aurora-A leads to mitotic faults and results in pathological conditions. No studies on Aurora-A expression in human diabetic skin tissue have been reported. In light of this, we explored the expression of Aurora-A in human diabetic skin tissue. Aurora-A protein was evaluated by western blotting in 6 human diabetic skin tissue and 6 normal skin specimens. Increased expression of Aurora-A protein was detected in all diabetic skin tissue samples in both western blot analysis and immunohistochemical staining. However, in the case of the normal skin tissue, no bands of Aurora-A protein were detected in either the western blotting analysis or the immunohistochemical staining. Thus far, there have been no studies on the expression of Aurora-A in diabetic skin tissue. However, we believe that oxidative DNA damage related to the expression of Aurora-A protein and Aurora-A could be involved inhuman diabetic skin tissue.
    Archives of Plastic Surgery 01/2014; 41(1):35-9. DOI:10.5999/aps.2014.41.1.35
  • Source
    • "We also analyzed Aurora A kinase, which has been found to phosphorylate and induce p73 protein [29]. Although the phosphorylation sites for Aurora A are retained in the ΔNp73 molecule, we were unable to demonstrate that inhibition of this kinase has a significant effect on ΔNp73 protein levels in BA/A-treated cells. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Gastroesophageal reflux disease (GERD) is the main etiological factor behind the recent rapid increase in the incidence of esophageal adenocarcinoma. During reflux, esophageal cells are exposed to bile at low pH resulting in cellular damage and inflammation, which are known to facilitate cancer development. In this study, we investigated the regulation of p73 isoform, ΔNp73α, in the reflux condition. Previous studies have reported that ΔNp73 exhibits anti-apoptotic and oncogenic properties through inhibition of p53 and p73 proteins. We found that direct exposure of esophageal cells to bile acids in an acidic environment alters the phosphorylation of ΔNp73, its subcellular localization and increases ΔNp73 protein levels. Upregulation of ΔNp73 was also observed in esophageal tissues collected from patients with GERD and Barrett's metaplasia, a precancerous lesion in the esophagus associated with gastric reflux. c-Abl, p38 MAPK, and IKK protein kinases were identified to interact in the regulation of ΔNp73. Their inhibition with chemotherapeutic agents and siRNA suppresses ΔNp73. We also found that pro-inflammatory cytokines, IL-1β and TNFα, are potent inducers of ΔNp73α, which further enhance the bile acids/acid effect. Combined, our studies provide evidence that gastroesophageal reflux alters the regulation of oncogenic ΔNp73 isoform that may facilitate tumorigenic transformation of esophageal metaplastic epithelium.
    PLoS ONE 05/2013; 8(5):e64306. DOI:10.1371/journal.pone.0064306 · 3.23 Impact Factor
Show more