Angiopoietin-1-expressing adipose stem cells genetically modified with baculovirus nanocomplex: investigation in rat heart with acute infarction.

Abstract

The objective of this study was to develop angiopoietin-1 (Ang1)-expressing genetically modified human adipose tissue derived stem cells (hASCs) for myocardial therapy. For this, an efficient gene delivery system using recombinant baculovirus complexed with cell penetrating transactivating transcriptional activator TAT peptide/deoxyribonucleic acid nanoparticles (Bac-NP), through ionic interactions, was used. It was hypothesized that the hybrid Bac- NP(Ang1) system can efficiently transduce hASCs and induces favorable therapeutic effects when transplanted in vivo. To evaluate this hypothesis, a rat model with acute myocardial infarction and intramyocardially transplanted Ang1-expressing hASCs (hASC-Ang1), genetically modified by Bac-NP(Ang1), was used. Ang1 is a crucial pro-angiogenic factor for vascular maturation and neovasculogenesis. The released hAng1 from hASC-Ang1 demonstrated profound mitotic and anti-apoptotic activities on endothelial cells and cardiomyocytes. The transplanted hASC-Ang1 group showed higher cell retention compared to hASC and control groups. A significant increase in capillary density and reduction in infarct sizes were noted in the infarcted hearts with hASC-Ang1 treatment compared to infarcted hearts treated with hASC or the untreated group. Furthermore, the hASC-Ang1 group showed significantly higher cardiac performance in echocardiography (ejection fraction 46.28% ± 6.3%, P < 0.001 versus control, n = 8) than the hASC group (36.35% ± 5.7%, P < 0.01, n = 8), 28 days post-infarction. The study identified Bac-NP complex as an advanced gene delivery vehicle for stem cells and demonstrated its potential to treat ischemic heart disease with high therapeutic index for combined stem cell-gene therapy strategy.

Full text

Page 1

© 2012 Paul et al, publisher and licensee Dove Medical Press Ltd. This is an Open Access article
which permits unrestricted noncommercial use, provided the original work is properly cited.
International Journal of Nanomedicine 2012:7 663–682
International Journal of Nanomedicine
Angiopoietin-1-expressing adipose stem
cells genetically modified with baculovirus
nanocomplex: investigation in rat heart
with acute infarction
Arghya Paul1
Madhur Nayan2
Afshan Afsar Khan1
Dominique Shum-Tim2
Satya Prakash1
1Biomedical Technology and Cell
Therapy Research Laboratory,
Department of Biomedical
Engineering, Faculty of Medicine,
McGill University, 2Divisions of
Cardiac Surgery and Surgical
Research, The Montreal General
Hospital, Montreal, QC, Canada
Correspondence: Satya Prakash
Biomedical Technology and Cell Therapy
Research Laboratory, Department
of Biomedical Engineering, Faculty
of Medicine, 3775 University Street,
McGill University, Montreal,
QC H3A 2B4, Canada
Tel +1 514 398 3676
Fax +1 514 398 7461
Email satya.prakash@mcgill.ca
Abstract: The objective of this study was to develop angiopoietin-1 (Ang1)-expressing
genetically modified human adipose tissue derived stem cells (hASCs) for myocardial therapy.
For this, an efficient gene delivery system using recombinant baculovirus complexed with cell
penetrating transactivating transcriptional activator TAT peptide/deoxyribonucleic acid nano-
particles (Bac-NP), through ionic interactions, was used. It was hypothesized that the hybrid
Bac-NPAng1 system can efficiently transduce hASCs and induces favorable therapeutic effects
when transplanted in vivo. To evaluate this hypothesis, a rat model with acute myocardial infarc-
tion and intramyocardially transplanted Ang1-expressing hASCs (hASC-Ang1), genetically
modified by Bac-NPAng1, was used. Ang1 is a crucial pro-angiogenic factor for vascular maturation
and neovasculogenesis. The released hAng1 from hASC-Ang1 demonstrated profound mitotic
and anti-apoptotic activities on endothelial cells and cardiomyocytes. The transplanted hASC-
Ang1 group showed higher cell retention compared to hASC and control groups. A significant
increase in capillary density and reduction in infarct sizes were noted in the infarcted hearts
with hASC-Ang1 treatment compared to infarcted hearts treated with hASC or the untreated
group. Furthermore, the hASC-Ang1 group showed significantly higher cardiac performance
in echocardiography (ejection fraction 46.28% ± 6.3%, P , 0.001 versus control, n = 8) than
the hASC group (36.35% ± 5.7%, P , 0.01, n = 8), 28 days post-infarction. The study identi-
fied Bac-NP complex as an advanced gene delivery vehicle for stem cells and demonstrated
its potential to treat ischemic heart disease with high therapeutic index for combined stem
cell-gene therapy strategy.
Keywords: combined stem cell-gene therapy, baculovirus, nanoparticle, myocardial therapy,
angiogenesis, tissue engineering
Introduction
A promising therapeutic approach currently under intensive clinical trials is
mesenchymal stem cell (MSC) therapy for congestive heart diseases, which depends on
several corroborated mechanisms, such as myocyte formation and neovascularization
to improve cardiac function and attenuate ventricular remodeling.1,2 Despite promising
initial results, such clinical application remains limited due to logistic, economic, and
timing issues when harvesting autologous stem cells from elderly patients. Moreover,
it has been reported that MSCs obtained from elderly donors and patients with diabetes
or ischemic heart disease have a significantly reduced capacity for neovascularization,
proliferation, and differentiation potential.3
Dovepress
submit your manuscript | www.dovepress.com
Dovepress
663
O R I G I N A L R E S E A R C H
open access to scientific and medical research
Open Access Full Text Article
http://dx.doi.org/10.2147/IJN.S26882
Number of times this article has been viewed
This article was published in the following Dove Press journal:
International Journal of Nanomedicine
7 February 2012

Page 2

International Journal of Nanomedicine 2012:7
Delivering proangiogenic proteins, such as vascular
endothelial growth factor (VEGF) and angiopoietin-1 (Ang1),
using MSC-based gene therapy approaches are currently
being employed in recent studies as an alternative strategy
to promote myocardial angiogenesis and regeneration.4–6
However, the mammalian gene delivery vectors widely used
in such studies have various drawbacks and severe safety
concerns.7–9 These vectors are prone to integration into coding
regions of transcriptionally active genes, raising concerns
about gene silencing and insertional mutagenesis. On the
other hand, nonviral gene delivery systems are much safer
for potential clinical applications, but are currently limited
by low transfection efficiency and highly transient nature of
expression with suboptimal level of transgene expression.
Unlike the aforementioned vectors, baculovirus (Bac) is an
insect cell-originated viral vector that is considered non-
pathogenic to humans as they cannot replicate in mammalian
cells.9,10 The viral genome remains in episomal form within
the nucleus and is degraded within mammalian cells over
time, eliminating the chance of potential mutagenesis. They
can efficiently transduce a wide range of mammalian cells
with minimal cytotoxicity, including MSCs as shown in
earlier studies, and reports confirm the safety of transplanting
Bac-engineered MSCs into immunocompetent animals for
cell-based gene therapy.9,11
The present study aimed to develop a hybrid nanodeliv-
ery system to genetically modify MSCs efficiently, utilizing
the complementary strengths of Bac, such as relatively high
transduction efficiency and easy scale-up, and transactivat-
ing transcriptional activator (TAT)/deoxyribonucleic acid
(DNA) nanoparticles (NPs), such as low immunogenicity.
TAT peptide sequence, obtained from the protein transduction
domain of human immunodeficiency virus-1 responsible for
nuclear import of human immunodeficiency virus genome,
was modified here by incorporating histidine and cysteine
residues for enhanced DNA transport, efficient cell penetra-
tion, cell vesicle escape, and transgene expression.12 The
potential of this new system for direct gene therapy with
cardiomyocytes has recently been demonstrated.13 Here,
it was hypothesized that MSC transduction efficiency can
also be significantly enhanced by this new system where the
negatively charged Bac is coupled with positively charged
endosomolytic histidine rich TAT peptide/DNA NPs, both
carrying the transgene. For this, a unique pool of MSCs
located within the adipose tissue was used, called adipose
tissue-derived stem cells (ASCs), mainly because of their
practical availability and pro-angiogenic, immunomodula-
tory, and other unique properties.14,15 Based on the positive
efficacy data in disease-relevant animal models, ASCs have
recently entered into their first clinical trial.16 In a recent
intriguing study, Metzele et al reported that human ASCs
(hASCs) can fuse to newborn rat heart cells to form new
cardiomyocytes with several nuclei, which can beat when
maintained in a culture environment.17 ASCs possess a natural
ability to secrete VEGF, which overexpresses under hypoxic
conditions in ischemic tissues.18
It has been reported that VEGF in cooperation with
another angiogenic growth factor, Ang1, promotes significant
neovascularization, and their combined action leads to a for-
mation of mature and functional vasculature.19–21 Thus, it was
hypothesized that the secretion of Ang1 along with naturally
releasing VEGF from the genetically modified ASCs,
together with their inherent transdifferentiation abilities to
cardiomyocytes, can induce a superior synergistic therapeu-
tic effect for myocardial regeneration therapy. Additionally,
acute myocardial infarction also induces a high circulating
endogenous serum VEGF state.22 With these rationales, Ang1
complementary DNA-carrying recombinant Bac and TAT
NPs were generated, a self-assembled binary nanocomplex
was prepared by hybridizing the two, and its efficiency to
express functionally active Ang1 was determined using
optimized transduction protocol with hASCs. The in vivo
efficacy of the formulated nanobiohybrid (Bac-NP) system
for combined stem cell-gene therapy applications was also
evaluated using human Ang1 (hAng1)-expressing genetically
modified hASCs for myocardial therapy using an immuno-
competent infarcted rat heart model. A schematic presenta-
tion of the entire procedure is demonstrated in Figure 1.
Methods and materials
Cell culture and preparation
of Bac gene delivery complex
Human ASCs (n = 1 male donor) were obtained from Invitro-
gen Life Technologies (Carlsbad, CA) and cultured in Gibco®
Dulbecco’s Modified Eagle Medium (Invitrogen) supplemented
with 10% fetal bovine serum (FBS, Gibco, Grand Island, NY).
The cells were routinely maintained as stationary cultures in
75 cm2 tissue culture flasks (Corning, MA) and incubated at
37°C in a controlled environment with an air atmosphere of
5% carbon dioxide. Human umbilical vein endothelial cells
(HUVECs) (ScienCell Research Laboratories, Carlsbad, CA)
were cultured and expanded on tissue culture flasks according
to the supplier’s instructions. They were cultured in endothe-
lial cell medium (ScienCell) supplemented with 5% FBS and
placed in an incubator containing 5% carbon dioxide at 37°C.
H9c2 myogenic cell line, derived from embryonic rat heart
submit your manuscript | www.dovepress.com
Dovepress
Dovepress
664
Paul et al

Page 3

International Journal of Nanomedicine 2012:7
ventricles, was obtained from American Type Culture Collection
(CRL-1446; Manassas, VA) and cultured in Dulbecco’s Modi-
fied Eagle Medium supplemented with 10% FBS. The cells
were routinely maintained as stationary cultures in flasks,
incubated at 37°C in a controlled environment with 5% carbon
dioxide. Sf 9 insect cells (Invitrogen) were maintained at 27°C
in SF-900™ III serum free medium (Invitrogen). The cells
were maintained in exponential growth phase and subcultured
twice per week. Larger volumes were prepared in shaker flasks
(Erlenmeyer; Corning Life Sciences, Lowell, MA) which were
agitated at 120 rpm in an incubator shaker as mentioned in
earlier studies.11
Generation of LacZ and Ang1 gene-carrying recombinant
Bac and their subsequent hybridization with NPs to form
submit your manuscript | www.dovepress.com
Dovepress
Dovepress
665
Genetically modified angiopoietin-1 in myotherapy
BacAng1
Insect cell culture
Cell transplantation in
myocardially infarcted heart
(In vivo studies: cell retention,
neovasculogenesis, fibrosis and
cardiac function)
Negatively charged
(BacAng1)
Positively charged
TAT/DNA nanocomplex
(NPAng1)
Hybridized Bac-NPAng1 self-
assembled nanocomplex
formed by ionic interaction
hASC culture transduced
with Bac-NPAng1
In vitro studies: ELISA,
mitotic, chemotactic and
anti-apoptotic effects
Genetically modified
hASCs expressing hAng1
(hASC-Ang1)
Figure 1 Schematic representation of the overall scheme: generation of recombinant baculovirus (BacAng1), preparation of hybridized baculovirus with TAT/DNA
nanoparticles, in vitro human adipose tissue-derived stem cell transduction, and in vivo investigation using direct intramyocardial transplantation of ASC-Ang1 using a rat
model with acute myocardial infarction. Transmission electronic microscopic pictures of baculovirus, nanoparticle, and baculovirus-nanoparticle complex shown in subsets
confirm the formation of the nanocomplex (in white arrows).
Abbreviations: ASC-Ang1, angiopoietin-1-expressing adipose tissue-derived stem cells; BacAng1, angiopoietin-1-carrying baculovirus; Bac-NPAng1, angiopoietin-1-
carrying baculovirus-nanoparticle complex; DNA, deoxyribonucleic acid; ELISA, enzyme-linked immunosorbent assay; NPAng1, angiopoietin-1-carrying nanoparticles;
TAT, transactivating transcriptional activator.

Page 4

International Journal of Nanomedicine 2012:7
Bac-NPAng1 and Bac-NPLacz were performed using protocol
as mentioned in earlier work.13
Detection of hAng1 expressed
by the transduced hASCs: enzyme-
linked immunosorbent assay (ELISA)
and immunofluorostaining
In order to evaluate the transduction efficiency of Bac-NP on
hASCs and compare it with free Bac and NP gene system,
NPAng1, BacAng1, and Bac-NPAng1 at multiplicity of infection
(MOI; defined as plaque forming units per cell) of 200 were
used. hASCs were seeded in six-well plates at 0.5 × 106
cells/well and incubated overnight at 5% carbon dioxide and
37°C. Following this, an appropriate volume of the nanocom-
plexes suspended in phosphate buffered saline (PBS; Life
Technologies, Burlington, ON, Canada) was added to each
well and incubated for 4 hours. Following this, the transduc-
tion solution was replaced with fresh media and grown in a
cell culture incubator. Conditioned media were collected every
alternate day for 21 days and stored at −80°C for Ang1 ELISA
(R&D Systems, Inc, Minneapolis, MN) analysis using standard
procedure provided by the manufacturer.13 To detect the Ang1
expressed within the transduced cells, in another set of experi-
ments, hASCs transduced with NPAng1, BacAng1, and Bac-NPAng1
or nontreated controls were grown on glass microscope slides
for 96 hours. After washing with PBS, the cells were fixed
with −20°C methanol for 10 minutes followed by immuno-
staining as mentioned elsewhere.23 Briefly, after blocking for
1 hour with 10% donkey serum (Santa Cruz Biotechnology,
Santa Cruz, CA), the cells were incubated overnight at 37°C
with 1:50 dilution of goat anti-hAng1 (Santa Cruz Biotech-
nology) primary antibodies. On the second day, the cells were
thoroughly washed with wash buffer. The cells were incu-
bated with donkey anti-goat immunoglobulin G-tetramethyl
rhodamine isothiocyanate (Santa Cruz Biotechnology) with
1:200 dilutions for 1 hour. The proportions and intensities of
tetramethyl rhodamine isothiocyanate-positive hASCs, as seen
under fluorescence microscope (Eclipse TE2000U; Nikon Cor-
poration, Tokyo, Japan), gave a qualitative idea of the relative
amount of cellular Ang1 expressed due to transgene delivery
by the different delivery systems.
Cell proliferation and viability assay
For the cell proliferation assay, 2 × 104 HUVEC cells/
well were seeded in triplicate for each sample in 96-well
plates. After 8 hours of culturing, the cells were washed
twice with PBS and 200 µL of conditioned media from
nontransduced hASCs, Bac-NPLacZ-transduced hASCs,
Bac-NPAng1-transduced hASCs, and Bac-NPAng1-transduced
hASCs supplemented with anti-hAng1 antibodies were
added to the corresponding set of wells. After 96 hours,
absorbance was measured at 490 nm using CellTiter
96® AQueous Non- Radioactive Cell Proliferation Assay
(Promega, Fitchburg, WI) in a Victor3 Multi Label Plate
Counter (Perkin Elmer, Montreal, QC, Canada).24 In a similar
way, cardiomyocyte cell viabilities under oxidative stress in
groups treated with different conditioned media were mea-
sured as described later in the study, using the same assay.
The experiment was performed in triplicate.
Wound healing assay with HUVECs
In order to check the wound healing potential of released
Ang1, HUVECs were seeded into 24-well plates and grown
to confluency. After 24 hours of serum starvation (1% FBS),
lesions were made in the monolayer using a cell scraper.13
Cells were rinsed with PBS, and then incubated with the hASC
cardiomyocytes from different experimental groups (NPAng1,
BacAng1, and Bac-NPAng1) for 24 hours. Cardiomyocytes
from untransduced hASCs were used as control. To confirm
the beneficial effect of Ang1 in particular, cardiomyocytes
from Bac-NPAng1 group were preincubated with anti-Ang1
neutralizing antibody (R&D Systems; 1 µg/mL) for 30 min-
utes before being added to the wells. Cells were fixed with
4% paraformaldehyde (Sigma-Aldrich, St Louis, MO) after
24 hours and the number of cells which had moved across the
starting scratched lines were measured for all groups. Three
fields were analyzed for each well at 200× magnification under
bright field settings of the microscope mentioned earlier.
Apoptosis assay using cardiomyocytes
H9c2 cells were seeded in 96-well microtiter plates at a density
of 2 × 104 cells/well and cultured overnight. The media was
replaced with cardiomyocytes from different treatment groups
and oxidative stress was induced by adding 200 µM hydro-
gen peroxide to the media as described elsewhere.25 After
6 hours, the apoptotic cells were detected by tracking the loss
of mitochondrial membrane potential using MitoCapture™
Apoptosis Detection Kit (BioVision, Inc, Mountain View,
CA) cell staining cationic dye, according to the manufacturer’s
protocol, which fluoresces differently in healthy and apoptotic
cells under fluorescence microscope (488-nm and 543-nm
excitation filters). The red emission of the dye is due to a
potential-dependent aggregation in the mitochondria reflecting
normal membrane potential and the green fluorescence detects
the monomeric form of MitoCapture, appearing in the cyto-
sol after mitochondrial membrane depolarization.26 For each
submit your manuscript | www.dovepress.com
Dovepress
Dovepress
666
Paul et al

Page 5

International Journal of Nanomedicine 2012:7
experimental group, total cell number was counted and related
to the number of cells that displayed fluorescence. In a similar
way, after oxidative stress of 6 hours, the cell viabilities were
also checked using CellTiter 96 assay as mentioned above.
In vivo studies in myocardially
infarcted rat model
Immunocompetent female Lewis rats (200–250 g; Charles
River Laboratories, Senneville, QC, Canada) were used. All
procedures were in compliance with the Guide for the Care
and Use of Laboratory Animals (National Institutes of Health
publication 85-23) and the Guide to the Care and Use of
Experimental Animals of the Canadian Council on Animal
Care. Female Lewis rats were anesthetized. The rats were intu-
bated with an 18-gauge catheter and mechanically ventilated
(Harvard Ventilator 683; Harvard Apparatus, St Laurent, QC,
Canada) at 80 breaths/minute. Anesthesia was maintained with
3% isoflurane. A left thoracotomy was performed through the
fourth intercostal space to expose the left ventricle. The left
coronary artery was ligated 2 mm from its origin with a 7-0
polypropylene suture (Ethicon, Inc, Somerville, NJ) using
standard protocol.13 The ischemic myocardial segment rapidly
became identifiable through its pallor. Fifteen minutes after
ligation of the artery, intramyocardial injections were given. In
the control group with no hASC (n = 8), 300 µL of the culture
medium was divided into three equal periinfarct left ventricular
intramyocardial injections using a 27 gauge needle. In the hASC
group (n = 8), the same procedure was repeated using culture
medium containing 3 × 106 hASCs, while the group hASC-
Ang1 (n = 8) received the same number of cells transduced
with Bac-NPAng1 (MOI: 200) suspended in culture medium.
To detect the transgene expression in transplanted cells,
three animals underwent the same experimental procedure as
described above, followed by injection of three million cells
transduced with Bac-NPLacZ (MOI: 200). Three days post-
transplantation, LacZ expression was detected in histological
samples using a standard staining LacZ staining procedure.13
Detection of transplanted male
hASCs in female rat hearts:
polymerase chain reaction (PCR)
analysis for human Y chromosome
In order to detect the transplanted hASCs from the male
donor in heart tissue, samples from groups with no hASC
(n = 6), hASC (n = 6), and hASC-Ang1 (n = 6) were taken.
After 3 days and 28 days post-injection, three animals from
each group were sacrificed and heart tissue samples were
snap frozen. PCR analysis was done on the extracted DNA
samples to confirm the survival of the implanted gender-
mismatched cells in the hearts using standard procedure
followed in earlier studies.27 Briefly, equal amounts of DNA
were extracted from peri-infarct portions of the ventricular
heart in each group and PCR analysis was done to confirm
the survival of the implanted gender-mismatched cells in
the hearts 3 days and 28 days post-operation. Genomic
DNA was purified using DNeasy (QIAGEN, Valencia, CA)
according to the manufacturer’s instructions, and the pres-
ence of living male cells in female hearts was confirmed
by targeting a specific microsatellite sequence within the
Y chromosome (DYS390). The primer pairs used were for-
ward primer 5′TATATTTTACACATTTTTGGGCC3′ and
reverse primer 5′TGACAGTAAAATGAACACATTGC3′
with product length of 250 base pairs.
Scar area analysis: myocardial infarct size
Twenty-eight days post-operation, rats were deeply anes-
thetized and sacrificed by rapid excision of the heart. The
excised hearts were immediately soaked in cold saline
to remove excess blood from the ventricles and fixed in
neutral-buffered 4% formalin. Paraffin embedded samples
were sectioned at 5 µm, and Masson’s trichrome staining
(Diagnostic BioSystems, Pleasanton, CA) was performed
to delineate scar tissue (blue color) from the total area of
myocardium.22,28 Masson’s trichrome-stained section images
were analyzed by ImageJ 1.41 software (National Institutes
of Health, Bethesda, MA). Infarct area, epicardial and endo-
cardial length of infarction, and ventricular and septal wall
thickness were calculated and expressed as a percentage.
Immunohistochemistry for detecting
neovascularization
Neovascularization was evaluated by analyzing capil-
lary and arteriole density in the periinfarct area. For
this, immunohistochemical staining was performed with
anti-PECAM (Santa Cruz Biotechnology) for identifica-
tion of endothelial cells and antismooth muscle α-actin
(Santa Cruz Biotechnology) for tracing the smooth muscle
cells, as described elsewhere.22 Briefly, for measurement
of capillary density, five fields in the periinfarct area were
imaged with 200× magnification and average numbers of
capillaries ,10 µm in diameter were counted. Capillary
density was quantified as (mean total PECAM-positive
microvessels)/mm2 using three tissue sections spanning the
periinfarct tissue region of each animal. Similarly, arteriole
densities were quantified as (mean total smooth muscle
α-actin-positive microvessels)/mm2.
submit your manuscript | www.dovepress.com
Dovepress
Dovepress
667
Genetically modified angiopoietin-1 in myotherapy