Comparison and transfer testing of multiplex ligation detection methods for GM plants.

Abstract

With the increasing number of GMOs on the global market the maintenance of European GMO regulations is becoming more complex. For the analysis of a single food or feed sample it is necessary to assess the sample for the presence of many GMO-targets simultaneously at a sensitive level. Several methods have been published regarding DNA-based multidetection. Multiplex ligation detection methods have been described that use the same basic approach: i) hybridisation and ligation of specific probes, ii) amplification of the ligated probes and iii) detection and identification of the amplified products. Despite they all have this same basis, the published ligation methods differ radically. The present study investigated with real-time PCR whether these different ligation methods have any influence on the performance of the probes. Sensitivity and the specificity of the padlock probes (PLPs) with the ligation protocol with the best performance were also tested and the selected method was initially validated in a laboratory exchange study.
Of the ligation protocols tested in this study, the best results were obtained with the PPLMD I and PPLMD II protocols and no consistent differences between these two protocols were observed. Both protocols are based on padlock probe ligation combined with microarray detection. Twenty PLPs were tested for specificity and the best probes were subjected to further evaluation. Up to 13 targets were detected specifically and simultaneously. During the interlaboratory exchange study similar results were achieved by the two participating institutes (NIB, Slovenia, and RIKILT, the Netherlands).
From the comparison of ligation protocols it can be concluded that two protocols perform equally well on the basis of the selected set of PLPs. Using the most ideal parameters the multiplicity of one of the methods was tested and 13 targets were successfully and specifically detected. In the interlaboratory exchange study it was shown that the selected method meets the 0.1% sensitivity criterion. The present study thus shows that specific and sensitive multidetection of GMO targets is now feasible.

Full text

Page 1

RESEARCH ARTICLEOpen Access
Comparison and transfer testing of multiplex
ligation detection methods for GM plants
Gabriella Ujhelyi1, Jeroen P van Dijk2*, Theo W Prins2, Marleen M Voorhuijzen2, AM Angeline Van Hoef2,
Henriek G Beenen3, Dany Morisset4, Kristina Gruden4and Esther J Kok2
Abstract
Background: With the increasing number of GMOs on the global market the maintenance of European GMO
regulations is becoming more complex. For the analysis of a single food or feed sample it is necessary to assess
the sample for the presence of many GMO-targets simultaneously at a sensitive level. Several methods have been
published regarding DNA-based multidetection. Multiplex ligation detection methods have been described that
use the same basic approach: i) hybridisation and ligation of specific probes, ii) amplification of the ligated probes
and iii) detection and identification of the amplified products. Despite they all have this same basis, the published
ligation methods differ radically. The present study investigated with real-time PCR whether these different ligation
methods have any influence on the performance of the probes. Sensitivity and the specificity of the padlock
probes (PLPs) with the ligation protocol with the best performance were also tested and the selected method was
initially validated in a laboratory exchange study.
Results: Of the ligation protocols tested in this study, the best results were obtained with the PPLMD I and PPLMD
II protocols and no consistent differences between these two protocols were observed. Both protocols are based
on padlock probe ligation combined with microarray detection. Twenty PLPs were tested for specificity and the
best probes were subjected to further evaluation. Up to 13 targets were detected specifically and simultaneously.
During the interlaboratory exchange study similar results were achieved by the two participating institutes (NIB,
Slovenia, and RIKILT, the Netherlands).
Conclusions: From the comparison of ligation protocols it can be concluded that two protocols perform equally
well on the basis of the selected set of PLPs. Using the most ideal parameters the multiplicity of one of the
methods was tested and 13 targets were successfully and specifically detected. In the interlaboratory exchange
study it was shown that the selected method meets the 0.1% sensitivity criterion. The present study thus shows
that specific and sensitive multidetection of GMO targets is now feasible.
Background
The adoption of crops that are genetically modified
organisms (GMOs) has continuously increased over the
last decade with 148 million hectares grown in 2010
worldwide [1]. Because of the increasing number of GM
crops, the analysis of an individual food or feed sample
for the potential presence of GMOs becomes more
complex, time-consuming and expensive. To overcome
these problems it is necessary to develop a method
which can identify many GMO-derived DNA targets in
a single experiment, at a sensitive level, reducing both
cost and analysis time. The potential presence of
unauthorized GM crops makes the situation even more
complicated [2,3].
Currently, the most common method to detect and
identify GMOs in food and feed products is real-time
polymerase chain reaction (PCR). For most targets this
method has a limit of detection (LOD) of 0.1% or less.
In the scientific literature, different multiplex GMO
detection methods have been described but various pro-
blems with detection level and specificity have been
reported. Ligation-based systems seem very promising
approaches to detect GMOs in a multiplex setting in a
sensitive and specific way.
* Correspondence: jeroen.vandijk@wur.nl
2RIKILT - Institute of Food Safety (WUR), Akkermaalsbos 2, 6708 WB,
Wageningen, the Netherlands
Full list of author information is available at the end of the article
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
© 2012 Ujhelyi et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.

Page 2

Ligation was one of the first tools in the hands of
molecular biologists for cloning and DNA manipulation
and has played a major role in explanation of gene func-
tions. It was also found that ligation can be used for
detection of specific DNA sequences [4]. During the
1990s several ideas and theories were examined for
making ligation detection more sensitive and applicable
for multiplex detection. One of the resulting strategies
used so-called padlock probes (PLPs). PLPs were
designed to be linear with the ligation sites at the extre-
mities. The PLP was shown to be circularized after liga-
tion [5] and with this method up to 10,000 DNA targets
were detected simultaneously in a human setting [6]. In
the area of single-nucleotide polymorphism (SNP) detec-
tion of up to thousands of targets has been reached [7].
A PLP usually contains universal primer sites for PCR
amplification and a universal microarray can be used for
detection and identification (Figure 1). Such a padlock
system was adapted to detect and identify (GMO) crops
[8,9].
In a tenplex PLP experiment different genomic targets
in GTS 40-3-2 soy, MON1445 cotton and Bt176 maize
were detected down to at least 1% [8]. The PLP system
can be used not just for GMO detection but also for
other nucleic acid experiments. It was for instance used
for SNP-based genotyping in allohexaploid wheat [10].
Other ligation based techniques have been developed
to detect GMOs as well. One of these uses two separate
“ bipartite ligation” probes for each target. After the
amplification of the targets the detection can be per-
formed either by capillary electrophoresis or by microar-
ray hybridization. This kind of ligation-dependent probe
amplification (LPA) system was used by Moreano et al.
[11] to detect several targets. In their study two endo-
genous targets and two event specific junction regions
were detected simultaneously. GMO maize DNA (0.1%)
was detected in the presence of 5% GM soy DNA and
vice versa. This group improved the above-mentioned
LPA technique for more targets [12]. This LPA techni-
que was also used for simultaneous detection of 10
allergens [13]. Holck et al. [14] developed a nineplex
ligation-dependent probe amplification method for
detection of seven GM maize events, one GM maize
construct and one endogenous maize reference gene.
A so-called SNPlex method, which used also two sepa-
rate probes, has also been tested for GM detection by
Chaouachi et al. [15]. Probes in this paper contained
universal primer sites for the PCR and specific ZIP-
codes (ZIPChute probe). As one of the primers was bio-
tinylated, the biotinylated amplicon was captured onto a
streptavidin coated surface after the PCR. These ZIPs
contained a unique sequence that enabled their size dif-
ferentiation during electrophoresis. This assay allowed
the simultaneous detection of potentially up to 48 DNA
sequences (endogenous, element-, construct-, and event-
specific targets). In their paper simultaneous detection
for up to seven targets was shown with a detection limit
range of 0.1-1%.
padlock probes
(PLP)
genomic DNA
(gDNA)
specific PLP-gDNA
interactions
non-ligated probes
(d,e,f)
?
‘negative’ gDNA
unique target site 1
universal reverse primer site
universal forward primer site
unique ZIP DNA sequence
unique target site 2
no exponential amplification in PCR
exponential
amplification in PCR
x ~109
x ~109
x ~109
abcd
ef..
....
a
b
c
d
e
f
A, match
B, match
C, match
no matchhybridisation,
aA
bB
cC
abc
d
e
f
Universal microarray
ligation
?
Figure 1 Scheme of the padlock ligation detection procedure. A mix of linear padlock probes can hybridize to their genomic counterparts,
after which the juxtaposed ends are ligated to form a circular molecule. Only ligated, circular molecules are amplified by subsequent PCR with a
universal forward and Cy3-labelled reverse primer. Non-ligated probes will not be amplified as the primer sites point away from each other. Each
probe contains a unique DNA sequence (cZIP-code). After PCR the products are visualized by hybridization of the Cy3-labelled molecule on a
microarray via a homologous ZIP sequence.
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
Page 2 of 12

Page 3

Peano et al. [16] also applied separate probes and the
ligation detection reaction was combined with a univer-
sal array approach. They performed an extra pre-ampli-
fication step before the ligation and describe the
detection of five different GMOs when present at 0.4%
each, relative to non-GM (conventional) material.
Ligation based systems have been used for other
nucleic acid experiments as well. Ericsson et al. [17]
used a dual-tag microarray platform for high-perfor-
mance nucleic acid analysis. After the dual-tag probe
ligation, solution phase rolling circle amplification was
performed and the detection was carried out on chip.
Different other multiplex approaches have been
described by several authors [18-23] to detect GMOs
but none of the techniques have so far shown more
multiplicity than the ligation detection methods.
It was noted that the above-mentioned ligation based
methods used various ligation protocols, which are radi-
cally different from each other with regard to tempera-
tures, incubation times and number of reaction cycles
(Figure 2). There are also some differences among the
types of probes, probe concentrations and the type of
ligation enzymes, but all publications seem to reach
similar sensitivities so far. In the literature different
kinds of PCR parameters have been described as well,
but the different PCR parameters are not likely to have
so much effect on the sensitivity compared to the liga-
tion step. The large differences among these ligation
procedures led us to compare different protocols in a
common sample setting to try and find the factors that
are most important for specific and sensitive GMO
(multi)detection.
To this end the present study aimed to compare dif-
ferent ligation protocols including reaction temperatures
with the PLP system in different GM mixes. Three of
the selected ligation protocols were GMO detection
related [8,12,15] and the other two were used for other
types of nucleic acid analysis [10,17]. The detection was
performed with TaqMan probes designed for PLPs in all
cases, using the same real-time PCR parameters in four-
plex and the best results were confirmed on microarray.
Further aim was to test the specificity of the system
using the best ligation protocol, based on the results of
the ligation comparison. Finally, the transferability of
method was tested in an interlaboratory exchange study
as an initial validation step of the approach.
Methods
Plant materials
For detailed information on the composition of the
genetically modified organisms (GMOs) used for the
experiments, see the GMO Detection Method Database
[24] and GM Crop Database [25]. Ground seed materi-
als were purchased from IRMM (Geel, Belgium) and
AOCS (Urbana, IL, USA) (Table 1). The same reference
materials were used throughout the study and the
results reflect these materials. As such, differences in
any of the GMOs that may occur in different years of
cultivation are not part of the present study.
DNA extraction
The following protocol was used for all maize samples
except for 100% Bt176 and 100% TC1507. Plant material
(100 mg), 150 μl MilliQ treated water (MQ) and 350 μl
CTAB extraction buffer (20 g/l CTAB; 1.4 M NaCl; 0.1
M Tris-HCl; 20 mM EDTA) was mixed together with 5
μl RNaseA (Qiagen) and incubated for 15 min at 65°C.
Subsequently, 20 μl 20 mg/ml Proteinase K (Fermentas
Molecular Biology, Germany) was added and the mix
was incubated for 15 min at 65°C. After adding 200 μl
of Buffer AP2 (Qiagen DNeasy Plant Minikit) the mix
was placed on ice for 5 min. Further steps continued
from step 4 of the Qiagen DNeasy Plant Minikit proto-
col without modifications [26]. For GTS 40-3-2, 100%
Bt176 and 100% TC1507 the DNA Wizard Clean up
system for genomic DNA (Promega) was used. Plant
material (200 mg) was weighed and DNA extraction was
performed according to Zimmermann et al. [27]. DNA
concentrations and the purity of the DNAs (A260/A280
and A260/A230) were measured with NanoDrop spec-
trophotometer (NanoDrop ND-1000, V3.5.2).
Padlock probes/PLPs
Different mixtures of PLPs were prepared for the differ-
ent purposes. The mixture used for the ligation compar-
ison contained the PLPs for detection of cry1Ab, bar,
????????
???????
????????????
?????????????
????????????
???????????
????????
???????
????????????
??????????
????????????
??
???????????
????
????????????
???????????
????????????
???
?????? ????
????
?????????????
?????????????
?????????????
???????????
??????????????????????
???
??????????????
????
????????????????????????
????????????
?????????????
???
Figure 2 Differences among the published ligation protocols.
For each method, a temperature (y-axis) × time diagram (x-axis) is
shown as it was used in the indicated references. LPA: Ligation-
dependent Probe Amplification, DTM: Dual Tag Microarray, PPLMD:
Padlock Probe Ligation in combination with Microarray Detection.
*PPLMD II: Edwards et al. [10] did not use any abbreviated protocol
name for their method contrary to the other authors [8,12,15,17],
but for clarity this protocol was called PPLMD II in this article.
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
Page 3 of 12

Page 4

TC1507 and maize endogenous hmg in concentrations
shown in the protocol section.
A 20-plex PLP mixture was used for testing the speci-
ficity and consisted of the following PLPs: three event
specific PLPs (GTS 40-3-2, MON810, Bt176), seven ele-
ment specific PLPs (cry1F, pat, bar, CP4-epsps,
p35SCaMV, p35SFMV and barstar), one construct spe-
cific (Bt11), eight species specific (maize, soy, cotton,
Table 1 Final composition of the prepared GM mixes
ExperimentNameComponentSourceCodeFinal
concentration*
GMO construct copy numbers in 200
ng DNA**
Ligation
comparison
GM mix 1 1% Bt176 maizeIRMMERM-
BF411d
ERM-
BF418d
ERM-
BF413a
ERM-
BF411f
ERM-
BF418d
ERM-
BF413a
0.1% Bt17618
10% TC1507 maizeIRMM5% TC1507889
0% MON810 maize***IRMM
GM mix 2 5% Bt176 maizeIRMM 2.5% Bt176 444
10% TC1507 maizeIRMM1% TC1507178
0% MON810 maize*** IRMM
GM mix 3100% Bt176 maize
100% TC1507 maize
0% GTS 40-3-2 ****
RIKILT
RIKILT
IRMM
2.5% Bt176
2.5% TC1507
444
444
ERM-
BF410a
Specificity
testing
Mix 1 > 97.9% 281-24-236x3006-210-23
cotton
100% LL25 cotton
100% RF3 canola
100% LL62 rice
> 89.9%
MON863xNK603xMON810 maize
> 99.4% MON15985xMON1445
cotton
oat
barley
wheat
IRMMERM-
BF422b
0306-D
0306-G
0306-I
0406-C
16.7%6789
AOCS
AOCS
AOCS
AOCS
16.7%
16.7%
16.7%
16.7%
6789
13047
37111
2966
AOCS 0804-F16.7%6789
Mix 2Biolytix
Biolytix
Biolytix
33.3%
33.3%
33.3%
Exchange study1% GM
mix
5% Bt176 maizeIRMM ERM-
BF411f
ERM-
BF418d
ERM-
BF416d
ERM-
BF413a
1% Bt176178
10% TC1507 maizeIRMM 1% TC1507 178
10% MON863 maizeIRMM1% MON863 178
0% MON810 maize*** IRMM
0.1% GM
mix
1% Bt176 maize1% GM
mix
1% GM
mix
1% GM
mix
IRMM
0.1% Bt17618
1% TC1507 maize 0.1% TC150718
1% MON863 maize0.1% MON86318
0% MON810 maize*** ERM-
BF413a
ERM-
BF413a
0% GM
mix
0% MON810 maize*** IRMM
*expressed as percentage of total mass
**based on information in the reference material certificate, unless stated otherwise in the certificate, GMO constructs were assumed to be present as single
copy, homozygous insertions in the native genomic DNA
***certified as < 0.2% MON810
****certified as < 0.3% GTS 40-3-2, commercially known as Roundup Ready soy.
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
Page 4 of 12

Page 5

rice, canola, wheat, oat and barley) and one control PLP
(spikelock). Every PLP was present at a concentration of
250 pM.
For the exchange study a tenplex PLP mixture was
prepared containing maize hmg, maize zein, p35SCaMV,
pat, bar, cry1F, cry1Ab, cry3Bb, TC1507 and the Spike-
lock, also at a final concentration of 250 pM per PLP.
The relevant sequences of the newly designed PLPs
are given in Table 2 and Table 3. The same primer
binding sites were used as previously published [8]. All
other PLPs were published before [8,9].
Ligation protocols
All ligation reactions were performed in a BioRad iCy-
cler IQ 3.021.
According to Prins et al. [8] (PPLMD I)
Two hundred nanograms of DNA was used for the liga-
tion reaction which consisted of 1 × Pfu ligation buffer
(Stratagene); 12% PEG6000 (Fluka, Germany); 0.1 U/μl
Pfu ligase (Stratagene) and 25 pM of each PLP in a final
volume of 10 μl. The following cycle conditions were
used 94°C for 5 min; 95°C 30 s, 65°C 5 min for 30
cycles.
According to Ericsson et al. [17] (DTM)
Ligation reactions were performed in 10 μl comprising
0.1 nM of each PLP, 200 ng DNA, and 5 U of Ampli-
gase in Ampligase buffer (Epicentre Biotechnologies,
WI, USA). The ligation reaction was performed for 4
cycles of 4 h at 50°C and 2 min at 95°C.
According to Ehlert et al. [12] (LPA)
DNA (250 ng) was denatured for 5 min at 98°C. Subse-
quent 1.5 μl of MLPA buffer (MRC Holland, Amster-
dam, the Netherlands) and 1.5 μl of a mixture of 2 fmol
of each PLP were added and the reaction was kept for
16 h at 60°C. The subsequent ligation reaction was per-
formed at 54°C for 15 min by adding 3 μl Ligase-65 buf-
fer A, 3 μl Ligase-65 buffer B, 25 μl MilliQ and 1 μl
Ligase-65 (MRC-Holland, Amsterdam, the Netherlands).
A final incubation for 5 min at 98°C was used to inacti-
vate the enzyme.
According to Edwards et al. [10] (PPLMD II)
DNA (25 ng) was mixed with 1 μl of a 300 pM PLP
mix, 1 U of Ampligase (Epicentre, Madison, Wisconsin,
USA) and 3 μl of Ampligase reaction buffer in a total
volume of 30 μl. The following cycling conditions were
used: 95°C for 5 min; 95°C for 2 min and 72°C for 20
min for 10 cycles and enzyme inactivation at 95°C for 2
min.
According to Chaouachi et al. [15] (SNPlex)
Ligation chemicals were applied as described by Prins et
al. [8]. Cycling conditions were used according to
Chaouachi et al. [15] and consisted of the following
steps: 48°C 30 min; 90°C 20 min; after 94°C 15 s, 60°C
30 s, 51°C with a 3% ramp of 30 s for 25 cycles; and 99°
C 10 min.
PCR detection
In all cases Linear After The Exponential (LATE)-PCR
[28] in combination with asymmetric primer concen-
trations [8,9] was used in order to create single
stranded PCR products. For the ligation comparison
detection was performed using real-time PCR. TaqMan
probes were designed with the aid of Beacon designer
7.0 Software (Premier Biosoft, California, USA). All
primers and probes were purchased from Biolegio, the
Netherlands. Sequences of the TaqMan probes are
described in Table 3.
All real-time PCRs were performed on a BioRad iCy-
cler IQ with Universal Mastermix No-ROX PCR kit
from Diagenode (Liège, Belgium). Reaction tubes con-
tained 4 μl ligation mixture, 12.5 μl mastermix, 500
nM forward primer, 50 nM reverse primer and 400
nM TaqMan probe in a total volume of 25 μl. The fol-
lowing cycling protocol was used: 10 min at 95°C fol-
lowed by 40 cycles consisting of 10 s at 95°C and 40 s
at 60°C.
Table 2 DNA sequences of the oligonucleotides used in padlocks
Name TypeT1, 5’ target (5’-3’)cZIP sequence (5’-3’)T2, 3’ target (5’-3’)Size
(nt)
TC1507
pat
cry1F
cry1Ab
cp4-epsps
barstar
Bt11
maize
(hmg)
maize
(zein)
rice
event
element
element
element
element
element
construct ATCTTCGCTAGAGTAAGGGTTTCTTATATGCTCAACACATGAGCG GAATGCGGTTCAACAGTCTT
speciesCACACAAACGCACGCGTAAAACAATTAATCAGCACGAG
CGCGGTTTGTGATATCGTTAACCATTACATTGAGACGTCTAC
CAACCACAGACTTAAAACCTTGCGCCTCCATAGAC
GAAACGTGTAAGGGACAGGGAGATGTCTAACGGCAATC
CAGGTTGGTGCACTTGGTGAGGGGGATCTGGGTGATTTGG
GGCCTTGCCCGTATTGATGACGTCCTCGCC
GCCTCCATTCCAAAACGAGCGGGTACTCCA
ATGATGTGCAAAGTGCCGTC
ACGCTAATGACGGCAGTGCA GGAAGGCCTATAACAG
ATTTGACGAACGTATGCCGC
ACATCCTGGACACGAGTGAC GGTGCCGCTGCC
ATTAACTCGACTGCCGCGTG
TCCTCTCGTTGGATGTGAGC
CTTTCGTTCTTGTGTTC126
118
ACAAACTCAGACAACAG 122
119
111
114
126
121
CCCATGGCCTGCAT
CTTGCTTTGTTCAAACT
GCGAGGTGAAGAGG
GCCTTGTCCTACAATC CTGCGGTGTCAGTGATCTCT
CTGTGGCATCATCACTGGCATCGTGTACTACATTCGTGCGATGG TTAGGCGTCATCAT 124
speciesCCATTGCTGTCTCTGCAAGCTCACGCGCATGCAGCGTAGGTATCGACTCGGCAGCAACTCTCA 110
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
Page 5 of 12

Page 6

Microarray analysis
For PLP specificity testing as well as the exchange study,
detection was performed on a microarray using a Cy3
labelled reverse primer in the LATE-PCR as described
by Prins et al. [8]. Two brands of arrays were used for
the experiments. The EAT (Eppendorf Array Technolo-
gies, Belgium) slide contained 8 microarrays and the Iso-
gen (Isogen, the Netherlands) slide contained 2
microarrays. In both cases each array contained 100
spotted ZIP-codes (20-mer oligonucleotide sequences
from Affymetrix) with a 10-mer A-tail (and C6 to lin-
ker) in quadruplicate per microarray. 2 μl denatured
labelled mix was applied to either 38 μl (EAT array) or
63 μl (Isogen array) hybridisation mixture. 0.4 nM (EAT
array) or 0.2 nM (Isogen array) Cy3 labelled cZIP-B3
was used as a hybridisation control. Following steps
were performed according to Prins et al. [8].
Data analysis
Real-time PCR
Four observations for the optimal temperature for each
method were subjected to ANOVA (a = 0.01) and
Tukeys HSD post-hoc testing for statistical evaluation of
the results. Results were expressed as the ΔCt, i.e. the
difference between the Ct value of the sample and the
Ct value of 0% GTS 40-3-2 in the same experiment.
Only samples with at least three replicates of positive
ΔCts were taken into account.
Microarray experiments
For the comparison of the different ligation methods the
outliers and obvious artefacts were removed manually.
Density values (Dens) of the spots were used for the
further analysis. A two tailed t-test was used to evaluate
differences between the two methods for two separate
experiments.
In case of the examination of specificity of the 20
probes the outliers and obvious artefacts were also
removed manually. The samples were scored positive or
negative on the basis of visual inspection of the array
scans.
In case of the transfer project the outliers were filtered
on the basis of the relative SD of the spot signals, the
percentage at ceiling and the interquartile range (IQR).
Outliers were defined as values above: Q3+3(IQR) or
below: Q1-3(IQR). Further data analyses were done
according to Prins et al. [8]. Raw data for the microarray
experiments are available as additional files 1 and 2 as
Comparison protocols.csv and Transfer.csv.
Results
Ligation comparison: real-time PCR analysis
Five different published ligation detection protocols
were tested on three DNA mixes with different GM
targets, 0% GTS 40-3-2 DNA was used as a negative
control in all experiments. The methods were the pad-
lock probe ligation in combination with microarray
detection (PPLMD I) [8], another padlock probe
approach also combined with microarray detection
(PPLMD II) [10], the protocol used in the dual tag
microarray method (DTM) [17], a ligation-dependent
probe amplification (LPA) protocol [12] and the
SNPlex approach as described by Chaouachi et al. [15].
The PLPs that were used were specific for the maize
endogenous hmg gene, the maize GM elements cry1Ab
and bar and the maize GM event TC1507. TC1507
maize was used as a source for the TC1507 event tar-
get and Bt176 maize as a source for the bar and
cry1Ab element targets. Subsequent PCR amplification
and identification were the same for all comparisons
just as the four padlock ligation probes used in all pro-
tocols, in order to only investigate the influence of the
specific detection part of the different protocols.
Instead of microarray identification of amplified pro-
ducts after the PCR, the system was adapted for real-
time detection. For this purpose, TaqMan probes
labelled with different fluorescent dyes were designed
specifically for the four different PLPs. The TaqMan
probes were designed on the so-called short arm,
between the unique target site 2 and cZIP regions for
the four PLPs. Except for the bar PLP, these PLPs
were not published before. Before using the newly
developed PLPs in the ligation comparison study, they
were tested for general performance based on pre-
viously published criteria [8]; their circularizing capa-
city was tested on single stranded synthetic targets as
well as genomic DNA using SYBR green PCR. In all
cases, the PLPs showed Ct values at least 4 cycles ear-
lier for their specific target than for the non-target
control. After this each PLP was examined in simplex
with microarray analysis to screen for possible cross-
Table 3 Sequences of TaqMan probes designed for PLPs
Name Reporter dye-5’ sequence 3’-quencher Amplicon size (nt)
maize (hmg)
bar
TC1507 event
cry1Ab
Cy5-TGCGGTGTCAGTGATCTCTGCCTTGTCCT-BHQ2
TR-TGCTCCGTGCGAAATATGACCGTGCTT-BHQ2
FAM-AAGTGCCGTCCTTTCGTTCTTGTGTTCCG-BHQ1
VIC-ACACGAGTGACGGTGCCGCTGCC-BHQ1
121
112
126
119
TR: Texas Red, BHQ: Black Hole Quencher.
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
Page 6 of 12

Page 7

hybridizations with other ZIP-codes on the array; none
were observed (data not shown).
In a first round of ligation comparisons, both the liga-
tion chemicals and reaction times were according to the
published methods. In this case, the SNPlex protocol
could not be evaluated as the precise buffer composi-
tions were not disclosed by the authors or the company
[29]. On top of that, at least at the time of the experi-
ments, the buffer was not sold separately, but only as
part of the rather expensive full SNPlex kit. For each of
the remaining four methods, a range of ligation tem-
peratures was tested. The range was different for all
methods and included eight distinct temperatures
including the published temperature and the Tm of the
PLPs. A summary of the implemented ligation compari-
sons is shown in Table 4. Subsequent PCR was per-
formed in duplicate. After evaluation of the results, the
comparison was repeated with three distinct tempera-
tures, one above and one below the optimal temperature
of the previous experiment. The optimal temperature
was confirmed in all cases. For the LPA protocol the
ligation procedure consisted of two distinct steps, hybri-
dization and ligation. Based on their paper, the hybridi-
zation step was the most critical, therefore the
temperature range was tested for the hybridization step
while all ligations were performed at the published tem-
perature of 54°C. Results are shown in Table 5. The
PPLMD I protocol performed statistically best for the
hmg detection, while both the PPLMD I and DTM pro-
tocols performed best for the cry1Ab and bar detection;
TC1507 detection was unsuccessful with all four
protocols.
In a second round of comparisons only the reaction
times were kept as in the published protocols. Buffers
and chemicals were all according to the PPLMD I pro-
tocol. For this series four ligation temperatures were
evaluated for the PPLMD II and DTM protocols. Three
hybridization temperatures and three ligation tempera-
tures were combined to yield four different combina-
tions for the LPA protocol. For the SNPlex protocol
three temperature ramp ranges were tested. PCRs were
again performed in duplicate and the whole experiment
was repeated to yield four observations per sample. Ana-
lysis was performed as for the first round of compari-
sons and the results are shown in Table 6. The LPA,
DTM and PPLMD II protocols performed better in this
comparison than in the first one. In this comparison the
PPLMD I protocol performed best for hmg in GM mix
1 and 2, while for mix 1 the SNPlex and for mix 2 the
PPLMD II protocol performed statistically the same as
the PPLMD I protocol. For the cry1Ab test the PPLMD
II protocol showed the best results. For bar detection,
no significant differences were found between methods,
and TC1507 detection was again unsuccessful.
Ligation comparison: microarray analysis
The PPLMD I and PPLMD II protocols were also com-
pared using microarray detection, as these two per-
formed overall best in the real-time comparison. For
microarray analysis, four observations were analysed per
sample, as on each array each cZIP probe was spotted
in quadruplicate. Eight such arrays were spotted on a
glass slide and in one experiment the three GM mixes
and the 0% GTS 40-3-2 control sample were tested for
both protocols on one slide. The whole experiment was
repeated with a second slide. Positive signals were
defined as signals with an observed mean fluorescence
significantly higher than that of the control sample.
Especially for bar detection high background values
were observed in the control sample (data not shown).
For TC1507, positive signals were observed in some
cases, contrary to the real-time detection. Like for real-
time analysis, no consistent significant difference
between the two protocols was observed. In fact, only
for the hmg detection significant differences were
observed in GM mix 2. In the first experiment the
PPLMD II protocol performed better while in the sec-
ond experiment the PPLMD I protocol performed bet-
ter. Results of the comparison of the two best methods
are shown in Figure 3.
Specificity of the PLPs
Further aim was to test the specificity of the PLPs using
one of the best ligation protocols (PPLMD I) in combi-
nation with microarray detection. A selection of 20
PLPs was chosen for this, including six more PLPs that
were not published before (Table 2). After checking the
general performance of the PLPs as described under the
Table 4 Differences among ligation methods used for the
ligation comparison
Ligation temperature (°C)
ChemicalsCycle program Tested range Published
DTM [17]
PPLMD II [10]
LPA [12]
PPLMD I [8]
DTM
PPLMD II
LPA
PPLMD I
46-65*
59.3-75*
H:51.7-65*; L:54
53-68*
50
72
H:60 / L:54
65
PPLMD I DTM
PPLMD II
LPA
50; 55.5; 59.3; 65
61; 65; 67.8; 72
H:60 / L:54
H:71 / L65
H:65 / L:59
H65 / L:65
Ramp 1: 60-51
Ramp 2: 74-65
Ramp 3: 70-61
50
72
H:60 / L:54
SNPlex [15]3% Ramp: 60-51
* Range with eight different temperatures. H: hybridisation, L: ligation
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
Page 7 of 12

Page 8

ligation comparison, they were tested further in multi-
plex reactions. For this purpose, two DNA mixes were
prepared with different targets. The GM mix contained
equal amounts of DNA of different GM reference mate-
rial, containing at least 90% GM material each. This mix
contained targets for four endogenous genes, seven GM
elements, one event and one for the internal control.
The cereal mix contained equal amounts of 100% oat,
barley and wheat DNA. Detailed information is shown
in Table 7. The PLPs were mixed together and were
tested on both mixes. In the GM mix all of the 13
targets (including the internal control) were detected
and the seven probes, for which no targets were present,
were negative as expected (Table 7). In case of the cer-
eal mix three out of four positive targets were detected
and the others were negative. So, except for the barley
probe, all of the tested PLPs showed a positive signal on
the array.
Detection level and transferability
A tenplex PLP system in maize was tested regarding the
detection level and the transferability of the method to a
Table 5 Results of the ligation comparison using different chemicals with different cycle conditions
ΔCt (SD)
Target GM mixesTarget % PPLMD I - 65°C
14.3 (0.4)a
13.8 (0.9)a
7.8 (1.6)
DTM - 63.6°C
8.1 (0.7)b
8.1 (0.3)b
ND
LPA - 62.4°C
6.9 (0.4)bc
6.4 (0.4)bc
ND
PPLMD II - 62.5°C
3.8 (3.8)c
3.3 (3.5)c
ND
p-value ANOVA
hmg
1
2
3
100
100
5
5.7E-05
2.6E-05
-
bar
1
2
3
0.1
2.5
2.5
ND-
3.9 (0.5)
3.5 (1.2)ab
4.5 (2.3)
4.8 (2.3)a
1.0 (0.4)
0.8 (0.6)b
ND > 0.01
2.3E-03 0.6 (0.5)b
cry1Ab
1
2
3
0.1
2.5
2.5
ND-
7.5 (0.0)a
6.9 (0.5)b
8.2 (0.1)a
8.3 (0.7)a
3.2 (1.0)b
3.4 (0.6)d
0.5 (0.2)c
0.6 (0.4)d
1.1E-10
6.3E-10
TC 15071
2
3
5
1
ND
ND
ND
-
2.5
SD: standard deviation of the ΔCt values
Values marked with different superscript characters indicate groups (for the same target-mix combination) that are significantly different according to Tukeys
HSD test (P < 0.05); xais different from yb, zabis not different from either.
ND: not detected or negative ΔCt.
The temperature shows the optimal temperature from which the data were analysed.
Table 6 Results of the ligation comparison using chemicals from PPLMD I protocol with different cycle conditions
ΔCt (SD)
Target GM mixesTarget %PPLMD I 65°C DTM 65°C LPA
H60-L 54°C
9.0 (1.4)c
9.3 (0.9)d
4.7 (2.2)
PPLMD II
65°C
12.0 (0.2)b
12.6 (0.7)ab
7.5 (1.1)
SNPlex Ramp 70-61°C p-value ANOVA
hmg
1
2
3
100
100
5
14.3 (0.4)a
13.8 (0.9)a
7.8 (1.6)
10.0 (0.7)c
10.5 (1.0)cd
5.2 (1.3)
12.6 (0.7)ab
12.0 (0.2)bc
7.1 (0.2)
1.2E-06
6.5E-06
> 0.01
bar
1
2
3
0.1
2.5
2.5
ND
3.9 (0.5)
3.5 (1.2)
2.5 (0.7)
2.5 (1.3)
4.5 (3.19)
3.4 (3.5)
4.0 (0.7)
3.3 (1.3)
3.2 (1.0)
3.9 (0.7)
> 0.01
> 0.01
cry1Ab
1
2
3
0.1
2.5
2.5
ND
7.5 (0.0)b
6.9 (0.6)b
5.2 (0.5)b
5.7 (0.5)b
4.4 (2.5)b
5.4 (2.4)b
11.4 (0.6)a
10.9 (0.3)a
7.5 (2.3)b
7.5 (2.1)b
1.2E-04
5.7E04
TC 15071
2
3
5
1
ND
ND
ND2.5
SD: standard deviation.
Values marked with different superscript characters indicate groups (for the same target-mix combination) that are significantly different according to Tukeys
HSD test (P < 0.05); xais different from yb, zabis not different from either.
ND: not detected or negative ΔCt.
The temperature shows the optimal temperature from which the data were analysed.
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
Page 8 of 12

Page 9

different laboratory. The transfer experiments were car-
ried out following the PPLMD I protocol. The NIB
served as transfer laboratory.
Three GM mixes were tested containing 0% (negative
control), 0.1% and 1% GM material. The 0.1% and 1%
GM mixes contained targets for six GM elements, two
plant-species, one GM event and one internal control.
The same ten PLPs were mixed together and tested on
the three GM mixes, see the details in Table 8.
MON810, 0% was used as a negative control. Samples
were coded randomly prior to sending. The results were
re-encoded by the transfer lab prior to sending in the
raw data. After data analysis and exchange the codes
were broken. In the test laboratory results showed posi-
tive signals in each case for the 1% and 0.1% GM mate-
rial apart from the TC1507 event. In case of the 0% GM
0
5000
10000
15000
20000
25000
exp1
mix 1: 0.1% mix 2: 2.5% mix 3: 2.5%
exp2exp1exp2exp1exp2
0
5000
10000
15000
20000
25000
30000
exp1
mix 1: 0.1% mix 2: 2.5% mix 3: 2.5%
exp2exp1exp2exp1 exp2
0
5000
10000
15000
20000
25000
30000
35000
exp1
mix 1: 100% mix 2: 100% mix 3: 5%
exp2exp1 exp2exp1 exp2
0
500
1000
1500
2000
2500
3000
3500
exp1
mix 1: 5% mix 2: 1% mix 3: 2.5%
exp2 exp1exp2exp1exp2
** *
AB
C
D
Figure 3 Results of the comparison of the two best methods
on microarray. The mean value and standard error of four
individual spots on a microarray are expressed in arbitrary
fluorescence units on the y-axis. On the x-axis the number of the
experiment, the number of the DNA mix and the weight
percentage of the genomic DNA is given for A: bar, B: cry1Ab, C:
hmg and D: TC1507 detection. * indicates a p-value of < 0.05 and **
a p-value of < 0.01 in a two-tailed student’s t-test between the
PPLMD II protocol in white bars and the PPLMD I protocol in grey
bars.
Table 7 Results of 20 probes tested in two mixes
GM mixCereal mix
TargetTypeExpected resultsActual resultsExpected ResultsActual results
GTS 40-3-2
MON810 event
Bt 176
p35SCaMV
cry1F
pat
bar
cp4-epsps
p35SFMV
barstar
Bt11
maize (zein)
soy
cotton
rice
canola
wheat
oat
barley
spikelock
GM event
GM event
GM event
GM element
GM element
GM element
GM element
GM element
GM element
GM element
GM construct
species
species
species
species
species
species
species
species
control
-
+
-
+
+
+
+
+
+
+
-
+
-
+
+
+
-
-
-
+
-
+
-
+
+
+
+
+
+
+
-
+
-
+
+
+
-
-
-
+
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
+
+
+
+
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
+
+
-
+
Table 8 Results of the tenplex system tested on different
GM mixes by RIKILT and by NIB
1% GM mix 0.1% GM mix 0% GM mix
Target TypeRIKILT NIBRIKILTNIB RIKILT NIB
maize (hmg) species
maize (zein)
p35SCaMV
pat
bar
cry1F
cry1Ab
cry3Bb
TC1507
spikelock
+
+
+
+
+
+
+
+
-
+
+
+
+
+
+
+
+
+
-
+
+
+
+
+
+
+
+
+
-
+
+
+
+
+
-
+
+
+
-
+
+
+
-
-
-
-
-
-
-
+
+
+
-
-
-
-
-
species
GM element
GM element
GM element
GM element
GM element
GM element
GM event
control
+/-
-
+
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
Page 9 of 12

Page 10

mix only the PLPs for endogenous targets showed posi-
tive signals, no false positive signals were observed
(Table 8).
GM related signals of the test laboratory (RIKILT) for
the 1% GM mixture are shown in Figure 4 as an exam-
ple. Out of the seven GM related targets, only TC1507
event did not show significant signal compared to the
control (MON810, 0%). In case of the two endogenous
genes (hmg, zein) similar results were observed on the
target and control slide as expected and the adequacy of
the ligation was proven with the internal control (data
not shown). Signals were normalised for the hmg target
signal.
The experiments were carried out by the transfer
laboratory (NIB) twice on separate days. During the
transfer of the method from four samples results were
obtained that could be analysed: two 0% samples, one
0.1% sample and one 1% sample, the other two samples
suffered from technical errors (Table 8). In case of the
0% samples, only the cry3Bb spot was scored as a false
positive once, the other spots showed the expected
results, namely the GM related spots were all negative
and the endogenous spots were positive. Of the 1% sam-
ple, one false negative signal was observed for TC1507,
all other spots were positive. For the 0.1% sample both
endogenous spots were positive as were five of the
seven GM spots, no significant signals were observed for
bar or TC1507.
Discussion
So far, various ligation protocols, very different from
each other, have been published for the purpose of spe-
cific multiplex DNA detection. In this study, perfor-
mance of a number of protocols was compared using
identical probes and samples. For all comparisons, a
real-time PCR strategy was used for signal detection.
After choosing the best protocol, the specificity, detec-
tion level and the transferability of the method were
tested using microarrays.
The ligation protocols were compared in two rounds
of experiments. In the first round, both chemicals and
reaction times were kept the same as the published
methods. In a second round, only the reaction times
were kept as in the published protocols while the che-
micals were all according to the PPLMD I protocol. In
both cases ligation temperature ranges were tested as
well. The best temperatures were chosen in each case
(Table 5, 6), which was always between 60 and 65°C. At
lower temperatures signals in non-target reactions
increased, in some cases to the same level as observed
for specific reactions. At higher temperatures increased
Ct values were observed, indicating less efficient ligation
reactions. At the chosen best temperature for each pro-
tocol significant differences were found among the dif-
ferent ligation techniques. The PPLMD I and PPLMD II
protocols performed overall best in the real-time com-
parison after two rounds of ligation comparisons. In
both rounds the LPA protocol resulted in atypical
amplification curves in most cases. A possible cause for
this could be that this method was designed to work
with two separate “bipartite” ligation probes contrary to
the PLP system which was used in this paper. The
PPLMD I, PPLMD II and SNPlex methods were most
similar to each other providing similar results whereas
with the LPA and DTM protocols, later Ct values were
observed in the PCR, indicating a less efficient prior
ligation reaction. The differences might be explained by
the fact that these two protocols have just a few long
cycles contrary to the others which consist of more
short cycles (Figure 2). Furthermore, these two protocols
were not designed or optimized for the low level detec-
tion demands in GMO detection but were originally
used for other types of DNA targets. Our results con-
firmed the importance of choosing the best ligation pro-
tocol for a certain ligation based system in order to
reach the appropriate specificity and detection level.
The two best protocols (PPLMD I and PPLMD II)
were also compared using microarray detection to con-
firm the results of the ligation comparison. Like for the
real-time PCR analysis no consistent significant differ-
ence was observed between the two protocols. The only
difference between the array and real-time detection was
the positive signals observed for TC1507 event in some
cases on array contrary to the results of the real-time
detection.
For further experiments the PPLMD I protocol was
chosen to test the specificity, sensitivity and the transfer-
ability of the method. A combination of 20 PLPs was
0
60
120
180
p-35S
CaMV
pat barcry1F cry1Ab cry3Bb TC1507
Figure 4 GM related microarray results of test laboratory for
the 1% GM mixture. The y-axis represents the mean pixel density,
normalized for hmg. On the x-axis the GM related targets are given.
Out of the seven GM related targets, only TC1507 event did not
show significant signal compared to the control slide. The results of
the control slide are shown in white bars and grey bars represent
the target slide.
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
Page 10 of 12

Page 11

selected to test the specificity in a complex matrix of
plant DNAs isolated from GM or non GM reference
materials. Our results showed that all but one probe
reacted specifically with their targets when present, and
the ones for which no target was present showed nega-
tive results. In total, 13 targets were detected in a single
multiplex reaction. According to the literature the
SNPlex assay [15] allows the simultaneous detection of
up to 48 DNA sequences (endogenous, element-, con-
struct- and event-specific targets), but in their article up
to sevenplex detection was actually shown. Different
other multiplex approaches have been described by sev-
eral authors, but none of the techniques have shown
higher multiplicity in GMO detection than the results
presented here.
Another very important factor in GMO detection is the
detection level and the transferability of the method. To
examine these parameters a tenplex PLP system was
tested in a test laboratory as well as in a transfer labora-
tory. During the comparison of protocols, the 0.1% sig-
nals for bar and Cry1Ab were scored negative due to the
background in the 0% GTS 40-3-2 reference material
that was used as negative control. It has been reported in
literature, as well as on certificates of certified reference
materials that 0% CRMs may contain a certain low level
of the GMO they are supposed to be negative for as well
as other GMOs [30,31]. Furthermore, it is not very prob-
able, given the shown specificity of PLPs in the present
and previous papers [8,9], that the signal in the 0% GTS
40-3-2 was due to cross-reaction. For these reasons, a dif-
ferent reference material was selected as negative control
in the transfer experiments, particularly 0% MON810.
During the experiments a detection level down to 0.1%
was reached for most of the GM targets while the endo-
genous genes (hmg, zein) were present at 100% level, as
the mix contained only maize material. Moreover, similar
results were achieved by the two laboratories indicating a
good transferability and robustness of the method. The
detection level that was reached is sufficiently lower than
the 0.9% labelling obligation which has been defined
according to the EU regulation [32] and is indeed com-
parable to the detection level that is now considered ade-
quate for single GMO detection methods. Especially in
the transfer study it was shown that a 0.1% level could be
reached for most genomic targets which would be in line
with the novel EU regulation 619/2011, which sets a
technical zero of 0.1% for low level presence of GMOs
pending authorisation in the EU while having been
approved elsewhere [33]. The detection level stated in
this paper reflects the lowest reproducibly detected level
in this study, as such it is not a fully validated limit of
detection (LOD) as required for methods for legal pur-
poses. Such a full validation is part of future experiments.
The weight percentage of a GMO reference material can
be translated to an estimation of GMO related copy
numbers. For instance, in TC1507, the 200 ng input of a
0.1% sample would contain approximately 18 copies,
assuming a heterozygous single insertion. Because of the
differing genetic composition of different parts of the
seeds of monocotyledons (e.g. maize endosperm, seed
coat and embryo), the value of the DNA ratio in the
reference material may be not the same as the value of
the certified powder mass fraction [34].
During the ligation comparison and also during the
transfer of the method problems were observed with
TC1507 event and bar detection. These two probes per-
formed well in initial simplex evaluation but showed
suboptimal results in a multiplex situation. Still they
were included throughout the study on purpose. This
indicates the necessity of fine-tuning the parameters for
optimal probe design. This aspect requires further atten-
tion in future experiments.
Conclusions
The outcome of this study demonstrated that some liga-
tion protocols are more effective than others, but at the
same time that different protocols can lead to similar
results. Secondly, the applied PLP system using the opti-
mal ligation protocol was able to identify more GMO
related DNA targets simultaneously than previously
published and had a detection level down to 0.1% for
six GMO element targets. The reproducibility of this
approach was also shown in a transfer laboratory.
Further experiments and validation are necessary for the
method in order to implement this elegant procedure in
the routine analysis of food and feed samples.
Additional material
Additional file 1: Comparison protocols.csv. raw data for the
microarray spots and the results of the statistical analysis of the
comparison of the different ligation protocols.
Additional file 2: Transfer.csv. raw data for the microarray spots and
the results of the statistical analysis the transfer of the PPLMD method.
Acknowledgements
This work was supported by: GMULTI, a Marie Curie Intra European
Fellowship within the 7thEuropean Community Framework Programme,
project nr. 221218; CO-EXTRA, integrated project GM and non-GM supply
chains: their CO-EXistence and TRAceability, contract number 007158 funded
by the European Commission under the 6thframework program priority 5;
Food Safety and Quality; TRACE, integrated project -TRAcing food
Commodities in Europe, project nr. FOOD-CT-2005-006942, funded by the 6th
Framework Programme of the European Union; the Dutch Ministry of
Economic Affairs, Agriculture and Innovation.
Author details
1CFRI - Central Food Research Institute, Herman Ottó út 15. H-1022,
Budapest, Hungary.2RIKILT - Institute of Food Safety (WUR), Akkermaalsbos 2,
6708 WB, Wageningen, the Netherlands.3Laboratory of Phytopathology
(WUR), Droevendaalsesteeg 1, 6708 PB, Wageningen, the Netherlands.4NIB -
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
Page 11 of 12

Page 12

Department of Biotechnology and Systems Biology, National Institute of
Biology, Večna pot 111, 1000 Ljubljana, Slovenia.
Authors’ contributions
GU performed the comparison of the protocols, coordinated the transfer
study, performed the transfer study at RIKILT and drafted the manuscript,
JPvD supervised all practical and statistical work, drafted and finalized the
manuscript, TWP performed sequence analysis, probe design and helped
drafting the manuscript, MMV performed the specificity testing and drafted
the manuscript, AMAVH assisted in experimental work and helped drafting
the manuscript, HGB assisted in experimental work and helped drafting the
manuscript, DM performed the transfer study at NIB and helped drafting the
manuscript, KG coordinated the transfer study at NIB, EJK coordinated the
study and drafted the manuscript. All authors read and approved the final
manuscript.
Received: 19 July 2011 Accepted: 19 January 2012
Published: 19 January 2012
References
1. James C: Global Status of Commercialized Biotech/GM Crops: 2010. ISAAA
Brief 2010, 42.
2. Holst-Jensen A: Testing for genetically modified organisms (GMOs): Past,
present and future perspectives. Biotechnol Adv 2009, 27:1071-1082.
3.Morisset D, Štebih D, Cankar K, žel J, Gruden K: Alternative DNA
amplification methods to PCR and their application in GMO detection: a
review. Eur Food Res Technol 2008, 227:1287-1297.
4. Landegren U, Kaiser R, Sanders J, Hood L: A ligase-mediated gene
detection technique. Science 1988, 241:1077-1080.
5.Nilsson M, Malmgren H, Samiotaki M, Kwiatkowski M, Chowdhary BP,
Landegren U: Padlock Probes: Circularizing oligonucleotides for localized
DNA detection. Science 1994, 265:2085-2089.
6.Hardenbol P, Banér J, Jain M, Nilsson M, Namsaraev EA, Karlin-Neumann GA,
Fakhrai-Rad H, Ronaghi M, Willis TD, Landegren U, Davis RW: Multiplexed
genotyping with sequence-tagged molecular inversion probes. Nat
Biotechnol 2003, 21:673-678.
7.Baner J, Isaksson A, Waldenstrom E, Jarvius J, Landegren U, Nilsson M:
Parallel gene analysis with allele-specific padlock probes and tag
microarrays. Nucl Acids Res 2003, 31:e103.
8.Prins TW, Van Dijk JP, Beenen HG, Hoef AMA, Voorhuijzen MM, Schoen CD,
Aarts HMJ, Kok EJ: Optimised padlock probe ligation and microarray
detection of multiple (non-authorised) GMOs in a single reaction. BMC
Genomics 2008, 9:584-596.
9.Prins TW, Van Dijk JP, Hoef AMA, Voorhuijzen MM, Broeders S, Trapmann S,
Seyfarth R, Pardigol A, Schoen CD, Aarts HMJ, Kok EJ: Towards a multiplex
cereal traceability tool using padlock probe ligation on genomic DNA.
Food Chem 2010, 118:966-973.
10.Edwards KJ, Reid AL, Coghill JA, Berry ST, Barker GLA: Multiplex single
nucleotide polymorphism (SNP)-based genotyping in allohexaploid
wheat using padlock probes. Plant Biotechnol J 2009, 7:375-390.
11.Moreano F, Ehlert A, Burch U, Engel KH: Ligation-dependent probe
amplification for the simultaneous event-specific detection and relative
quantification of DNA from two genetically modified organisms. Eur
Food Res Technol 2006, 222:479-485.
12. Ehlert A, Moreano F, Busch U, Engel KH: Development of a modular
system for detection of genetically modified organisms in food based
on ligation-dependent probe amplification. Eur Food Res Technol 2008,
227:805-812.
13. Ehlert A, Demmel A, Hupfer C, Busch U, Engel KH: Simultaneous detection
of DNA from 10 food allergens by ligation-dependent probe
amplification. Food Add Contam 2009, 26:409-418.
14.Holck AL, Dromtorp SM, Heir E: Quantitative, multiplex ligation-
dependent probe amplification for the determination of eight
genetically modified maize events. Eur Food Res Technol 2009,
230:185-194.
15. Chaouachi M, Chupeau G, Berard A, Mckhann H, Romaniuk M, Giancola S,
Laval V, Bertheau Y, Brunel D: A high-throughput multiplex method
adapted for GMO detection. J Agric Food Chem 2008, 56:11596-11606.
16.Peano C, Bordoni R, Gulli M, Mezzalani A, Samson MC, De Bellis G,
Marmiroli N: Multiplex polymerase chain reaction and ligation detection
reaction/universal array technology for the traceability of genetically
modified organisms in foods. Anal Biochem 2005, 346:90-100.
Ericsson O, Jarvius J, Schallmeiner E, Howell M, Nong RY, Reuter H, Hahn M,
Stenberg J, Nilsson M, Landegren U: A dual-tag microarray platform for
high-performance nucleic acid and protein analyses. Nucl Acids Res 2008,
36:e45.
Gaudron T, Peters C, Boland E, Steinmetz A, Moris G: Development of
quadruplex-real-time-PCR for screening food for genetically modified
organisms. Eur Food Res Technol 2009, 229:295-305.
Onishi M, Matsuoka T, Kodama T, Kashiwaba K, Futo S, Akiyama H,
Maitani T, Furui S, Oguchi T, Hino A: Development of a multiplex
polymerase chain reaction method for simultaneous detection of eight
events of genetically modified maize. J Agr Food Chem 2005,
53:9713-9721.
Heinde BR, Heir E, Holck A: Detection of eight GMO maize events by
qualitative, multiplex PCR and fluorescence capillary gel electrophoresis.
Eur Food Res Technol 2008, 227:527-535.
Xu J, Miao H, Wu H, Huang W, Tang R, Qiu M, Wen J, Zhu S, Li Y:
Screening genetically modified organisms using multiplex-PCR coupled
with oligonucleotide microarray. Biosens Bioelectron 2006, 22:71-77.
Xu J, Zhu S, Miao H, Huang W, Qiu M, Hunag Y, Fu X, Li Y: Event specific
detection of seven genetically modified soybean and maizes using
multiplex PCR coupled with oligonucleotide microarray. J Agr Food Chem
2007, 55:5575-5579.
Morisset D, Dobnik D, Hamels S, Zel J, Gruden K: NAIMA: target
amplification strategy allowing quantitative on-chip detection of GMOs.
Nucl Acids Res 2008, 36:e118.
GMDD database. [http://gmdd.shgmo.org/], accessed: 07-07-2011.
GM Crop Database. [http://www.cera-gmc.org/?action=gm_crop_database],
accessed: 07-07-2011.
Qiagen D: Neasy Plant Mini and DNeasy Plant Maxi Handbook 01/2004..
Zimmermann A, Lüthy J, Pauli U: Quantitative and qualitative evaluation
of nine different extraction methods for nucleic acids on soya bean
food samples. Z Lebensm Unters Forsch 1998, 207:81-90.
Sanchez JA, Pierce KE, Rice JE, Wangh LJ: Linear-After-The-Exponential
(LATE) PCR: An advanced method of asymmetric PCR and its uses in
quantitative real-time analysis. Proc Natl Acad Sci USA 2004,
101:1933-1938.
Applied Biosystem protocol: SNPlex genotyping system 48-plex user
guide.3:17-18[http://www3.appliedbiosystems.com/cms/groups/
mcb_support/documents/generaldocuments/cms_042019.pdf], accessed:
07-07-2011.
Dinon AZ, Prins TW, van Dijk JP, Arisi ACM, Scholtens IMJ, Kok EJ:
Development and validation of real-time PCR screening methods for
detection of cry1A.105 and cry2Ab2 genes in genetically modified
organisms. Anal Bioanal Chem 2011, 400(5):1433-1442.
Clapper G, Cantrill R: Certification report - The certification of
conventional and MON88017 corn certified reference materials AOCS
0406-A and AOCS 0406-D. Champaign, IL, USA; 2009 [https://secure.aocs.
org/crm/files/0406D-Report.pdf], accessed 25 May 2010.
Regulation (EC) No 1829/2003 of The European Parliament and of the
Council of 22 September on genetically modified food and feed. Official
J Eur Union 2003, L268:1-23.
Regulation (EC) No 96/2011 of 24 June 2011 laying down the methods
of sampling and analysis for the official control of feed as regards
presence of genetically modified material for which an authorisation
procedure is pending or the authorisation of which has expired. Official
J Eur Union 2011, L166:9-15.
Trapmann S: Application Note 4, use of certified reference materials for
the quantification of GMO in food and feed.[http://www.erm-crm.org/
ERM_products/application_notes/application_note_4/Documents/
application_note_4_english.pdf], accessed 10-10-2011.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
doi:10.1186/1472-6750-12-4
Cite this article as: Ujhelyi et al.: Comparison and transfer testing of
multiplex ligation detection methods for GM plants. BMC Biotechnology
2012 12:4.
Ujhelyi et al. BMC Biotechnology 2012, 12:4
http://www.biomedcentral.com/1472-6750/12/4
Page 12 of 12