Download full-text


Available from: Jeanne Serb, Sep 30, 2015
55 Reads
  • Source
    • "Portions of the cox1 and nad1 genes were amplified. Primers for cox1 were 5'–GTTCCACAAATCATAAGGATATTGG–3' and 5'–TACACCTCAGGGTGACCAAAAAACCA–3', adapted from Folmer et al.[39] and primers for nadh1 were 5'–TGGCAGAAAAGTGCATCAGATTTAAGC–3' and 5'–GCTATTAGTAGGTCGTATCG–3' [40,41]. The primer LoGlyR (5’–CCTGCTTGGAAGGCAAGTGTACT–3′) [42] served as an alternate reverse primer for nadh1. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Freshwater bivalves in the order Unionoida are considered to be one of the most endangered groups of animals in North America. In Texas, where over 60% of unionids are rare or very rare, 15 species have been recently added to the state's list of threatened species, and 11 are under consideration for federal listing. Due to insufficient survey efforts in the past decades, however, primary data on current distribution and habitat requirement for most of these rare species are lacking, thus challenging their protection and management. Taxonomic identification of endemic species based on shell morphology is challenging and complicates conservation efforts. In this paper we present historic and current distributional data for three rare Texas species, Fusconaia askewi, F. lananensis, and Pleurobema riddellii, collected during our 2003-2011 state-wide surveys and suggest appropriate conservation measures. In addition, we tested the genetic affinities of Fusconaia and similar species collected from eastern Texas and western Louisiana using cox1 and nad1 sequences. We found that F. askewi still inhabits four river basins in eastern and northeastern Texas and can be locally abundant, while P. riddellii was found only in one river basin. Pleurobema riddellii was well-separated from F. askewi and grouped with the P. sintoxia clade. The sequences for F. lananensis were very similar to those for F. askewi, with a maximum difference of just over 1% for nad1 and only 0.7% for cox1, similar to the variation between F. askewi alleles. Except for one low difference (1.55%) with the partial cox1 sequence for F. burkei, all other Fusconaia populations, including those from the Calcasieu drainage, differed by over 2.3% for both genes. Our study suggested that F. lananensis is not a valid species, and it is likely that only one Fusconaia species (F. askewi or its probable senior synonym F. chunii) is currently present in East Texas, thus simplifying conservation efforts. Distribution range of both these regional endemics (F. askewi and P. riddellii) has been reduced in the last 80 years.
    Aquatic Biosystems 06/2012; 8(1):12. DOI:10.1186/2046-9063-8-12
  • Source
    • "The ITS1 region and portions of the cox1, and nad1 genes were amplifi ed. Primers for cox1 were 5′-GTTCCACAAATCAT AAGGATATTGG-3′ and 5′-TACACCTCAGGGTGACC AAAAA ACCA-3′, adapted from Folmer et al. (1994); primers for nadh1 were 5′-TGGCAGAAAAGTGCATCAGATTTA AGC-3′ and 5′-GCTATTAGTAGGTCGTATCG-3′ (Buhay et al. 2002, Serb and Lydeard 2003); and primers for ITS1 were 5' "
    [Show abstract] [Hide abstract]
    ABSTRACT: The genus Fusconaia Simpson, 1900, as currently recognized, includes ~12 species in the tribe Pleurobemini. Two species are federally listed and several more are imperiled in part or all of their ranges; one species is probably extinct. However, classification at the species and genus level has been problematic, and it is unknown whether imperiled populations represent merely local ecophenotypic variations or endemic species. To provide additional evidence on the systematics of this group and to help establish conservation priorities, we sequenced two mitochondrial genes for all available species of Fusconaia as well as representatives of other genera of Pleurobemini and several outgroups. Both cox1 and nad1 provided well-resolved phytogenies. Some putative species show little molecular differentiation, supporting their synonymization. In particular, Fusconaia flava (Rafinesque, 1820), F. cerina (Conrad, 1838), and the easternmost populations previously assigned to F. askewi (Marsh, 1896) are not differentiated by our data. Although the majority of Fusconaia places in a well-supported clade that includes F. flava, the type species, others do not. “Fusconaia” barnesiana (Lea, 1838), the type of Pleuronaia Frierson, 1927, places with “Lexingtonia” dollabelloides (Lea, 1840) and “Pleurobema” gibberum (Lea, 1838). “Fusconaia” ebenus (Lea, 1831) and “F.” rotulata (Wright, 1899) form a distinct clade outside of Pleurobemini. “Fusconaia” succissa (Lea, 1852) is assigned to the pustulosa group of Quadrula (subgenus Rotundaria), along with Quincuncina infucata (Conrad, 1834). Conversely, the type species of Quincuncina, Quincuncina burkei Walker, 1922, is assigned to Fusconaia. Populations in the Ozark region assigned to F. flava and populations in the Suwannee River system assigned to Quincuncina infucata probably deserve species-level recognition.
    American Malacological Bulletin 02/2012; 30(Feb 2012):1-17. DOI:10.4003/006.030.0101 · 0.94 Impact Factor
  • Source
    • "The ITS1 region and portions of the cox1 and nad1 genes were amplifi ed. Primers for cox1 were 5′-GTTCCACAAATCATAAGGATATTGG-3′ and 5′-TAC ACCTCAGGGTGACCAAAAAACCA-3′, adapted from Folmer et al. (1994); primers for nadh1 were 5′-TGGCA GAAAAGTGCATCAGATTTAAGC-3′ and 5′-GCTATTAGTA GGTCGTATCG-3′ (Buhay et al. 2002, Serb and Lydeard 2003); and primers for ITS1 were 5'-AAAAAGCTTCCG TAGGTGAACCTGCG-3' and 5'-AGCTTGCTGCGTTCTT CATCG-3' (King et al. 1999). For members of the Quadrulini, the primer LoGlyR (5'-CCTGCTTGGAAGGCAAGTGT ACT-3') (Serb, Buhay et al. 2003) often worked better as a reverse primer for nadh1. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The unionid tribe Pleurobemini is diverse but poorly-understood phylogenetically. Current classification recognizes two highly diverse genera, Elliptio Rafinesque, 1819 and Pleurobema Rafinesque, 1820, besides the moderately diverse Fusconaia Simpson, 1900, and several genera with one to three species. However, classification at the species and genus level has been problematic. Molecular data and re-examination of shell morphology and anatomy indicate new groupings of these taxa. Several genera proposed by early workers such as Rafinesque and Swainson are available, but are poorly-characterized and are often overlooked. We analyzed two mitochondrial genes, cox1 and nad1, for 50 species assigned to Pleurobemini, including the type species of each genus and as many other species as possible. Although the majority of studied species in Elliptio, Pleurobema, and Fusconaia show close affinities to the respective type species, the affinities of others are problematic. Genera or subgenera such as Eurynia Rafinesque, 1819, Sintoxia Rafinesque, 1820, and Pleuronaia Frierson, 1927, generally regarded as subjective synonyms, apply to some clades. Other clades or unaffiliated species have no available name. Quincuncina burkei (Walker, 1922), the type of the genus Quincuncina Ortmann, 1922, is assigned to Fusconaia Simpson, 1900. Fusconaia apalachicola (Williams and Fradkin, 1999), F. ebenus (Lea, 1831), F. rotulata (Wright, 1899) (also listed as Obovaria rotulata), F. succissa (Lea, 1852), Cyclonaias tuberculatus (Rafinesque, 1820), Uniomerus Conrad, 1853, and the Quincuncina infucata (Conrad, 1834) complex are all excluded from Pleurobemini. The first three are placed in the new genus Reginaia Campbell and Lydeard; Uniomerus Conrad, 1853 is assigned to Quadrulini; and the remainder belong in the pustulosa Lea, 1831 group of Quadrulini (genus Rotundaria Rafinesque, 1820).
    American Malacological Bulletin 02/2012; 30(1):19-38. DOI:10.4003/006.030.0102 · 0.94 Impact Factor
Show more