Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools

Abstract

Ethnopharmacological relevance: Phyllanthus (Euphorbiaceae) species are well known for their hepatoprotective
activity and are used in several ethno-medicines in indigenous health care systems in India.
Aim of the study: To assess species admixtures in raw drug trade of Phyllanthus using morphological and
DNA barcoding tools.
Materials and methods: Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in
southern India. Species admixtures in the samples were assessed by identifying species using morphotaxonomic
keys. These identities were further validated by developing species specific DNA barcode
signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted
and amplified using the forward (psbAF – GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR –
CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India,
Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established
by constructing a neighbor-joining tree using MEGA V 4.0.
Results: Morphological analysis of market samples revealed six different species of Phyllanthus in the trade
samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant
species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different
species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus
maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were
further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH.
Conclusion: Our results show that market samples of Phyllanthus sold in southern India contain at least
six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH
region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve
species admixtures in the raw drug trade of Phyllanthus.