Article

Analyses of plant communities composition and small mammals components in town park Ilidža.

Veterinaria 58 (1-2), 111-120, Sarajevo 01/2009; 58:111-120.

ABSTRACT UDK 619:636/639 (05) ISSN 0372-6827 SARAJEVO 1-2/09 VETERINARIA - Vol. 58, broj 1-2, str. 1-155, SARAJEVO, 2009.
Page 2
Page 3
UDK 619:636/639 (05) ISSN 0372-6827SARAJEVOSarajevo, 2009. Vol. 58, br. 1-2, str. 1-155IZDAVAČI:Veterinarski fakultet Univerziteta u SarajevuUdruženje veterinara i veterinarskih tehničara BiHGLAVNI I ODGOVORNI UREDNIK: Muhidin HamamdžićZAMJENIK GLAVNOG I ODGOVORNOG UREDNIKA: Safet HadžovićIZVRŠNI UREDNIK: Mladen Hlubna REDAKCIJSKI KOLEGIJ: Alibegović-Zečić Fahira, Crnkić Ćazim, Čaklovica Faruk,Kadić Muhamed, Muminović Mehmed, Pašić Šemso, Saračević Lejla - svi Veterinarskifakultet, Sarajevo, Andrijanić Milan, Veterinarski zavod, Mostar, Bogućanin Hamid,Poljoprivredni fakultet, Sarajevo, Burgu Ibrahim, Veterinarski fakultet, Ankara, FerizbegovićJasmin, Veterinarska stanica, Tuzla, Hartung Joerg, Veterinarski fakultet, Hanover, JimenezMarcel, Veterinarski fakultet, Barcelona, Porodi Margherita, Veterinarski fakultet, Milano,Pumarola Marti, Veterinarski fakultet, Barcelona, Šarić Milenko, Veterinarski institut, BanjaLuka, Telalović Amir, Kantonalna veterinarska inspekcija, Bihać.UREĐIVAČKI SAVJET: Arnautović Ibrahim, Džuvić Abdulah, Hadžiomerović Zijah,Hadžović Safet, Hamamdžić Muhidin, Lokvančić Hamdo, Milanović Ante, Mutevelić Ahmed,Nevjestić Ante, Ožegović Ladislav – svi Veterinarski fakultet, Sarajevo, Likar Rade, Novi Grad,Omanović Hilmo, Cazin, Selak Vjekoslav, Poljoprivredni fakultet, Sarajevo.web-site: http://www.vfs.unsa.ba/veterinaria.htmle-mail: veterinaria@vfs.unsa.ba LEKTORI:Hrnjević Subhija, prof. bosanskog, hrvatskog i srpskog jezikaRenata Milardović, doktor medicine, lektor za engleski jezikŠTAMPA:«Štamparija FOJNICA» d.o.o. Fojnica
Page 4
Časopis "VETERINARIA" upisan je u Evidenciju javnih glasilaMinistarstva za obrazovanje, nauku, kulturu i sport Federacije Bosne i Hercegovine 9.februara 1996. godine pod rednim brojem: 553.Časopis Veterinaria (Sarajevo) je indeksiran u bazi podataka CAB Abstracts(CAB International)The journal Veterinaria (Sarajevo) is indexed in the CAB Abstracts database(CAB International) www.cabi-publishing.org/
Page 5
SADRŽAJ – ContentsSvezak 1-2 – Numbers 1-2NAUČNI RADOVI – Original Papers Avdić R., Pobrić Hazima, Bejdić Pamela, Hodžić A.Morfološke karakteristike mišića tibiotarzalne, tarzometatarzalne i falangealneregije noja (Struthio camelus)Morphological characteristics of tibiotarsal, tarsometatarsal and phalangeal muscles in ostrich (Struthio camelus) .................................................................................1Maksimović Zinka, Rifatbegović M.Antibakterijski efekti svježe i konzervirane matične mliječiAntibacterial effects of fresh and preserved royal jelly.....................................................11Ćutahija VelidaDistribucija arterijskih krvnih sudova kopita bosanskog brdskog konjaDistribution of hoof arterial blood vessels in Bosnian mountain horse.............................17Čavaljuga Semra, Šerić-Haračić Sabina, Fejzić N., Smajlović M.,Gorančić Edina"Case control" studija bolesti uzrokovanih hranom kod ljudi u regiji centralneBosne i Hercegovine tokom 2006. godineCase control study of food-borne illnesses in humans in central region of Bosnia and Herzegovina during 2006............................................................................................29Sinanović N., Zahirović A., Ćutuk R., Filipović Selma, Maksimović A.Prevalencija dislokacija sirišta muznih krava različitih dobnih kategorijaPrevalence of abomasal displacement in dairy cattle of different age categories..............39Rexhepi A., Scheinert P., Bërxholli K., Hamidi A., Sherifi K.Occurrence of infectious pancreatic necrosis virus (IPNV) in farmed rainbowtrout (Onchorhynchus mykiss) in KosovoPojava virusa zarazne nekroze gušterače (IPNV) kalifornijske pastrmke (Onchorhynchus mykiss) na Kosovu..................................................................................47Korjenić E., Džano A., Šuta N.Populacije riba rijeke PožarneFish populations of the Požarna River...............................................................................55Mitrašinović Maja, Suljević D.Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz rijekeKrupice i ŽeljezniceHematological status of chub fish Leuciscus cephalus (Linnaeus, 1758.) from Krupica and Željeznica rivers............................................................................................63
Page 6
DIVLJAČ – WildlifeKorjenić E., Džano A., Šuta N.Brojnost populacije divokoze - Rupicarpa rupicarpa (Linnaé) u planinskomkompleksu Dive GrabovicePopulation size of chamois - Rupicarpa rupicarpa (Linnaé) in Diva Grabovicamountain chain...................................................................................................................77Lukić-Bilela Lada, Mulaomerović J., Tulić Una, Habul A., Softić Almira,Katica V.Morfometrijski parametri kostiju glave i postkranijalnog skeleta špiljskogmedvjeda (Ursus spelaeus Rosenmüller & Heinroth, 1794) iz Lukine pećine iMegare u Bosni i HercegoviniMorphometric parameters of cranial and postcranial skeleton in cave bear (Ursus spelaeus Rosenmüller & Heinroth, 1794) from Lukina pećina cave and Megara in Bosnia and Herzegovina............................................................................83Lukić-Bilela Lada, Mulaomerović J., Tulić Una, Lačević Amela, SoftićAlmira, Katica V., Pojskić N.Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller & Heinroth,1794) u Bosni i Hercegovini: morfološko-anatomske odlike kostiju glavenađene u špilji na vrelu Mokranjske MiljackeNew locality of cave bear (Ursus spelaeus Rosenmüller & Heinroth, 1794) in Bosnia and Herzegovina: morpho-anatomical characteristics of cranial skeleton found in cave at vrelo Mokranjska Miljacka ....................................................................97Muzaferović Š., Aladžuz A.Analiza sastava biljne zajednice i komponente sitnih sisara gradskog parkaIlidžaAnalysis of plant communities composition and small mammals components in town park Ilidža...............................................................................................................111PREGLEDNI RADOVI - Review ArticlesBajrović T., Nurkić M., Zvizdić Š.TuberkulozaTuberculosis.....................................................................................................................121In memoriam -Prof. dr. Milka Milenković (1925- 2009) ..........................................137UPUTE SARADNICIMA - Instruction to Authors....................................................141
Page 7
Avdić R. i sar.: Morfološke karakteristike mišića tibiotarzalne, tarzometatarzalne i falangealne ... Veterinaria 58 (1-2),1-9, Sarajevo 2009.1 MORFOLOŠKE KARAKTERISTIKE MIŠIĆA TIBIOTARZALNE,TARZOMETATARZALNE I FALANGEALNE REGIJE NOJA (Struthiocamelus)MORPHOLOGICAL CHARACTERISTICS OF TIBIOTARSAL,TARSOMETATARSAL AND PHALANGEAL MUSCLES IN OSTRICH(Struthio camelus)Avdić R., Pobrić Hazima, Bejdić Pamela, Hodžić A.• Abstract - Ostrich (Struthio camelus) is the largest living bird not indiginious inour climate, but with a currently increasing trend of farm breeding in Bosnia andHerzegovina for the purposes of food and leather industry. Beside the standard laboratory methods for meat specification, it is alsonecessary to be familiar with morphological characteristics of the ostrich musculature, inorder to be able to specify the meat on the market, i.e. to determinate authenticity of themeat declaration.The research was conducted on three mature female African Black ostriches inthe age range between 3 to 7 years.By dissecting tibiotarsal, tarsometatarsal and phalangeal region, 15 muscles wereidentified with their basic morphometric and functional characteristics established.Key words: ostrich, musculature, topography, extensors, flexorsKratak sadržaj - Noj (Struthio camelus), najveća živuća ptica, koja niježivotinja našeg podneblja, sve više se uzgaja i u Bosni i Hercegovini u svrhu dobijanjaproizvoda prehrambene i kožarske industrije. Pored priznatih laboratorijskih metodakojima se vrši identifikacija vrsta mesa, neophodno je poznavanje određenih morfološkihkarakteristika muskulature, a u svrhu identifikacije mesa u prometu, tj. utvrđivanjaautentičnosti deklaracije. • Dr. sc. Avdić Rizah, DVM, vanredni profesor, rizaha@yahoo.com; dr. sc. PobrićHazima, DVM, redovni profesor, Bejdić Pamela, DVM, asistent; Hodžić Adnan, DVM, asistent,Katedra za anatomiju i histologiju sa embriologijom, Veterinarski fakultet, Univerzitet u SarajevuAvdić Rizah, DVM, PhD, Associate Professor, rizaha@yaho.com; Pobrić Hazima, DVM,PhD, Full Professor ; Bejdić Pamela, DVM, Assistant; Hodžić Adnan, DVM, Assistant, Departmentof Anatomy and Histology with Embriology, Veterinary Faculty, University of Sarajevo
Page 8
Avdić R. i sar.: Morfološke karakteristike mišića tibiotarzalne, tarzometatarzalne i falangealne ... 2Istraživanje je vršeno na tri spolno zrele ženke afričkog crnog noja, u dobi od 3do 7 godina. Disekcijom tibiotarzalne, tarzometatarzalne i falangealne regijeidentificirano je 15 mišića, kojima su određene osnovne morfometrijske i funkcionalnekarakteristike. Ključne riječi: noj, muskulatura, topografija, ekstenzori, fleksori Uvod Noj (Struthio camelus) je vrsta iz reda nojevki (Struthioniformes) ili "pticatrkačica", kako ih još nazivaju, koja danas obitava još samo u istočnim i južnimdijelovima afričkog kontinenta. Odnos čovjeka i noja datira od starog Egipta iMezopotamije do današnjih dana.To su najveće živuće ptice na Zemlji koje zbog svoje tjelesne mase (mužjaci od100-150 kg, a ženke od 90-100 kg), reducirane grudne muskulature i zakržljalih krila nemogu da lete. Karakterišu ih duge noge sa veoma specifičnom mišićno-skeletnommorfologijom, što im omogućava da u punom trku razviju brzinu i do 70 km/h.Zbog niskog sadržaja masti (0,48 - 4,5 g/100 g) i holesterola (58 mg/100 g)meso noja ima sve veći značaj u ishrani ljudi. Koža plavkaste boje, koja je po kvalitetunajsličnija koži krokodila, sve više se primjenjuje u kožarskoj industriji, dok perje oddavnina služi kao ukras.Kako je u Evropi velika potražnja za mesom i drugim proizvodima od nojeva,trend farmskog uzgoja i u Bosni i Hercegovini je u porastu, pogotovo na prostoruHercegovine.Imajući u vidu da noj nije životinja našeg podneblja, te da lica koja rade unadzoru nad prometom mesa mogu doći u situaciju da ne mogu sa sigurnošću utvrditivrstu mesa na osnovu morfoloških karakteristika, cilj rada je identificirati muskulaturutibiotarzalne, tarzometatarzalne i falangealne regije, te utvrditi morfometrijske vrijednostikoje bi omogućile sigurniji inspekcijski nadzor nad prometom nojevog mesa. Materijal i metode Istraživanje je vršeno u toku 2007. i 2008. godine na tri spolno zrele ženkeafričkog crnog noja, starosne dobi od 3 - 7 godina i tjelesne mase: 78 kg, 86 kg i 91 kg.Životinje smo dobili nakon ugibanja iz zoološkog vrta "Pionirska dolina" u Sarajevu.Nakon patoanatomskih pretraga, detaljna morfološka istraživanja su vršena ulaboratorijama Katedre za anatomiju Veterinarskog fakulteta u Sarajevu uz odgovarajućeveterinarsko-sanitarne mjere.Po izvršenoj egzenteraciji noge su odvajane u visini bočnog zgloba (articulatiocoxae), sa njih je skinuta koža, odstranjeno masno tkivo i mišićne fascije. Zatim smo
Page 9
Avdić R. i sar.: Morfološke karakteristike mišića tibiotarzalne, tarzometatarzalne i falangealne ... Veterinaria 58 (1-2),1-9, Sarajevo 2009.3pristupili disekciji i identifikaciji svih površnih i dubokih mišića tibiotarzalne itarzometatarzalne regije.Za svaki mišić pojedinačno utvrđen je njegov početak (origo), završetak(insertio), mišićna masa, dužina, širina i debljina. Dobijeni rezultati su sistematizirani na osnovu mišićne funkcije (ekstenzori ifleksori) tibiotarzalne i tarzometatarzalne regije. Rezultati Disekcijom tibiotarzalne, tarzometatarzalne i falangealne regije nogu nojaidentificirano je ukupno 15 mišića tamnocrvene boje. Deset od njih mišićnim dijelom ležiu tibiotarzalnoj regiji, dok se njihove tetive nastavljaju duž dorzalne i plantarne stranetarzometatarzalne i falangealne regije. Pozicija tetiva zavisi od mjesta inzercije, odnosnofunkcije mišića. U tarzometatarzalnoj i falangealnoj regiji, pored tetiva mišića tibiotarzusa,identificirali smo pet manjih mišića koji su po funkciji uglavnom ekstenzori prstiju. Naziv mišića, njihov početak (origo), završetak (insertio) kao i funkcijaprikazani su u tabeli 1 i 2, a oblik i pozicija mišića na fotografijama od 1 - 10. Slika 1. Mišići noge nojaFigure 1. Pelvic limb muscles inostrichSlika 2. Mišići sa lateralne strane tibiotarzalne regijeFigure 2. Lateral tibiotarsal region muscles 1. M. gastrocnemius (pars lateralis), 2. M. fibularislongus, 3. M. flexor perforatus digiti IV, 4. M. flexorperforans et perforatus digiti III, 5. M. flexor perforatusdigiti III, 6. M. flexor digitorum longus, 7. M. tibialis cranialis, 8. M. extensor digitorum longus
Page 10
Avdić R. i sar.: Morfološke karakteristike mišića tibiotarzalne, tarzometatarzalne i falangealne ... 4 Tabela 1. Mišići tibiotarzalne regijeTable 1. Tibiotarsal region musclesMusculusOrigoInsertioFunctioM. fibularis longusLateralna strana koljenogzgloba i proksimalni diofibuleProksimalno natarzometatarzusuEkstenzor ITzglobaM. tibialis cranialisLataralni kondil femura imedijalna strana tibiotarzusaDistalno i dorzalnona tarzometatarzusuFleksor IT zglobaM. flexor digitorumlongusProksimalno i kaudalno natibiotarzusuIV falanga 3. i Vfalanga 4. prstaFleksor prstiju iekstenzor ITzglobaM. flexor perforanset perforatus digitiIIIProksimalni dio tibiotarzusa itetiva M. FTE i M. FPD IIISrednji IP zglob3. prstaFleksor 3. prsta iekstenzor ITzglobaM. flexorperforatus digiti IIIKaudalno i proksimalno natibiotarzusu i iz kolat. lat.ligamenta koljenog zglobaI falanga iproksimalni IP zglob3. prstaFleksor prsta iekstenzor ITzglobaM. flexor hallucislongusDistalni dio femuraU tetivi M. FDLEkstenzor koljenogi IT zglobaM. extensordigitorum longusKranijalno i proksimalno natibiotarzusuII i III falanga iproksimalni IP zglob3. prsta, IV i Vfalanga i proksimalniIP zglob 4. prstaEkstenzor prstiju iIT zglobaM. flexorperforatus digiti IVIz tetive lateralne glave M.FPDIIII falanga, proksimalnii srednji IP zglob 4.prstaFleksor 4. prsta iekstenzor ITzglobaM. gastrocnemius-pars lateralisLateralni kondil femura-pars medialisMedijalna strana koljenogzgloba i tibiotarzus-pars intermediaKaudalna površina femura iaponeuroza M. ITLPlantarno i distalnona tarzometatarzus-parssupramedialis(tetivastastruktura)lat. meniskus koljenogzgloba i kaud. površinatibiotarzusapars intermedia mi.gastrocnemiiEkstenzor ITzgloba i flexorkoljenog zglobaM. popliteusLateralni kondil femuraKaudalna površinatibiotarzusaFleksor koljenogzgloba Mali mišići tarzometatarzalne regije (tab. 2) su vretenastog oblika sa izrazitodugim tetivama koje završavaju na III i IV prstu, a čija je funkcija ekstenzija i abdukcija.
Page 11
Avdić R. i sar.: Morfološke karakteristike mišića tibiotarzalne, tarzometatarzalne i falangealne ... Veterinaria 58 (1-2),1-9, Sarajevo 2009.5 Tabela 2. Mišići tarzometatarzalne regijeTable 2. Muscles of tarsometatarsal regionMusculusOrigoInsertioFunctioM. extensor propriusdigiti IIIFascija IT zglobaIV falanga 3.prstaEkstenzor prstaM. extensor brevis digiti IIIDorzalno i distalno natarzometatarzusuI falanga 3. prstaEkstenzor 3. prstaM. extensor brevis digiti IVDorzalno natarzometatarzusu iproksimalno doM. EBD IIII falanga 4. prstaEkstenzor 4. prstaM. abductor digiti IVPlantarno iproksimalno natarzometatarzusuI falanga 4. prstaAbduktor 4. prstaM. lumbricalisDistalno iz tetiveM. FDLMTP zglob 3. i 4.prstaPotpomaže funkciju M.FDLLegenda (tabela 1 i 2)IT - Articulus intertarsalis seu articulus tibiotarso-tarsometatarsalis, M. FTE - M. femorotibialisexternus, M. ITL - M. iliotibialis lateralis, EBD III - M. extensor brevis digiti III, M. FPD III - M.flexor perforatus digiti III, IP - Articulus interfalangealis digiti, MTP - Articulusmetatarsophalangealis, M. FDL - M. flexor digitorum longusLegend (Table 1, 2)IT - Intertarsal joint or tibiotarsal-tarsometatarsal joint, M. FTE - External femorotibial muscle, M.ITL - Lateral iliotibial muscle, EBD III - Short extensor muscle of third digit, M. FPD III -Perforatus flexor muscle of third digit, IP - Interphalangeal joint of digits, MTP -Metatarsophalangeal joint, M. FDL - Long digital flexor muscle U tibiotarzalnoj regiji sa njene kaudalne, lateralne i u površnom sloju kranijalnestrane nalaze se ekstenzori intertarzalnog zgloba i fleksori prsta. Od fleksoraintertarzalnog zgloba evidentna su dva mišića, m. tibialis cranialis i m. extensordigitorum longus koji je ujedno i jedini ekstenzor oba prsta u cijeloj ovoj regiji. Obamišića nalaze se na kranijalnoj strani tibiotarzusa, a pokriveni su m. fibularisomlongusom. Prosječna mišićna masa tibiotarzalne regije iznosi 4.295 g. Najmasivniji mišićove regije je m. gastrocnemisus (2.545 g) koji sa svoja tri dijela (pars lateralis, parsmedialis, pars intermedia) čini 59,25% mišićne mase ove regije. Njegov najduži dio je pars lateralis i iznosi 45,0 cm, dok je pars medialis uprosjeku kraći za 2 cm, ali je i najmasivniji dio m. gastrocnemiusa. Morfometrijskevrijednosti prikazane su u tabeli 3.
Page 12
Avdić R. i sar.: Morfološke karakteristike mišića tibiotarzalne, tarzometatarzalne i falangealne ... 6 Tabela 3. Prosječne morfometrijske vrijednosti mišića tibiotarzalne regijeTable 3. Average morphometry values of muscles in tibiotarsal regionMIŠIĆIMASA (g) DUŽINA(cm) ŠIRINA (cm) DEBLJINA (cm)M. fibularis longus75039,014,54,0M. tibialis cranialis22536,05,52,0M. flexor digitorumlongus11526,55,02,0M. flexor perforans etperforatus digiti III11530,0/13,06,0/3,51,3/0,8M. flexor perforatusdigiti III21530,57,01,2M. extensor digitorumlongus12033,04,52,3M. flexor perforatus digiti IV18526,0/19,56,5/5,01,7/1,2M. gastrocnemius•Pars lateralis•Pars medialis•Pars intermedia1000112542045,043,036,016,016,09,05,04,23,4M. popliteus250,8 Prema dobijenim rezultatima, ukupna mišićna masa svih ekstenzoraintertarzalnog zgloba iznosila je 3.925 g, što je 91,38% od ukupne mišićne mase overegije. S druge strane, mišićna masa fleksora ovog zgloba iznosila je svega 345 g,odnosno 8,03% od ukupne mišićne mase tibiotarzalne regije, dok 25 g (0,63%) pripadam. popliteusu koji je po funkciji jedini fleksor koljenog zgloba. Slika 3. Mišići sa medijalne strane tibiotarzalne regijeFigure 3. Medial tibiotarsal region muscles1. M. fibularis longus, 2. M. tibialis cranialis, 3. M. extensor digitorum longus, 4. M. gastrocnemius(pars medialis)
Page 13
Avdić R. i sar.: Morfološke karakteristike mišića tibiotarzalne, tarzometatarzalne i falangealne ... Veterinaria 58 (1-2),1-9, Sarajevo 2009.7 Slika 4. Mišići tarzometatarzalne regijeFigure 4. Muscles of tarsometatarsal region1. M. extensor digitorum longus (tendo)2. M. extensor proprius digiti IIISlika 5. M. gastrocnemiusFigure 5. Gastrocnemius muscle1. pars medialis, 2. pars intermedia, 3. parslateralisSlika 6. M. fibularis longusFigure 6. Long fibular muscleSlika 7. M. tibialis cranialisFigure 7. Cranial tibial muscleSlika 8. M. flexor perforans et perforatus digiti IIIFigure 8. Perforans et perforatus flexor muscle of third digit
Page 14
Avdić R. i sar.: Morfološke karakteristike mišića tibiotarzalne, tarzometatarzalne i falangealne ... 8 Slika 9. M. flexor perforatus digiti IVFigure 9. Perforatus flexor muscle of third digitSlika 10. M. extensor digitorum logusFigure 10. Long digital extensor muscle Diskusija Internacionalna klasifikacija i kategorizacija nojevog mesa svrstava muskulaturuzdjeličnog pojasa i stražnjih ekstremiteta u komercijalno i konzumno najcjenjeniji diomišićne mase kod ove vrste životinje (3). U opisu muskulature nogu noja Smith i sar. (4) navode da je najveći dio mišićnemase raspoređen u femoralnoj regiji, dok je najteži mišić stražnjeg ekstremiteta m.gastrocnemius, što se podudara i sa našim rezultatima. Međutim, ukupna mišićna masatibiotarzalne regije farmski uzgojenih nojeva, koje su istraživali Smith i sar. (4), iako nisudostigli spolnu zrelost, veća je za 1.326 g u odnosu na mišićnu masu ove iste regije kodspolno zrelih nojevki, uzgajanih u ZOO vrtu „Pionirska dolina“ koje smo mi istraživali. Prosječna masa m. gastrocnemiusa kao najvećeg mišića tibiotarzalne regije kodfarmski uzgojenih nojeva iznosi 3.075 g, a što je za 530 g više u odnosu na naše rezultete.Između drugih mišića ove regije nema značajnijih razlika. Prema istraživanju Zinovieva (5) m. plantaris, koji je signifikantno reduciran,počinje sa dvije tetivaste glave (lateralni meniskus koljenog zgloba i kaudalna površinatibiotarzusa), koje se distalno spajaju i završavaju u pars intermedia m. gastrocnemiusa.Međutim, Gangl i sar. (2) disekcijom 12 nojeva na ovom mjestu nalaze tetivastu strukturukoja inzerira na pars intermedia m. gastrocnemiusa, te shodno tome a, što se podudara isa našim nalazima, nazvaju ga m. gastrocnemius pars supramedialis. Za razliku odnavedenih autora Smith i sar. (4) u svojim istraživanjima ne navode prisustvo niti jedneod ovih struktura (m. plantaris i pars supramedialis m. gastrocnemiusa).
Page 15
Avdić R. i sar.: Morfološke karakteristike mišića tibiotarzalne, tarzometatarzalne i falangealne ... Veterinaria 58 (1-2),1-9, Sarajevo 2009.9 Zaključci Na osnovu navedenih istraživanja, pored fundamentalnih implikacija zarazumijevanje odnosa strukture i funkcije mišićnog sistema, ovi rezultati imaju praktičanznačaj, posebno u području razumijevanja bipedalnog kretanja i identifikacije vrste mesa.Na osnovu izrazito crvene boje muskulature, meso noja se može klasificirati kao¨crveno meso¨, te se lahko može zamijeniti sa mesom goveda. Međutim, trodjelni m.gastrocnemius kod noja otklanja nedomumicu u slučaju makroskopske identifikacije ieventualne zamjene sa istim mišićem goveda. Mišići su izduženi, uski, sa dugim tetivastim završecima, izuzev m.gastrocnemiusa i m. fibularis longusa. Dužina mišića tibiotarzalne regije iznosi 0,8 cm(m. popliteus) do 45,0 cm (m. gastrocnemius). Izrazito razvijena mišićna masa ekstenzora(3.925 g) u odnosu na fleksore (345 g) intertarzalnog zgloba omogućuje dobro i sigurnobipedalno kretanje. LITERATURA 1. Baumel JJ, King AS, Breazile HEE, Vanden Berge JC. Handbook of AvianAnatomy Nomina Anatomica Avium. Cambridge: Massachusetts; 1993.2. Gangl D, Weinssengruber GE, Egerbacher M, i sar. Anatomical description ofthe musclesof the Pelvic Limb in the Ostrich (Struthio camelus). Anatomia,Histologia, Embryologia. 2004;33(2):100-114.3. Mellet FD. A note on the Musculature of the Proximal Part of the Pelvic Limbof the Ostrich (Struthio Comelus). Afr.Vet.Ans. 1994;65(1):5-9.4. Smith NC, Wilson AM, Jaspers KJ, Payne RC. Muscle architecture andfunctional anatomy of the pelvic limb of the ostrich (Struthio camelus). J.Anat.2006;209:765-779.5. ZinovievAV. Notes of the hind limb myology of the ostrich (Struthio Camelus).Ornitologia morpfology. 2006;33:53-62.Uredništvo primilo rukopis 09.03. 2009.
Page 16
Page 17
Maksimović Zinka i sar.: Antibakterijski efekti svježe i konzervirane matične mliječi Veterinaria 58 (1-2),11-16, Sarajevo 2009.11 ANTIBAKTERIJSKI EFEKTI SVJEŽE I KONZERVIRANE MATIČNEMLIJEČIANTIBACTERIAL EFFECTS OF FRESH AND PRESERVED ROYALJELLYMaksimović Zinka, Rifatbegović M.• Abstract - Antibacterial effects of the fresh royal jelly, royal jelly stored at 4 °Cand -40 °C for a period of 12 months against reference and isolated bacterial strains fromthe different clinical samples, were tested and compared by the diffusion test. Royal jellyshows antibacterial effects against both tested gram-positive and gram-negative bacteria.Fresh royal jelly has the most effective antibacterial activity. Storage temperature at -40ºC slightly affects antibacterial activity of royal jelly, while storage temperature at 4 ºCdecreases its antibacterial activity.Key words: royal jelly, antibacterial effects, storage temperature, storageduration Kratak sadržaj - Ispitani su i komparirani antibakterijski efekti svježe matičnemliječi, zatim matične mliječi čuvane na 4 °C i - 40 °C u periodu od 12 mjeseci, nareferentne bakterijske kulture, kao i na sojeve izolovane iz različitih kliničkih uzorakametodom difuzionog testa. Matična mliječ ispoljava antibakterijski efekt prematestiranim gram-pozitivnim, ali i gram-negativnim bakterijama. Svježa matična mliječispoljava najefikasnije antibakterijsko djelovanje. Čuvanje matične mliječi pritemperaturama od -40 ºC neznatno utiče na njen antibakterijski efekt, dok joj temperaturačuvanja na 4 ºC smanjuje efekt.Ključne riječi: matična mliječ, antibakterijski efekti, temperatura čuvanja,dužina čuvanja •Maksimović Zinka, DVM, asistent, zinka.maksimovic@vfs.unsa.ba; dr. sc. Rifatbegović Maid, DVM, docent, Katedra za mikrobiologiju s imunologijom, Veterinarski fakultet Univerzitetau SarajevuMaksimović Zinka, DVM, Assistant, zinka.maksimovic@vfs.unsa.ba; RifatbegovićMaid, DVM, PhD, Assistant Professor, Department of Microbiology and Immunology, VeterinaryFaculty, University of Sarajevo
Page 18
Maksimović Zinka i sar.: Antibakterijski efekti svježe i konzervirane matične mliječi 12 Uvod Matična mliječ je ekskret hipofaringealne žlijezde mladih pčela radilica (Apismellifera), koji nastaje nepotpunom razgradnjom polena i nektara. Služi za ishranumladih larvi i matice (4, 12, 13). Matica i larve se hrane direktno, kako se matična mliječi luči, odnosno, ne skladišti se, te zato ne predstavlja tradicionalni proizvod pčelarstva.Pretežno spektakularna plodnost i dug život matice, ekskluzivno hranjene matičnommliječi, naveli su ljude da vjeruju kako matična mliječ ima slične efekte i na čovjeka i dainiciraju njena brojna ispitivanja (13). Zbog njenog kompleksnog sastava matičnu mliječje nemoguće sintetizirati (8). Svi korisni efekti matične mliječi ne mogu se pripisati samojednoj komponenti. Značajno je da samo kombinacija elemenata zajedno ostvarujekorisne efekte. Mnoge studije dokazuju širok spektar korisnog djelovanja matičnemliječi, uključujući antibakterijsko, antifungalno i antiviralno djelovanje (4, 12).Antibakterijsko djelovanje matične mliječi poznato je godinama. Dokazana jeinhibitorna aktivnost matične mliječi prema pojedinim gram-pozitivnim i gram-negativnim bakterijama, a novije studije su dokazale antibiotsku aktivnost i premagljivicama (3, 6, 7, 10, 12, 13). In vitro studije su potvrdile da trans-10-hidroksidekanoična kiselina (10-HDA) matične mliječi ima antibiotsku aktivnost i smatrala seglavnim faktorom antibakterijskog efekta. Njena količina je parametar kvalitete matičnemliječi, uključujući svježinu (1, 12, 13). Nedavno otkriven antibakterijski protein matičnemliječi, utvrđen kao rojalizin, ima antibiotsku aktivnost prema gram pozitivnimbakterijama u niskim koncentracijama, ali ne i prema gram-negativnim bakterijama (5,7). Izolovana frakcija peptida pokazala je inhibitorne efekte prema Paenibacillus larvae,Bacillus subtilis i Sarcina lutea, što je prvi dokaz antibiotskog efekta rojalizina protivuzročnika određenih bolesti pčela. Ova peptidna frakcija također je ispoljila i antifugalniefekt prema Botrytis cinerea (2). Nedavna ispitivanja su dokazala da antibakterijskuaktivnost imaju i različiti drugi peptidi matične mliječi (6, 12). Sve veća rezistencija klinički značajnih bakterija i gljivica prema različitimantibioticima, uz odsustvo efektivnih i komercijalno dostupnih antibiotika, usmjerili supažnju ka pronalasku i ispitivanju novih antimikrobnih supstancija, s posebnom pažnjomna prirodne materijale, naročito matičnu mliječ koja pokazuje najveći potencijal zaizolaciju djelotvornih antibiotskih supstancija. Cilj ovog istraživanja je ispitati i komparirati antibakterijske efekte svježematične mliječi, zatim matične mliječi čuvane pri temperaturi od 4 °C u periodu od 12mjeseci, te čuvane pri - 40 °C, također u periodu od 12 mjeseci. Materijal i metode Za ispitivanje antibakterijskog efekta matične mliječi korištene su referentnebakterijske kulture: Escherichia coli (ATCC 8739), Pseudomonas aeruginosa (ATCC9027), Staphylococcus aureus (ATCC 6538P) i Salmonella typhymurium (ATCC 14028).
Page 19
Maksimović Zinka i sar.: Antibakterijski efekti svježe i konzervirane matične mliječi Veterinaria 58 (1-2),11-16, Sarajevo 2009.13Osim referentnih, korišteni su i vlastiti sojevi izolovani iz različitih kliničkihuzoraka: E. coli, Salmonella spp, Pseudomonas aeruginosa, Staphylococcus sp.(koagulaza negativan soj), Streptococcus canis (ß hemolitičan soj) i Arcanobacteriumpyogenes.Testirana matična mliječ je porijeklom s Igmana, Kanton Sarajevo. Zaistraživanje je korištena svježa matična mliječ, kao i matična mliječ prekrivena etanolom,u cilju prevencije moguće kontaminacije i promjene njenih komponenti. Prekrivanjeetanolom je tradicionalni način kratkoročnog čuvanja matične mliječi. Matična mliječ ječuvana pri temperaturi od 4 °C, u periodu od 12 mjeseci. Također je ispitana matičnamliječ čuvana pri - 40 °C, u istom vremenskom periodu.Korištene testne kulture su inokulirane na krvni agar, plavi agar i McConkey, apotom inkubirane aerobno, pri temperaturi od 37 °C, u periodu od 24 sata. Kolonije čistihkultura su suspendovane u 5 ml sterilnog fiziološkog rastvora (0,85%-tni NaCl) ihomogenizirane. Gustina bakterijskih suspenzija je podešena na 0.5 po McFarlandstandardu (ekvivalentno 1-5 x 106 CFU/ml) pomoću denzimetra. Za testiranje jepripremljeno razrjeđenje matične mliječi: 500 mg matične mliječi u 1 ml sterilnedestilovane vode. Po 1 ml pripremljenih suspenzija bakterijskih kultura je inokulirano naMueller Hinton agar (po dvije Petrijeve ploče za svaku bakterijsku kulturu). Višaksuspenzije je otklonjen i ploče su ostavljene u laminaru da se osuše. U inokuliranim iosušenim pločama su napravljena po tri otvora promjera 5 mm i u svaki je aplicirano po20 µl pripremljenih suspenzija matične mliječi. Ploče su inkubirane aerobno, pritemperaturi od 37 °C, a rezultati su očitavani nakon 24 sata. Prečnik zona inhibicije jemjeren kroz centar otvora i izražen u mm. Rezultati Matična mliječ je pokazala različite inhibitorne efekte na testirane bakterije,zavisno od soja, svježine, odnosno načina konzerivarnja matične mliječi (tab. 1).Najuočljiviji je inhibitorni efekat otopine svježe matične mliječi. Inhibiran je rast grampozitivnih, ali i gram negativnih bakterija. Neznatno su manje zone inhibicije rasta gramnegativnih bakterija u odnosu na zone inhibicije gram pozitivnih bakterija.Vrijednostiinhibitorne aktivnosti otopine svježe matične mliječi i matične mliječi čuvane godinudana na temperaturi -40 °C su približne. Uočljiv je pad inhibitorne aktivnosti matične mliječi čuvane godinu dana pritemperaturi od 4 °C, gdje je zona inhibicije izostala za referentne sojeve E. coli (ATCC8739) i Staphylococcus aureus (ATCC 6538P) (sl. 1), kao i za vlastite izolate: E. coli,Pseudomonas aeruginosa i Streptococcus canis (ß hemolitičan soj). Djelomičnainhibicija rasta je uočena za Pseudomonas aeruginosa (ATCC 9027), Salmonellatyphymurium (ATCC 14028), Salmonella spp. i Arcanobacterium pyogenes, dok je zonainhibicije rasta Staphylococcus sp. (koagulaza negativan soj) približna efektu svježematične mliječi i matične mliječi čuvane godinu dana pri temperaturi od -40 °C.
Page 20
Maksimović Zinka i sar.: Antibakterijski efekti svježe i konzervirane matične mliječi 14 Tabela 1. Inhibitorna aktivnost matične mliječi na bakterijske sojeveTable 1. Inhibitory activity of royal jelly against bacterial strainsKoncentracija matične mliječi 500 mg/ml (20 µl)konzervirana 12 mjesecisvježa matičnamliječ-40 oC4 oCTestirane bakterijske kultureinhibicija u mmE. coli (ATCC 8739)1090Pseudomonas aeruginosa (ATCC 9027)11,5106Staphylococcus aureus (ATCC 6538P)13,512,50Salmonella typhymurium (ATCC 14028)865E. coli990Salmonella spp.997Pseudomonas aeruginosa 10,59,50Staphylococcus sp. (koagulaza negativan soj)181816Streptococcus canis (ß hemolitičan soj)20,518,50Arcanobacterium pyogenes10105Slika 1. Inhibitorni efekt matične mliječi na Staphylococcus aureus (ATCC 6538P)Figure 1. Inhibitory effect of royal jelly against Staphylococcus aureus (ATCC 6538P)Legenda:− 4: Matična mliječ čuvana pri temperaturi od 4 °C u periodu od 12 mjeseci− -40: Matična mliječ čuvana pri temperaturi od –40 °C u periodu od 12 mjeseci− S: Svježa matična mliječLegend:− 4: Royal jelly stored at 4 °C for a period of 12 months− -40: Royal jelly stored at –40 °C for a period of 12 monthsS: Fresh royal jelly
Page 21
Maksimović Zinka i sar.: Antibakterijski efekti svježe i konzervirane matične mliječi Veterinaria 58 (1-2),11-16, Sarajevo 2009.15 Diskusija Istraživanje dokazuje antibakterijsku aktivnost matične mliječi prema testiranimgram pozitivnim i gram-negativnim bakterijama. Većina ispitanih sojeva su patogeni iliuslovno patogeni i vremenom su postali manje ili više rezistentni prema određenimantibioticima koji se koriste u terapiji. Rezultirajući efekt matične mliječi trebao bi seuzeti u obzir prilikom odabira i pripreme novih antibakterijskih preparata u terapiji.Dosadašnja istraživanja potvrđuju antibakterijski efekt matične mliječi, kaobakteriostatski ili bakteriocidni. Također djeluje fungicidno ili fungistatički (4, 5, 9, 10,11, 12, 13). Međutim, različita istraživanja pokazuju različite zone inhibicije za istetestirane bakterije. Ono što bi moglo uticati na rezultate su faktori vezani za matičnumliječ, kao što su porijeklo, vrijeme sakupljanja, svježina, odnosno način čuvanja, njenakoncentracija, odnosno količina i način pripreme razrjeđenja (4, 5, 9, 11, 12). Istraživanjapotvrđuju varijacije antibakterijske aktivnosti matične mliječi različitog porijekla.Zavisno od porijekla, uzorci matične mliječi pokazuju inhibitorni efekt na određenebakterije, odnosno efektivniji su od nekih antibiotika ili su bez efekta (9). Sezonalniuticaj na antibakterijski efekt matične mliječi se ogleda u maksimalnom inhibitornomučinku matične mliječi sredinom sezone produkcije matične mliječi, te nižom početkom ikrajem sezone (12). Svježa matična mliječ ima najveću antibakterijsku aktivnost. Premanekim istraživanjima, najizraženija antibakterijska aktivnost svježe matične mliječi jeunutar 24 sata poslije skupljanja i potom opada (11). Matična mliječ ima ograničenovrijeme čuvanja. Tokom vremena biološka aktivnost joj opada. Opadanje antibakterijskeaktivnosti zavisi od temperature čuvanja. Novijim istraživanjem je dokazano da seskladištenjem matične mliječi pri temperaturi od 4 °C njena antibakterijska aktivnostsmanjuje, a da duboko zaleđena pokazuje antibakterijsku aktivnost i nakon dužeg periodačuvanja (12). Antibiotska aktivnost 10-HDA se smanjuje neprikladnim i dugotrajnimčuvanjem. Ustanovljen je gubitak sadržaja 10-HDA pri temperaturama od - 18 °C i 4 °C,u periodu od 12 mjeseci (1, 12, 13). Stoga, najbolji uslov čuvanja matične mliječi, u ciljuočuvanja antibakterijske aktivnosti je pri temeperaturama zamrzavanja (11). Manjekoncetracije matične mliječi, odnosno manja količina pokazuju slabiju antibakterijskuaktivnost (4, 9). U ovom istraživanju pripremljena koncentracija i upotrebljena količinamatične mliječi su pokazali efektivnu inhibitornu aktivnost prema testiranim bakterijama. Zaključci ▪ Matična mliječ ispoljava antibakterijski efekat prema testiranim gram-pozitivnim, ali i gram-negativnim bakterijama.▪ Svježa matična mliječ ispoljava najefikasnije antibakterijsko djelovanje.▪ Čuvanje matične mliječi pri temperaturi od -40 ºC neznatno utiče, dok jojtemperatura čuvanja pri 4 ºC smanjuje antibakterijski efekat.
Page 22
Maksimović Zinka i sar.: Antibakterijski efekti svježe i konzervirane matične mliječi 16 LITERATURA 1. Antinelli J-F, Zeggane S, Davico R, i sar.: Evaluation of (E)-10-hydroxydec-2-enoic acid as a freshness parameter for royal jelly. Food Chemistry.2003;80(1):85-89. 2. Bíliková K, Gusui W, Simúth J: Isolation of a peptide fraction from honeybeeroyal jelly as a potential antifoulbrood factor. Apidologie. 2001; 32: 275-283.3. Boukraâ L, Niar A, Benbarek H, i sar.: Additive Action of Royal Jelly andHoney Against Staphylococcus aureus. Journal of Medicinal Food 2008;11(1):190-192. 4. Eshraghi S, Seifollahi F: Antibacterial Effects of Royal Jelly on DifferentStrains of Bacteria. Iranian J Publ Health. 2003;32(1):25-30.5. Eshraghi S: An Evaluation of the Potent Inhibitory Effects of Royal JellyFractions against Streptomyces bacteria. Pak J Med Sci. 2005; 21 (1): 63-68. 6. Fontana R, Mendes MA, de Souza BM, i sar.: Jelleines: a family ofantimicrobial peptides from the Royal Jelly of honeybees (Apis mellifera).Peptides. 2004;25:919-928. 7. Fujiwara S, Imai J, Fujiwara M, i sar.: A Potent Antibacterial Protein in RoyalJelly. Purification and determination of the primary structure of royalisin. TheJournal of Biological Chemistry. 1990;265(19):11333-11337. 8. Elkins MH R: Bee Pollen, Royal Jelly, Propolis and Honey. WoodlandPublishing 1996; str. 7-8. 9. Mercan N, Yüksekdag NZ, Yýlmaz M, i sar.: Examination on the anti-microbialactivity of royal jelly collected from different provinces. Mellifera. 2002;2-4:54-57. 10. Murray S, Blum SM, Novak FA, i sar.: 10-Hydroxy-2-Decenoic Acid, anAntibiotic Found in Royal Jelly. Science. 1959; 130 (3373): 452 – 453. 11. Ratanavalachai T, Wongchai V: Antibacterial Activity of Intact Royal Jelly, ItsLipid Extract and Its Defatted Extract. Thammasat Int. J. Sc. Tech. 2002; 7 (1). 12. Stocker A. Isolation and characterisation of substances from Royal Jelly(disertacija). Vollständiger Abdruck der von der Fakultät WissenschaftszentrumWeihenstephan für Ernährung,Landnutzung und Umwelt der TechnischenUniversität München und der Faculté des Sciences,Université d’Orléans zurErlangung des akademischen Grades eines; 2003. 13. - - -: Food and Agriculture Organization of the United Nations Rome. Value-Added Products From Beekeeping. Fao Agricultural Services Bulletin 1996; 124[citirano 10.10.2008.] Dostupno na http://www.fao.org/docrep/w0076E/w0076E00.htmUredništvo primilo rukopis 13.03.2009.
Page 23
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja Veterinaria 58 (1-2),17-28, Sarajevo 2009.17 DISTRIBUCIJA ARTERIJSKIH KRVNIH SUDOVA KOPITABOSANSKOG BRDSKOG KONJADISTRIBUTION OF HOOF ARTERIAL BLOOD VESSELS IN BOSNIANMOUNTAIN HORSEĆutahija Velida1 Abstract – Casting method was conducted by injecting the Vinilyth mass intothe digital blood vessels of 36 fore and hind limbs of the Bosnian Mountain Horse of bothgenders, aged from 5 to 7 years. Corrosive casts provided a precise estimation of positionand branching characteristics of the arterial blood vessels in the hoof of the BosnianMountain Horse. By comparison of our results with the previous literature findings wefound certain differences in branching of the digital arteries. So, we found differences inbranching of the rami dorsales phalangis I, a. tori digitalis and a. dorsalis phalangis II.Last observed difference, according to our research, was that we did not demonstrate theexistence of the a. dorsalis phalangis III. These findings may provide betterunderstanding of the diseases, prognoses and treatment of the horse hoof disorders.Undoubtedly, these findings may have a practical importance in equine orthopedics.Key words: artery, hoof, horseKratak sadržaj - Primjenom metode odljeva vinilitom su injicirane digitalnearterije i vene 36 prednjih i stražnjih nogu bosanskog brdskog konja oba spola, starosnedobi od 5 do 7 godina. Dobijeni korozioni odljevi su omogućili da preciziramo detalje opoložaju i grananju arterijskih krvnih sudova u kopitu bosanskog brdskog konja.Usporedbom naših nalaza sa literaturnim podacima utvrdili smo da postoje određenerazlike u grananju digitalnih arterija. Tako smo našli razlike u grananju rami dorsalesphalangis I, a. tori digitalis i a dorsalis phalangis II. Posljednja uočena razlika je da unašim istraživanjima nismo utvrdili postojanje a. dorsalis phalangis III. Nalazi dajuinformaciju za bolje razumijevanje oboljenja, prognoze i tretmana oboljelih stopala.Nesumnjivo, ovi nalazi mogu imati praktični značaj u ortopediji konja. 1Ćutahija Velida, DVM spec., saradnik, Katedra za anatomiju i histologiju s embriologijom, Veterinarski fakultet, Univerzitet u Sarajevu, e- mail: velida_vet@hotmail.comĆutahija Velida, DVM Spec., Research Assistant, Department of Anatomy and Histologywith Embriology, Veterinary Faculty, University of Sarajevo, e- mail: velida_vet@hotmail.com
Page 24
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja 18Ključne riječi: arterija, kopito, konj Uvod Prvenstvena potreba svih uzgajivača je da imaju zdravu životinju. Izmeđuostalog i kopito je izuzetno važna struktura životinjskog tijela. Iako životinje saproblemima kopita mogu biti u funkciji, šanse za optimalnu produktivnost i dostignuća ćebiti reducirana zavisno od veličine problema. Dobar program njege kopita vodi smanjenjutroškova u tretmanu nastalih poblema, stoga je znanje o lokomotornom sistemu konjanaročito važno.«No hoof, no horse» je slogan stoljećima, a mnogi od regulatornih mehanizamakoji kontrolišu rast i uticaj funkcije ove značajne strukture nisu razjašnjene. Kvalitetrožnog dijela ovisi o unutrašnjim i vanjskim faktorima. Unutrašnji faktori se tiču krvi idotoka nutritiva, dok se vanjski tiču okoline u kojoj se kopito nalazi. Stvaranje rožnogdijela ovisi o dobrom vaskularnom snabdijevanju. Vjeruje se da kopito ima povlaštenosnabdijevanje krvlju proliferativnih područja i područja koja nose težinu. To ukazuje daje vaskularni sistem kopita veoma važan u normalnim funkcijama i u patološkimprocesima kopita.Normalna vaskularizacija kopita može biti poremećena promjenom u protokukrvi kao posljedica povrede, ulcera, prsnuća rane, pukotina, frakture treće falange,laminitisa ili različitih vrsta intoksikacija. Poremećeni protok krvi može se očitovati uformi stenoze ili dilatacije krvnih sudova, ili pak u nekim slučajevima dođe do potpunognestanka krvnih sudova oko nastalih promjena (1, 2, 12, 13). Prema nekim autorima (3,10, 11) smanjenje u regionalnom krvnom protoku kroz dermalne lamele dovodi dolaminitisa, a vjeruje se da je povezan sa preusmjeravanjem krvi kroz arteriovenskeanastomoze. Veliki kalibar velikih vanjskih i unutrašnjih arterija kopita je opisan od višeautora (4, 5, 6, 7, 8, 9, 15, 21, 23, 25). Storch (24) je bio prvi koji je napravio korozioniodljev velikih vanjskih i unutrašnjih vena kopita. Anatomiju krvnih sudova unutar kopitasu opisali Kruger (15), Habermehl (8), Ghoshal i Getty (5), te Mishra i Leach (19). Na istraživanju mikrocirkulacije (skening elektro mikroskopija) pojedinihkorijuma kopita je radilo više autora ( 16, 17, 18, 20, 22). Ovi autori su, pored prikazaarterija i vena pojedinih korijuma, dokazali i postojanje arteriovenskih anastomoza. Konačno, poznavanje anatomije krvnih sudova unutar kopita je preduslov za bilo kojuvrstu hirurške operacije kopita.Prema iznesenom evidentno je da postoje određene, ne baš detaljne informacije ovaskularizaciji kopita. Mi smo odlučili da napravimo slična istraživanja na kopitubosanskog konja i rezultete naših istraživanja usporedimo sa raspoloživom literaturom.
Page 25
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja Veterinaria 58 (1-2),17-28, Sarajevo 2009.19 Materijal i metode rada Za istraživanje su upotrijebljena trideset šest klinički normalna kopita prednje istražnje noge odraslih konja oba spola. Osam kopita je korišteno za disekciju. Ostalih 28kopita je korišteno za pripremu korozionih odljeva. Za metodu odljeva smo koristilikorozionu tehniku, a tako dobijeni preparati vrlo često se nazivaju korozioni odljevi.Unutar 1 sata od smrti svake životinje, kopito je odstranjeno deartikulacijommetakarpofalangealnog (matatarzofalangealnog) zgloba. Sva kopita su tada procesuiranatako što je kanila ubacivana u jedan ili oba odgovarajuća krvna suda odmah distalno odputičnog zgloba. Prethodno pripremljen i obojen rastvor Vinilyte mase je tada injiciran.Arteria digitalis (palmaris-plantaris propria III) lat. i med. injicirane su crveno obojenimvinilitom u četiri kopita, vena digitalis (palmaris – plantaris propria III) lat. i med. plavoobojenim vinilitom u četiri kopita i u dvadeset kopita su istovremeno injicirane i arterija ivena. Poenta je postignuta kada dobijemo povratni pritisak i kada se nije moglo injicirativiše plastike. Kopita za disekciju su odvojena, a preostala su poslije injiciranja Vinilitmase čuvana pri sobnoj temperaturi 4-6 sati zbog polimerizacije. Kopita su tada uranjanau 36%-tnu solnu kiselinu da bi se rastopila sva meka tkiva i kosti. Proces rastapanja jetrajao između 20 i 30 dana. Nakon navedenog vremena odljevi su vađeni iz kiseline,ispirani i osušeni pri sobnoj temperaturi. Rezultati Kopito, ungula, predstavlja distalni modificirani završetak konjske noge. Centralnepotporne dijelove kopita čine distalni dio krunske kosti, kopitnica, žabična kost, kopitnahrskavica, ligamenti, fleksorne i ekstenzorne tetive i podotrohlearna burza (sl. 1/1-5). Nacentralne potporne organe kopita najprije naliježe potkožje koje je različito razvijeno.U području ruba, krune, žabice i mekuši subkutis je u formi jastučića (telasubcutanea ungulae) (sl. 1/9), koji daju kopitu tipičnu formu. Na parijetalnoj i solearnojpovršini kopitnice subcutis je tanak i predstavlja periost.Preko subkutisa naliježe corium. Korijum kopita je nešto modificiran u odnosu nakorijum prave kože a može se već prema različitim djelovima kopita podijeliti u 6segmenata, tj. korijum ruba (corium limbi), krune (corium coronae), zida (corium parietis),tabana (corium soleae), žabice ( corium cunei) i mekuši (corium tori) (sl. 1/6, 7, 8, 10, 2/1-3,3/1-3). Kopitni korijumi su bogato snabdjeveni arterijama većeg i manjeg kalibra, tearterijskom mrežom kapilara. Epidermis kopita prekriva korijume pa se i on kao i korijumidijeli u 6 odgovarajućih segmenata (epidermis limbi, e. coronae, e. parietis, e. soleae, e. cunei e. tori).Modificirani germinativni sloj epidermisa koji prekriva korijume stvara kopitnučahuru, capsula ungulae, na kojoj razlikujemo slijedeće dijelove: paries corneus (rožna
Page 26
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja 20ploča), solea cornea (rožina tabana); cuneus corneus (rožina žabice), torus corneus (rožinamekuši) (sl. 1/11-13, 4/1-3). Vaskularna mreža kopita prednje i stražnje noge je identična, stoga ćemoupotrebljavati samo termine vezane za prednju nogu. Slika 1. Podužni presjek kopita konja.1. Phalanx media, 2. Phalanx distalis, 3. Os sessamoideum ph. distalis, 4. Tetiva zajedničkogispruživača prsta, 5. Tetiva dubokog sagibača prsta, 6. Corium coronae, 7. Corium parietis, 8.Corium soleae, 9. Mekušni jastučić, 10. Corium tori, 11. Paries corneus, 12. Solea cornea, 13.Torus corneus, 14. Linea alba ungulaeFigure 1. Sagittal section of the hoof of horse.1.Second phalanx, 2. Third phalanx, Distal sesamoid bone, 4. Common digital extensortendon, 5. Deep digital flexor tendon, 6. Coronary corium, 7. Parietal corium, 8. Sole corium,9. Digital pad, 10. Bulbar corium, 11. Hoof wall, 12. Sole, 13, Bulb, 14. White lineSlika 2. Kopito sa odvojenom čahurom (dorzalni i postrani aspekt). Vinilitom injicirane arterije ivene. Figure 2. Hoof with separated horny capsule (dorsal and quarter view). Arteries and veins injectedwith Vinilyte.1. Corium limbi, 2. Corium coronae, 3. Corium parietis
Page 27
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja Veterinaria 58 (1-2),17-28, Sarajevo 2009.21Za arterijsku opskrbu kopita su odgovorne a. digitalis (palmaris propria III)lateralis i medialis (sl. 5/1, 2, 6/1, 7/1, 8/1). Ove arterije idu distalno sa palmarne stranestopala postrano od duboke sagibačke tetive prsta. U svom toku obje arterije duž putičnekosti daju nekoliko dorzalnih i palmarnih ogranaka (sl. 5/3). Digitalne arterije potom dolazeizmeđu tetive dubokog sagibača prsta i medijalne površine kopitne hrskavice gdje će datia.tori digitalis (sl. 5/4, 6/2, 7/2, 8/3), a oko 1 cm distalno a. coronalis (Sl. 6/5, 7/3, 8/2).Nadalje, digitalne arterije u visini krunske kosti daju a. dorsalis i palmaris phalangis mediae(Sl. 7/4, 5, 7). U daljem toku digitalne arterije, pored palmarnih izdanaka kopitnice, daju a.palmaris phalangis distalis. A. digitalis lateralis i medialis nastavljaju prema sulcus iforamen soleare kopitnice te se u canalis semilunarisu spajaju formirajući arcus terminalis(sl. 5/5, 7/8, 8/7). Slika3. Pokazuje korijume nasolearnoj površini kopita. Vinilitominjicirane arterije i vene. Figure 3. Shows dermis of the solesurface of the foot. Arteries andveins injected with Vinilyte.1. Corium soleae, 2. Corium cunei,3. Corium toriSlika 4. Polovica kopitne čahure.Figure 4. The half of the horncapsule.1. Paries corneus, 2. Solea cornea, 3. Cuneus corneus, 4. Stratum internum
Page 28
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja 22A. tori digitalis (sl. 5/4, 6/2, 7/2, 8/3) prva grana digitalne arterije odlazi palmarno idistalno i daje dva ogranka. Aksialni ogranak (sl. 6/3) ide distalno u mekušno jastuče sapripadajućim korijumom, žabično jastuče i njegov korijum, te dio solearnog korijuma(anguli soleae i pars inflexa lateralis i medialis). Distalni ogranak (sl. 6/4) se dijeli u dvamanja ogranka od kojih jedan nastavlja distalno i ulazi u korijum mekuša i stražnji diotabanskog korijuma. Drugi ogranak (sl. 6/4a) ide dorzalno prema krunskom korijumu gdje ćedati proksimalne i distalne ogranke za postrani dio rubnog, krunskog i parijetalnog korijuma.Ovaj ogranak anastomozira sa jednim od ogranaka koronalne arterije. Slika 5 Korozioni odljev arterija stopalabosanskog konja (dorzalni aspekt).1. A. digitalis lateralis, 2. A. digitalis medialis,3. Rami dorsales phalangis primae, 4. Grane a.tori digitalis za korijum žabice, 5. ArcusterminalisFigure 5. Corrosion cast of digital arteries ofthe foot of the Bosnian Horse (dorsal view)1. Lateral digital artery., 2. Medial digitalartery, 3. Dorsal ramus of the first phalanx, 4.Branches of bulbar artery for corium of thefrog, 5. Terminal arch A. coronalis je arterija (sl. 6/5, 7/3, 8/2) koja daje tri grane. Prva grana (sl. 6/5)odlazi nešto distalno i daje ogranke za postrani dio rubnog, krunskog i parijetalnog korijumai na kraju anastomozira sa granom torusne arterije (sl. 6/4a). Druga, relativno jača grana, idepalmarno i distalno i dublje u odnosu na prvi ogranak. Daje brojne ogranke u postranomdijelu parijetalnog i mekušnog korijuma. Neki od ovih ogranaka anastomoziraju sa a.marginis solearis (sl. 8/8). Treći ogranak a. coronalis (sl. 8/2a) ide dorzalno na rubni ikrunski korijum, tu se ramificira u proksimalne i distalne ogranke i na kraju anastomozira sagranama a. dorsalis phalangis mediae (sl. 7/4, 8/4).A. dorsalis phalangis mediae (sl. 7/4, 8/4) ide transverzalno preko tetivezajedničkog ispruživača prsta i anastomozira sa istom arterijom druge strane, te imapolukružan oblik. Ovu anastomozu možemo smatrati arterijskim koronalnim lukom (sl. 7/5).A. dorsalis phalangis mediae (sl. 7/4, 5) lateralno i medijalno prvo daje po jednu manju
Page 29
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja Veterinaria 58 (1-2),17-28, Sarajevo 2009.23arteriju koje također anastomoziraju i imaju polukružni oblik. Ova arterija se nalazi izmeđudugog ispruživača prsta i krunske kosti (sl. 7/6, 8/5) zajedno sa v. subcoronalis. Slika 6. Grananje digitalnearterije – palmarni aspekt.1. A. digitalis lateralis imedialis, 2. A. tori digitalis,3.Aksialna grana torusne arterije,4 Distalna grana torusnearterije, 4a. Ogranak zapostrani dio parijetalnog ikrunskog korijuma, 4b.Ogranak za korijum mekuša, 5.A. coronalisFigure 6. Branching of digitalartery – Palmar view.1. Lateral and medial digitalarteries., 2. Bulbar artery, 3.Axial branch of bulbar artery, 4Distal branch of bulbar artery,4a. Branch for quarter andcoronaly corium, 4b. Branchfor bulbar corium, 5. CoronalarterySlika 7. Korozioni odljev a. i v.digitalis lat. i med. (proksimopalmarni aspekt).1. A. digitalis lateralis imedialis, 2. A. tori digitalis 3. A.coronalis, 4. A. dorsalisphalangis mediae, 5. Arterijalnikoronalni luk, 6. A.subcoronalis, 7. A. palmarisphalangis mediae, 8. ArcusterminalisFigure 7. Corrosion cast of thea. and v. digitalis lat. and med.(proximo-palmar view).1. Lateral and medial digitalartery, 2. Bulbar artery, 3.Coronal artery, 4. Dorsal arteryof the second phalanx, 5.Arterial coronaly arch, 6.Subcoronal artery, 7. Palmarartery of the second phalanx, 8.Terminal arch
Page 30
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja 24Iz arterijskog koronalnog luka dorzalne arterije srednje falage izlaze brojniproksimalni i distalni ogranci. Proksimalni ogranci (sl. 8/4a) ulaze u pulvinus i coriumlimbi i kožu proksimalno od njega, dok distalni ogranci (sl. 8/4b) idu u pulvinus i coriumcoronae i distalno u proksimalnu trećinu parijetalnog korijuma. Ogranci koji se nalaze uproksimalnom dijelu parijetalnog korijuma anastomoziraju sa ograncima arterijadistalnog dijela parijetalnog korijuma. A. palmaris phalangis mediae (sl. 7/7) je znatno slabija grana digitalne arterije.Njih obje idu transverzano jedna prema drugoj i anastomoziraju. Svojim slabimograncima vaskularizira područje žabične kosti i podotrohlearnu burzu. Slika 8. Korozioni odljev arterija kopita.1. A. digitalis (palmaris propria III) lateralis i medialis, 2. A. coronalis, 2a. Grana koronalnearterije koja anastomozira sa arterijskim koronalnim lukom, 3. A.tori digitalis, 4. A. dorsalisphalangis mediae, 4a Proksimalne, 4b Distalne grane koronalnog luka, 5. A. subcoronalis, 6. A.palmaris phalangis distalis 6a Distalne i 6b Dorzalne grane, 7. Arcus terminalis, 7a Proksimalne i7b Distalne grane, 8. A. marginis solearisFigure 8. Corrosion cast of arteries of the hoof.1. Lateral and medial (palmar proper III) digital artery, 2. Coronal artery, 2a. Anastomosing branchof coronal artery with arterial coronaly arch, 3. Bulbar artery, 4. Dorsal artery of the secondphalanx, 4a Proximal, 4b Distal branches of coronary arch, 5. Subcoronal artery., 6. Palmar arteryof the third phalanx, 6a. Distal and 6b. Dorsal branches, 7. Terminal arch, 7a Proximal and 7bDistal branches, 8. Artery of the sole margin. A. palmaris phalangis distalis (sl. 8/6) je posljednja grana digitalne arterije prijenjenog ulaza u polumjesečasti kanal kopitnice. Arterija po svom izlasku iz digitalnearterije ulazi u postrani dio parijetalnog korijuma i dijeli se u dvije grane. Jedna grana (sl.8/6a) ide nešto palmarno i distalno, razgranjuje se u postranom dijelu parijetalnogkorijuma. Njeni ogranci anastomoziraju sa a. marginis solearis (sl. 8/8). Drugi, dorzalni,
Page 31
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja Veterinaria 58 (1-2),17-28, Sarajevo 2009.25(sl. 8/6b) ogranak a. palmaris phalangis distalis ide dorzalno u parijetalnom korijumu i tudaje veći broj proksimalnih ogranaka koji će anastomozirati sa distalnim ograncimaarterijskog koronalnog luka. Distalni ogranci dorzalne arterije nastale od a. palmarisphalangis distalis, su kraći i oni anastomoziraju sa a. marginis solearis i sa proksimalnimograncima izašlim iz terminalnog luka.Arcus terminalis (sl. 5/5, 7/8, 8/7) u polumjesečastom kanalu kopitnice daje 7–9ogranaka koji se potom dijele na proksimalne i distalne ogranke. Ovi završni ogranciterminalnog luka kroz otvore uz margo solearis kopitnice ulaze u dorzalni dioparijetalnog korijuma. Proksimalni ogranci (sl. 8/7a) idu proksimalno razgranjujući se ubogatu vaskularnu mrežu koja anastomozira sa vaskularnom mrežom proksimalnog dijelaparijetalnog korijuma, odnosno sa distalnim granama arterijalnog koronalnog luka.Distalni ogranci (sl. 8/7b) terminalnog luka idu distalno, također tvoreći bogatuvaskularnu mrežu i anastomoziraju sa a. marginis solearis.A. marginis solearis, (sl. 8/8) ustvari nastala anastomozama od više ogranakadigitalne arterije (grana koronalne arterije, grana a. palmaris phalangis III i granaterminalnog luka), u solearnom korijumu stvara bogatu vaskularnu mrežu, kojaanastomozira sa vaskularnom mrežom korijuma mekuši i žabice. Bogata arterijska opskrba korijuma ruba i krune potiče od grana a. tori digitalis, acoronalie i proksimalnih grana (arterijskog krunskog luka) a. dorsalis phalangis mediae. Vaskularizacija proksimalnog dijela parijetalnog korijuma potiče od distalnihgrana a. dorsalis phalangis mediae (arterijskog koronalnog luka), a coronalie, ogranakaa. tori digitalis i proksimalnih grana a. palmaris phalangis distalis. Distalni dioparijetalnog korijuma vaskulariziraju proksimalne grane nastale iz arcus terminalisa kojeanastomoziraju sa distalnim granama a. dorsalis phalangis mediae, nadalje grane a.coronalie i a. palmaris phalangis distalis.Stražnji dio tabanskog korijuma vaskulariziraju grane a. tori digitalis, a prednji ipostrani dio grane a. palmaris phalangis distalis, grane a. marginis solearis i distalniogranci terminalnog luka. Svi ovi krvni sudovi su povezani anastomozama. Korijumžabice i mekuša, kao i pulvinus digitalis, vaskulariziraju ogranci a. tori digitalis, a. corinaliei a. palmaris phalangis distalis. Diskusija Literaturni podaci o arterijskoj opskrbi kopita se znatno razlikuju. Tako Ghoshali Getty (5), Schummer (23) i Habermehl (8) navode da a. tori digitalis počinje naproksimalnom rubu cartilago ungulae što odgovara i našim nalazima, ali su autorikonstatovali da grane ove arterije ulaze samo u digitalni jastučić i korijum žabice i peta. Unašim istraživanjima smo konstatovali da a. tori digitalis daje i jednu granu za postrani diokoronalnog i parijetalnog korijuma, a koja anastomozira sa granom koronalne arterije (sl.6/4a).
Page 32
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja 26Ghoshal (7), Koch i Berg (14) a. tori digitalis nazivaju ramus tori digitalis.Smatramo da je ovo jak krvni sud i slažemo se sa Habermehlom (8) koji joj je dao ime a. toridigitalis.Schummer (23) i Habermehl (8) navode da se iz digitalne arterije nakon a. toridigitalis odvaja a. coronalis koja daje jednu granu prema dorzalnom dijelu krunskogkorijuma i dvije grane koje idu na postrani dio krunskog, parijetalnog i mekušnog korijuma.U našim nalazima smo utvrdili arteriju i njeno grananje, dok je Ghoshal (7) uopšte nenavodi (sl. 6/5, 7/3, 8/2).Prema nalazima Ghoshal i Getty (5), Ghoshal (7) a. dorsalis phalangis mediaeje jaka arterija koja anastomozira sa istoimenom arterijom druge strane i one formirajuarterijski koronalni luk, što se podudara sa našim istraživanjima. Schummer (23) iHabermehl (8) su našli da se a. dorsalis phalangis mediae grana na isti način, ali nepominju koronalni arterijalni luk. U našim istraživanjima smo uočili da se od obje a.dorsalis phalangis mediae odvaja po jedan slabiji ogranak. Ovi ogranci anastomoziraju teformiraju luk oko subkoronalne vene. Stoga sugerišemo da se ova arterija nazove a.subcoronalis. O ovoj arteriji nismo našli podatke u literaturi (sl. 7/6, 8/5).Položaj a. palmaris phalangis mediae u našim nalazima podudara se saliteraturnim podacima (5, 7, 8) (sl. 7/7).Schummer (23) i Habermehl (8) navode da iz digitalne arterije izlazi jako arterijskostablo (arterija kopitnog zida) koje se podijele na a. dorsalis phalangis distalis i a. palmarisphalangis distalis. Naši nalazi kod bosanskog konja potvrđuju postojanje jakogarterijskog stabla, ali samo a. palmaris phalangis distalis. A. dorsalis phalangis distalisnismo konstatovali. Isti autori opisuju a. marginis solearis što se slaže sa našim nalazima(sl. 8/8).Koch i Berg (14) opisuju ramus dorsalis phalangis I. Međutim kod bosanskogkonja ih nismo uočili kao takve. U našim nalazima duž proksimalne falange obje digitalnearterije daju veći broj ogranaka koji ne anastomoziraju u formi luka (sl. 5/3).Naglašavamo da je u kopitu veliki broj arterija te njihovih grana i ogranakapovezanih arterioarterijskim anastomozama. Zaključak Istraživanja su dala ilustrativan prikaz arterijske opskrbe kopita bosanskog brdskog konja. Kako je već spomenuto, važno je naglasiti postojanje arterioarterijskihanastomoza koje omogućavaju podvezivanje krvnih sudova pri hirurškim intervencijamana kopitu bez bojazni od ishemične nekroze. Svi navedeni nalazi ukazuju da postojeodređene razlike u vaskularizaciji kopita bosanskog konja u odnosu na navode uliteraturi. Dobijeni rezultati istraživanja imaju praktičnu vrijednost kako za primjenu uveterinarskoj ortopediji i hirurgiji, tako i u razumijevanju patogeneze i liječenja oboljenjakopita.
Page 33
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja Veterinaria 58 (1-2),17-28, Sarajevo 2009.27 LITERATURA 1. Ackerman N, Garner HE, Coffman JR, Clement JW. Angiographic appearance ofthe normal equine foot and alterations in chronic laminitis. J Am Vet Med Assoc.1975 Jan 1;166(1):58-62.2. Baxter GM. Alterations of endothelium-dependent digital vascular responses inhorses given low-dose endotoxin. Vet Surg. 1995; 24(2): 87-96. 3. Coffman JR, Garner HE. Acute laminitis. J Am Vet Med Assoc. 1972;161:1280-1283.4. De Vos NR. Vergelijkende Studie van de Arteries van het Voorste Lidmaat Bijde Huisdieren. Belgium State University, Veterinary School, Laboratory forAnimal Anatomy. 1964.5. Ghoshal NG, Getty T. The arterial blood supply to the appendages of the horse(equus caballus). Iowa State J. of Science. 1968; 43:153-181.6. Ghoshal NG, Koch T, Popesko P. The Venous Drainage of Domestic Animals.Philadelphia: W. B. Saunders Co; 1981.7. Ghoshal NG, Iz Sisson and Grossman: The Anatomy of the Domestic Animals.Fifth Edition, W.B. Saunders Company, Philadelphia, London, Toronto; 1975. str.494- 495.8. Habermehl KH: Iz Nickel, Schummer, Seiferle: Lehrbuch der Anatomie derHaustiere. Band III, Verlag Paul Pary, Berlin und Hamburg; 1976. str.581-599.9. Hertsch B. Zur Arteriographie der Zehe des Pferdes. Berliner und Muinchenertierarztliche Wochenschrift. 1973; 86: 461-480.10. Hood DM, Amoss MS, Hightower D, Mcdonald DR, Mcgrath JP, McmullanWC, Scrurchfield WL. Equine laminitis. I. Radioisotopic analysis of thehemodynamics of the foot during the acute disease. Journal of Equine Medicineand Surgery. 1978; 2: 439-444.11. Hood DM; Grosenbaugh DA; Slater MR. Vascular perfusion in horses with chroniclaminitis. Equine Vet J. 1994 May;26(3):191-6.12. Ingle-Fehr JE, Baxter GM. Evaluation of digital and laminar blood flow in horsesgiven a low dose of endotoxin. Am J Vet Res. 1998; 59(2):192-196.13. Ingle-Fehr JE, Baxter GM. The effect of oral isoxsuprine and pentoxifylline ondigital and laminar blood flow in healthy horses. Vet Surgery. 1999; 28(3):154-160. 14. Koch T, Berg R. Lehrbuch der Veterinär- Anatomiae.Band III, 5. Auflage, GustavFischer Verlag Jena – Stuttgart; 1992. str. 582-588.15. Kruger G. Uber die Blutgefassversorgung der Zehe und besonders desZehenendorgans des Pferdes. Gegenbaurs morphologisches Jahrbuch, 1934;74:639-669.16. Marais J, Masty J. Microcirculation of the coronary band of the equine hoof. ActaAnat (Basel). 1988;133(1):24-26.17. Marais J. Peripheral vascularization of the dermal laminae of the equine hoof. ActaAnat (Basel). 1989;134(1):79-81.
Page 34
Ćutahija Velida: Distribucija arterijskih krvnih sudova kopita bosanskog brdskog konja 2818. Mishra PC, Leach DH. Electron microscopic study of the veins of the dermallamellae of the equine hoof wall. Equine Vet J. 1983 Jan;15(1):14-21.19. Mishra PC, Leach DH. Extrinsic and intrinsic veins of the equine hoof wall. J Anat.1983 May;136(Pt 3):543-560.20. Nasu T, Yamanaka T, Nakai M, Ogawa H. Scanning electron microscopic study ofthe vascular supply of the equine hoof. J Vet Med Sci. 1998 Jul;60(7):855-858.21. Pohlmeyer L. Die arteriellen Versorgungsgefasse und deren intraossearerVerlauf in den Extremititenknochen beim Pferdefohlen. IV. Ossa digitorummanus. Deutsche tierarztliche Wochenschrift, 1979;86:113-119.22. Pollitt CC, Molyneux GS. A scanning electron microscopical study of the dermalmicrocirculation of the equine foot. Equine Vet J. 1990 Mar; 22(2):79-87.23. Schummer A. Blutgefasse und Zirkulationverhaltnisse in Zehenendorgan desPferdes. Gegenbaurs morphologisches Jahrbuch. 1951; 91:568-649.24. Storch C. Zur Anatomie der venosen Gefasse des Hufes. OsterreichischeMonatsschrift far Tierheilkunde. 1894. 18:19-22.25. Wintzer HJ, Schlarmann B. Zur arteriellen Blutversorgung des Strahlbeins undder Gleichbeine beim Pferd. Zentralblattffir Veterinarmedizin. Reihe. 1971; A18:642-652.Uredništvo primilo rukopis 30.03.2009.
Page 35
Čavaljuga Semra i sar.: "Case control" studija bolesti uzrokovanih hranom kod ljudi u regiji ... Veterinaria 58 (1-2),29-38, Sarajevo 2009.29 „CASE CONTROL“ STUDIJA BOLESTI UZROKOVANIH HRANOMKOD LJUDI U REGIJI CENTRALNE BOSNE I HERCEGOVINETOKOM 2006. GODINECASE CONTROL STUDY OF FOOD-BORNE ILLNESSES IN HUMANSIN CENTRAL REGION OF BOSNIA AND HERZEGOVINA DURING2006Čavaljuga Semra, Šerić-Haračić Sabina, Fejzić N., Smajlović M., Gorančić Edina2 Abstract - Integration and industrialization of food production chain andimplementation of the surveillance system “from a stable to the table” have decreasedfrequency of outbreaks of food-borne diseases and concurrently increased magnitude oftheir consequences (number of cases, severity of clinical symptoms, antimicrobialresistance, etc.). The lack of a uniform reporting system on food-borne illnesses inhumans, under-reporting and poor communication between veterinary and public healthsectors in Bosnia and Herzegovina (BiH), additionally impair the insight into the stateand size of the problems in this area. Certain progress in forming and strengthening of theinstitutional capacities as well as recent frequent occurrences of “food poisoning” havehad huge impact on reaffirmation of the needs for systematic epidemiological research inthe area of food safety. As a part of the feasibility study for the “Regional Center for Food, Agricultureand Veterinary Medicine”, financed by the EU RED (Regional Economic Development)Fund, we conducted the random survey of the population sample in Srednjobosanski andZeničko-dobojski Canton during 2006. In the overall sample of participants we hadidentified cases (families with recorded cases of food-borne illnesses in a previous year) 2Dr. sc. Čavaljuga Semra, MD, docent, Katedra za epidemiologiju i biostatistiku, Medicinski fakultet Univerziteta u Sarajevu, scavaljuga@gmail.com; mr. sc. Šerić-Haračić Sabina,DVM, viši asistent; dr. sc. Fejzić Nihad, DVM, vanredni profesor, Katedra za ekonomiku zdravljaživotinja; dr. sc. Smajlović Muhamed, DVM, docent, Katedra za higijenu i tehnologiju namirnica;Gorančić Edina, DVM, saradnik, Katedra za ekonomiku zdravlja životinja, Veterinarski fakultet,Univerzitet u Sarajevu.Čavaljuga Semra, MD, PhD, Assistant Professor, Department of Epidemiology andBiostatistics, Medical Faculty, University of Sarajevo, scavaljuga@gmail.com; Šerić-HaračićSabina, DVM, MSc, Senior Assistant; Fejzić Nihad, DVM, PhD, Associate Professor, Departmentof Animal Health Economics; Smajlović Muhamed, DVM, PhD, Assistant Professor, Departmentof Food Hygiene and Technology; Gorančić Edina, DVM, Associate, Department of Animal HealthEconomics, Veterinary Faculty, University of Sarajevo.
Page 36
Čavaljuga Semra i sar.: "Case control" studija bolesti uzrokovanih hranom kod ljudi u regiji ... 30and controls. Cases and controls were matched one on one according to the family size(number of adults and children), educational level of adults and category of the monthlyincome. Investigated outcome was recorded dichotomously and numerically as well asthe type and kind of the incriminated food source, and severity of clinical symptoms. Ourstudy shows that nowadays, food represents a much higher risk for human health despiteincreased attention given to the food safety by today’s consumers, producers and foodinspectors. Key words: case control, food-borne illnesses, central region of BiHKratak sadržaj - Integracija i industrijalizacija lanaca proizvodnje hrane uzimplementaciju sistema nadzora „od farme do stola“ je smanjila broj žarišta bolestiizazvanih hranom, a istovremeno povećala magnitudu njihovih posljedica (broj slučajeva,težina kliničkih simptoma, rezistentni uzročnici i sl.). Nepostojanje jedinstvenog sistemaizvještavanja o slučajevima trovanja hranom ljudi, prikrivanje slučajeva trovanja i lošakomunikacija veterinarskog i javnozdravstvenog sektora u Bosni i Hercegovini (BiH)dodatno otežavaju stjecanje uvida u stvarno stanje i veličinu problema u ovoj oblasti.Određeni pomaci u formiranju i jačanju institucionalnih kapaciteta, kao i nedavneučestalije pojave trovanja hranom, imali su značajan utjecaj na reafirmaciju potreba zasistemskim epidemiološkim istraživanjima u oblasti sigurnosti hrane. Kao dio studije izvodljivosti za uspostavljanje „Regionalnog centra za hranu,poljoprivredu i veterinarstvo“ finansirane od strane EU RED (Regional EconomicDevelopment) fonda, provedeno je nasumično ispitivanje uzorka stanovništva uSrednjobosanskom i Zeničko-dobojskom kantonu, tokom 2006. godine. Iz ukupne maseispitanika identificirani su slučajevi (porodice u kojima su zabilježeni slučajevi trovanjahranom godinu dana unazad) i kontrole. Slučajevi i kontrole su upareni po sistemu 1:1,prema broju članova porodice (odraslih i djece), stepenu obrazovanja odraslih i kategorijimjesečnih primanja. Ishod ispitivanja je ocijenjen dihotomno i brojčano, a ispitani sunačini nastanka oboljenja, težina kliničkih simptoma i vrste namirnica koje suidentificirane kao eventualni nosioci rizika. Istraživanja ukazuju da u današnjem vremenuhrana predstavlja mnogo veći rizik za zdravlje ljudi unatoč neusporedivo većoj pažnjikoju današnji potrošači, proizvođači i inspekcijski organi poklanjaju sigurnosti hrane.Ključne riječi: case control, bolesti izazvane hranom, centralna regija BiH Uvod Kvalitet se dugo smatrao glavnim faktorom prestiža u trgovini hranom, međutimnajnovija dešavanja vezana za kompromitiranu sigurnosti hrane lansirala su kvalitet kaouslov bez kojeg se ne može učestvovati na međunarodnom tržištu hrane. Potrošačima je
Page 37
Čavaljuga Semra i sar.: "Case control" studija bolesti uzrokovanih hranom kod ljudi u regiji ... Veterinaria 58 (1-2),29-38, Sarajevo 2009.31danas mnogo važnija sigurnost i kvalitet hrane zbog spoznaje da hrana značajnodoprinosi nastanku i širenju različitih rizika i oboljenja ljudi diljem svijeta (1). Ponuda sigurne, visoko kvalitetne hrane na međunarodnom tržištu je proces izahtijeva kontroliran pristup tokom cijelog prehrambenog lanca, kao i odgovarajućemehanizme certificiranja prema kupcu i zvaničnim regulatornim institucijama kojidokazuju da je primijenjena kontrola efikasna. Postoje dva različita područja upravljanja kvalitetom hrane u poljoprivrednojproizvodnji koja su ujedno veoma povezana. Prvo područje se odnosi na definiranjekvaliteta prema potrebama određenog tržišta kao što su preferencije u pogledu veličine,boje i organoleptičkih osobina. Drugo područje kontrole kvaliteta predstavlja kontrolusigurnosti prehrambenog proizvoda, što također može biti korišteno kao marketinški alatu zemljama sa visokim standardima sigurnosti hrane (6). Globalizacijom trgovine, lanac prehrane zahtijeva prilagodbu i promjenu mjerakontrole sigurnosti i kvaliteta hrane kroz znanstveno- istraživački rad na poljimaepidemiologije, higijene hrane i analize rizika (3). Suvremeni pristup zagovara prevencijukontaminacije tokom uzgoja sirovina, njihovog ubiranja i prerade. Internacionalnistandardi i trajno rastući zahtjevi razvijenih tržišta u pogledu kvaliteta proizvoda namećuvažnost pristupa upravljanju kvalitetom u zemljama u razvoju, ukoliko žele učestvovati umeđunarodnoj trgovini (7).Implementacija mehanizama za kontrolu sigurnosti hrane po principu „od farmedo stola“ ne samo da olakšava trgovinu, nego i doprinosi u velikoj mjeri prevencijiepidemija različitih bolesti. Integracija i industrijalizacija lanaca proizvodnje hrane uzimplementaciju sistema nadzora „od farme do stola“ je smanjila broj žarišta bolestiizazvanih hranom, a istovremeno povećala magnitudu njihovih posljedica. Nepostojanjejedinstvenog sistema izvještavanja o slučajevima trovanja hranom ljudi, prikrivanjeslučajeva trovanja i loša komunikacija veterinarskog i javnozdravstvenog sektora u BiHdodatno otežavaju stjecanje uvida u stvarno stanje i veličinu problema u ovoj oblasti.Određeni pomaci u formiranju i jačanju institucionalnih kapaciteta, kao i nedavneučestalije pojave trovanja hranom, imali su značajan utjecaj na reafirmaciju potreba zasistemskim epidemiološkim istraživanjima u oblasti sigurnosti hrane. Jedino znanstvenaosnova predstavlja racionalan i opravdan kriterij za uspostavljanje, priznavanje iliosporavanje nivoa kvaliteta i sigurnosti hrane.U ovom radu primijenjena je standardna znanstvena forma istraživačke studije:„case control“ studije s ciljem identificiranja i statističkog kvantificiranja najznačajnijihfaktora uticaja na pojavu i posljedice bolesti uzrokovanih hranom u regiji centralne BiHtokom 2006. godine. Materijal i metode Kao dio studije izvodljivosti za uspostavljanje „Regionalnog centra za hranu,poljoprivredu i veterinarstvo“, finansirane od strane EU RED (Regional Economic
Page 38
Čavaljuga Semra i sar.: "Case control" studija bolesti uzrokovanih hranom kod ljudi u regiji ... 32Development) fonda, provedeno je nasumično ispitivanje/anketiranje uzorka stanovništvau Srednjobosanskom i Zeničko-dobojskom kantonu tokom 2006. godine. Uzorakstanovništva u studiji izvodljivosti brojio je 800 domaćinstava sa ravnopravnim učešćemoba kantona. Na nivou svakog kantona broj domaćinstava iz svake od pripadajućihopćina određen je primjenom proporcionalnog grupnog sistema uzorkovanja. Naime,svaka općina u kantonima je participirala u ukupnom uzorku proporcionalno sa svojimdoprinosom u broju stanovnika na kantonu (tab. 1). Podaci o brojnosti stanovništva supotjecali iz posljednjeg popisa stanovništva u BiH iz 1991. godine. Tabela 1. Broj domaćinstava uzorkovanih po opštinama Zeničko-dobojskog i SrednjobosanskogkantonaTable 1. Number of households sampled from municipalities of Zeničko-dobojski andSrednjobosanski CantonKanton Opština Broj anketa Kanton Opština Broj anketaBreza20Bugojno55Doboj-jug21Busovača22Kakanj47D.Vakuf29Maglaj34Fojnica20Olovo14G.Vakuf30Tešanj40Jajce40Vareš19Kiseljak25Visoko38Kreševo8Zavidovići47N.Travnik36Zenica117Travnik85Zeničko-dobojskiŽepče20SrednjobosanskiVitez33 Anketa je provedena putem telefonskih intervjua koje su proveli 10 angažiranihanketara. Pripremljeno je uputstvo za popunjavanje ankete za anketare kako bi seosigurala jednoznačanost i homogenost prikupljenih podatka. (Primjerak ankete iuputstva za anketare nisu dio ovog rada, ali su dostupni u štampanoj ili elektronskojformi po upitu autorima.)Iz ukupne mase ispitanika identificirani su slučajevi (domaćinstva u kojima suzabilježeni slučajevi trovanja hranom godinu dana unazad) i kontrole. Ovo predstavljaformat „case control“ studije, koja je po definiciji retrospektivno istraživanje izloženostifaktorima rizika i kojom se utvrđuje povezanost faktora rizika i nastanka bolesti. Poredprimjene opisanog sistema nasumičnog uzorkovanja, u svrhu kontrole greške ipridruženih efekata, slučajevi i kontrole su upareni po sistemu 1:1, prema broju članovaporodice (odraslih i djece), stepenu obrazovanja odraslih i kategoriji mjesečnih primanja.U istraživanju smo analizirali 21 domaćinstvo u grupi slučajeva i isto toliko u grupikontrola.Ishod ispitivanja je ocijenjen dihotomno (pojava trovanja hranom udomaćinstvu) i brojčano (broj slučajeva trovanja hranom u domaćinstvu). Faktori rizikaidentificirani u ovom istraživanju, odnosili su se na prosječnu potrošnju: mlijeka i
Page 39
Čavaljuga Semra i sar.: "Case control" studija bolesti uzrokovanih hranom kod ljudi u regiji ... Veterinaria 58 (1-2),29-38, Sarajevo 2009.33proizvoda od mlijeka, mesa i proizvoda od mesa, jaja, voća i povrća, te da li su proizvodiiz uvoza ili domaće proizvodnje. Također je uzeto u obzir gdje je locirano anketiranodomaćinstvo (u ruralnim ili urbanim dijelovima općina), te koji su kriteriji bili presudniprilikom kupovine hrane.Biološka povezanost faktora rizika sa nastankom trovanja hranom udomaćinstvu ocijenjena je putem omjera vjerojatnosti. Jačina statističke asocijacijekvantificirana je upotrebom McNemar hi kvadrat test sa jednim stepenom odstupanja inivoom signifikantnosti od 5% (α=0,05). Analizirani podaci su uneseni u tabličnu bazu podataka kreiranu u Excelprogramu (Microsoft Office 2003), a isti program je korišten za većinu primijenjenihstatističkih analiza i grafičku prezentaciju rezultata. Rezultati U ovom istraživanju analizirano je 21 domaćinstvo sa jednim ili više slučajevatrovanja hranom u toku 2006. godine, kojima je pridruženo 21 domaćinstvo kod kojihslučajevi trovanja hranom nisu zabilježeni u istom periodu. U 19% (4/21) zabilježenihpojava bolesti izazvane hranom pogođeno je više članova iste porodice. Od uključenih 42domaćinstva 55% (23/42) bilo je iz ruralnih zajednica. Prosječan broj članova udomaćinstvu iznosio je 4, najviše 7, a najmanje 1. Najveći broj odraslih članovadomaćinstava imao je srednje obrazovanje. Bez stalno zaposlenih članova bilo je 19%domaćinstava i to su uglavnom bila umirovljenička domaćinstva. Najveći brojdomaćinstava imao je ukupna mjesečna primanja ispod 500 KM (41%), dok je 34%domaćinstava bilo u razredu ukupnih mjesečnih primanja između 500 i 1000 KM, a24,4% domaćinstava je privređivalo preko 1000 KM mjesečno (odgovor na ovo pitanjenije zabilježen za samo jedno domaćinstvo). Rezultati su prikazani u grafikonima 1 (uzrok trovanja), 2 (jačina simptoma), 3(vrsta hrane/namirnica koja je izazvala trovanje) i 4 (porijeklo hrane/namirnica koja jeizazvala trovanje). 49%8%8%35% kontaminirana hranahrana izvan roka trajanjaalergija na hranunepoznato Grafikon 1. Uzroci trovanja hranom i njihova zastupljenostGraph 1. Causes of food poisoning and their contribution to the total number of cases inpercentages
Page 40
Čavaljuga Semra i sar.: "Case control" studija bolesti uzrokovanih hranom kod ljudi u regiji ... 34 31%31%38% teški simptomi(hospitalizacija)relativno teški simptomilakši simptomi Grafikon 2. Težina simptoma trovanja hranom i njihova zastupljenostGraph 2. Severity of symptoms of food poisoning and their contribution to the total number ofcases in percentages 4%19%50%27% Mlijeko i proizvodiMeso i proizvodiNepoznatoOstale namirnice Grafikon 3. Vrsta hrane koja je uzrokovala trovanje i njena zastupljenostGraph 3. Type of food identified as a cause of food poisoning and its contribution to the totalnumber of cases in percentages 31%23%46% Domaći proizvodiUvozni proizvodiNepoznato porijeklo Grafikon 4. Porijeklo hrane koja je uzrokovala trovanje i njena zastupljenostGraph 4. Origin of food identified as a cause of food poisoning and its contribution to the totalnumber of cases in percentages Velika većina ispitanika primarnu odgovornost za sigurnost hrane dodjeljujevladinim agencijama. Značajan dio ispitanika također smatra odgovornim farmere iprerađivače, naročito u segmentu domaće proizvodnje.Rezultati ocjenjivanja biološke i statističke povezanosti definiranih faktorarizika i nastanka trovanja hranom u domaćinstvu (omjeri vjerovatnosti i rezultatistatističkog testiranja) dati su u tabeli 2.
Page 41
Čavaljuga Semra i sar.: "Case control" studija bolesti uzrokovanih hranom kod ljudi u regiji ... Veterinaria 58 (1-2),29-38, Sarajevo 2009.35 Tabela 2. Rezultati ocjenjivanja biološke i statističke povezanosti definiranih faktora rizika inastanka trovanja hranom u domaćinstvuTable 2. The results of the assessment of biological and statistical association of defined riskfactors and the occurrence of food poisoning in the household Neusaglašeni paroviFaktorOmjervjerovatnostiχ2b– faktorprisutan kodslučajevac– faktorprisutan kodkontrolaTumačenje> prosječne potrošnjemlijeka i pr./članu0,860,0867Bez povezanostiUvozno mlijeko i proizvodi20,321Blaga povezanostbez statističkesignifikantnosti> prosječne potrošnje mesai pr./članu63,661Jaka povezanost nagranici statističkesignifikantnostiUvozno meso i proizvodi52,751Jaka povezanost bezstatističkesignifikantnosti> prosječne potrošnjejaja/članu1,50,464Blaga povezanostbez statističkesignifikantnosti> prosječne potrošnje voća ipr./članu2163Blaga povezanostbez statističkesignifikantnostiUvozno voće i proizvodi1,670,553Blaga povezanostbez statističkesignifikantnosti> prosječne potrošnjepovrća i pr./članu43,682Jaka povezanost nagranici statističkesignifikantnostiUvozno povrće i proizvodi3,52,772Jaka povezanost bezstatističkesignifikantnostiRuralna porodica0,80,145Bez povezanostiSamoproizvodnja hrane1033Bez povezanostiZnačajno učešće samo-proizvedene hrane u ishrani0,670,223Bez povezanostiNezaposlenost odraslih0,50,312Bez povezanostiIzdvajanja za hranu < min.potrošačke korpe134,560Jaka povezanoststatističkisignifikantnaCijena prvi kriterij prikupovini3262Jaka povezanost bezstatističkesignifikantnostiKvalitet i sigurnost prvikriterij pri kupovini0,33113Bez povezanostiUvozni proizvod prvikriterij pri kupovini63,616Jaka povezanost nagranici statističkesignifikantnosti
Page 42
Čavaljuga Semra i sar.: "Case control" studija bolesti uzrokovanih hranom kod ljudi u regiji ... 36Omjeri vjerovatnosti manji od 1 su definirani kao znak izostanka direktnepovezanosti, omjeri vjerovatnosti manji i jednaki 2 su okarakterizirani kao blaga biološkapovezanost, a veći od 2 kao jaka povezanost. Statistička signifikantnost je određivanaprema zadatom nivou statističke signifikantnosti (χ2≥ χ2 za α=0,05). Diskusija Generalno mišljenje BiH građana je da na tržištu BiH postoji velika prisutnosthrane upitno deklariranog kvaliteta sa aspekta biološke vrijednosti, higijenske ispravnosti, sadržaja rezidua i ostalih kontaminanata. Dodatni izazov u primjeni važećih nacionalnih i internacionalnih standarda za sigurnost i kvalitet hrane u BiH je još uvijekprisutna propusnost granica za prehrambene proizvode i životinje, nepoznavanje i nepoštivanje važećih propisa, nepostojanje adekvatnih i akreditiranih laboratorija zakontrolu kvaliteta i sigurnosti hrane, zastarjelost važećih standarda i kvaliteta hrane,neefikasna inspekcijska kontrola i time kompromitirano funkcioniranje postojećegsistema kontrole kvaliteta hrane domaće proizvodnje i hrane iz uvoza. Značajan iskorak uovoj oblasti nastaje sa uspostavljanjenjem instiutucija na državnom nivou i to: Ureda za veterinarstvo BiH, Uprave za zaštitu zdravlja biljaka i Agencije za sigurnost hrane, kojesu u proteklom periodu započele reviziju niza pod zakonskih akata iz oblasti sigurnostihrane. Međutim, podaci o kontroli kvaliteta životnih namirnica za protekle godineukazuju na mali broj pregledanih uzoraka, pa se smatra da s se amo 3-5% namirnica ipredmeta opće upotrebe podvrgava adekvatnoj kontroli kvaliteta (10). Također, ostaje otvoreno pitanje prelaska na regulativu Evropske Unije (EU). Potreba prilagođavanju legislative i prakse u našoj zemlji internacionalnim zahtjevima upogledu standarda sigurnosti i kvaliteta hrane je neosporna. Uporište za to nije samoudovoljavanje propisanim uvjetima koji stoje između BiH i njenog prijema u evropske isvjetske integracije, nego i prihvatanje znanstveno osnovanih kriterija i metoda koje našazemlja nije u mogućnosti da razvije samostalno (2). Usvajanje internacionalnih standardaje takođe preduslov učešća u međunarodnoj trgovini (4). Standardi poput HACCP-a(Hazard Analysis and Critical Control Point- analiza hazarda i kontrola kritičnih točaka)će istovremeno omogućiti dotok podataka pomoću kojih je moguće povezati svaki gotovproizvod sa životinjom od koje su potekle sirovine (sistem nadzora „od farme do stola“),što je pak osnova efikasnog nacionalnog sistema zaštite javnog zdravstva. U segmentusigurnosti hrane ravnopravno uključivanje i harmonizacija rada veterinarske službe isistema javnog zdravstva nije samo potreba nego neminovnost. Rezultati našeg istraživanja mogu poslužiti kao smjernica za optimalnijeupravljanje problemom trovanja hranom, jer prema podacima Federalnog zavoda zajavno zdravstvo alimentarne intoksikacije zauzimaju značajno visoko mjesto na listivodećih zaraznih bolesti u FBiH (8). Naime, rezultati ukazuju da je trovanje najčešćeuzrokovano hranom iz uvoza, te da najveću prijetnju predstavljaju prehrambeni proizvodianimalnog/životinjskog porijekla. Poroznost granica kao i njihova otvorenost, zastarjelostpropisa i standarda, loša komunikacija graničnih prijelaza, inspekcije i nadležnih
Page 43
Čavaljuga Semra i sar.: "Case control" studija bolesti uzrokovanih hranom kod ljudi u regiji ... Veterinaria 58 (1-2),29-38, Sarajevo 2009.37institucija omogućavaju da se u našu zemlju uvozi hrana veoma lošeg i sumnjivogkvaliteta. Porijeklo uvezene hrane je uglavnom iz zemalja u regiji i okruženja, gdje su unekim od njih sistemi kontrole, nadzora, tehnologije proizvodnje hrane u lošijem stanjunego u BiH. Iz rezultata je također vidljivo da ukoliko cijena predstavlja prvi kriterijkupovine prehrambenih proizvoda u domaćinstvu, dolazi do značajnog povećanja rizikaod alimentarnih intoksikacija. Kako je većina ispitanih domaćinstva u najnižem razredumjesečnih primanja, za očekivati je da su ova domaćinstva opredijeljena na kupovinujeftinijih i često manje kvalitetnih prehrambenih proizvoda, te su na taj način u većemriziku od trovanja hranom. Zadatak nadležnih vladinih agencija je obezbijediti svimgrađanima pravo na sigurnu i kvalitetnu ishranu, što prema našim rezultatima očiglednonije standard koji trenutno vrijedi u BiH (9). Ovo, ali i mnoga druga istraživanja, ukazujuda u današnjem vremenu hrana predstavlja mnogo veći rizik za zdravlje ljudi, unatočneusporedivo većoj pažnji koju današnji potrošači, proizvođači i inspekcijski organipoklanjaju sigurnosti hrane (5). Zaključci Prije iznošenja direktnih zaključaka koji proističu iz našeg istraživanja,naglašavamo generalnu konstataciju potvrđenu mnogim istraživanjima, ali i medijskipopraćenim incidentima iz oblasti sigurnosti i kvaliteta hrane, a to je da hrana danaspredstavlja jedan od najznačajnijih rizika za zdravlje ljudi. Uz to, neprijavljivanjeslučajeva trovanja hranom kod ljudi predstavlja ozbiljan problem i teškoću za rješavanjeproblema. Rezultati naših istraživanja upućuju na nekoliko zaključaka koji se odnose naaktuelnu problematiku:• U najvećem broju slučajeva trovanja hranom pretpostavljeni uzrok trovanja bilaje kontaminirana hrana, što ukazuje da su najveći rizici vezani za sigurnost hraneu njenoj proizvodnji i preradi, dok značajno učešće hrane izvan roka trajanjaukazuje prvenstveno na nesavjesnost prodavača i distributera hrane, ali i naneučinkovitost inspekcijskog nadzora;• Samo trećina ispitanih slučajeva trovanja hranom je imala za posljedicu blažesimptome, što ukazuje na visok značaj i rizik uticaja kompromitirane hrane nazdravlje ljudi;• Najznačajniju prijetnju za trovanje stanovništva predstavljaju proizvodiživotinjskog porijekla i to mlijeko i proizvodi od mlijeka iz domaće proizvodnje,te meso i proizvodi od mesa iz uvoza, što podcrtava ulogu i značaj veterinara iveterinarskih eksperata i institucija u sistemu sigurnosti hrane u BiH.
Page 44
Čavaljuga Semra i sar.: "Case control" studija bolesti uzrokovanih hranom kod ljudi u regiji ... 38 LITERATURA 1. Catherine EW, Sandra LF, Danielle S. Keep Food Safe to Eat: Healthful FoodMust Be Safe as Well as Nutritious. 2001; 131:502-509. 2. Hromić H, Hromić S. HACCP kao dio sustava upravljanja kvalitetom uproizvodnji hrane. Seminar o legislativi i kontroli prehrambenih proizvoda.Sarajevo; 2002.3. Lammerding AM, Paoli GM. Quantitative Risk Assessment: An Emerging Toolfor Emerging Foodborne Pathogens. Animal Diseases of Public HealthImportance. Emerging Infectious Diseases. 1997; 3(4). 4. Miyagishima K. Internatioanal standard setting in biotechnology-role of CodexAlimentarius Commission. Health policy and administration. Kyoto University;2001.5. Rangan C, Barceloux DG. Food contamination. PubMed, 2009; 55(5):263-91.6. Wilbur GA. CGMP's Food Plant Sanitation. Food Production Management Inc;1990. 7. - - - : Anonymous. Emerging Pathogens Seen Needing Military-Style Thinking.Food Chemical News; 1996; 38(32).8. - - - : Ministarstvo zdravstva Kantona Sarajevo i Zavoda za javno zdravstvoKantona Sarajevo. Analiza zdravstvenog stanja stanovništva, higijenskih prilikai zdravstvene djelatnosti na Kantonu Sarajevo u 2007. godini. Sarajevo; 2008.9. - - - : Opća deklaracija o ljudskim pravima. Član 25. [Citirano: 18. 01. 2009.]Dostupno na: http://www.amnesty.hr/ 10. - - - : Zavod za javno zdravstvo Federacije Bosne i Hercegovine. Okoliš izdravlje. Bilten br. 17; 2007. [Citirano: 18. 01. 2009.] Dostupno na: http://www.zzjzfbih.ba/ Uredništvo primilo rukopis: 19.01.2009.
Page 45
Sinanović N. i sar.: Prevalencija dislokacija sirišta muznih krava različitih dobnih kategorija Veterinaria 58 (1-2),39-45, Sarajevo 2009.39 PREVALENCIJA DISLOKACIJA SIRIŠTA MUZNIH KRAVARAZLIČITIH DOBNIH KATEGORIJAPREVALENCE OF ABOMASAL DISPLACEMENT IN DAIRY CATTLEOF DIFFERENT AGE CATEGORIESSinanović N., Zahirović A., Ćutuk R., Filipović Selma, Maksimović A.• Abstract - Abomasal displacement in cattle has been characterized withdisplacement of abomasus out of its normal position to the left (LDA) or right (RDA)side of the abdomen. Abomasal displacements typically occur in high production dairycows. Abomasal displacements cause economic loss in dairy herds through decrease inmilk production, permanent weight loss, treatment costs, death, and has also beenconsidered to be having a negative impact on reproduction. The aim of this study was to analyze prevalence of abomasal displacement incattle in Bosnia and Herzegovina, considering the lack of the recorded data on thisdisorder. Clinical monitoring in one dairy farm was performed on 394 animals of Holstein –Frisian breed during 2008. The animals were divided into 3 groups according to age, in which Group 1consisted of animals between 15 and 24 months, Group 2 between 2 and 7 years, andGroup 3 older than 7 years. In this study, out of total of 394 animals, in 21 animals abomasal displacementwas diagnosed with total prevalence of 5,32%. In Group 1, from total of 36 animals, onlyone case of abomasal displacement was detected (2,77%). In Group 2, from total of 289animals, in 15 animals abomasal displacement was diagnosed (5,19%). In Group 3, fromtotal of 69 animals, in 5 animals abomasal displacement was diagnosed (7,24%.). Key words: abomasal displacement, dairy cattle, age • Dr. sc. Sinanović Nasir, DVM, viši asistent, Katedra za Ambulantnu kliniku; mr. sc. Zahirović Amir, DVM, viši asistent; dr. sc. Ćutuk Ramiz, DVM, vanredni profesor, Katdre zaunutrašnje bolesti; dr. sc. Filipović Selma, DVM, docent; Maksimović Alan, DVM, asistent,Katedra za hirurgiju, Veterinarski fakultet, Univerzitet u SarajevuSinanović Nasir, DVM, PhD, Senior Assistant, Department of Ambulatory Clinic;Zahirović Amir, DVM, MSc, Senior Assistant; Ćutuk Ramiz, DVM, PhD, Associate Professor,Department of Internal Medicine; Filipović Selma, DVM, PhD, Assistant Professor; MaksimovićAlan, DVM, Assistant, Department of Surgery, Veterinary Faculty, University of Sarajevo
Page 46
Sinanović N. i sar.: Prevalencija dislokacija sirišta muznih krava različitih dobnih kategorija 40Kratak sadržaj - Dislokaciju sirišta goveda karakteriše pomijeranje sirišta izvannjegove normalne pozicije, na lijevu ili desnu stranu. Dislokacija se najčešće dešava kodvisokomliječnih goveda. Ova bolest uzrokuje ekonomske gubitke, očitovane krozsmanjenu proizvodnju mlijeka, permanentno gubljenje tjelesne mase, troškove liječenja, aima i negativan uticaj na reproduktivnu sposobnost.Naš cilj bio je da ustanovimo prevalenciju kod mliječnih krava, obzirom da kodnas nema zabilježenih podataka o učestalosti ove bolesti.Klinički monitoring izvršen je tokom 2008. godine, na jednoj farmi muznihkrava i obuhvatio je 394 krave holštajn-frizijske pasmine.Tokom monitoringa životinje su, prema dobnim kategorijama, bile podijeljene utri grupe. Prva grupa obuhvatala je grla između 15 i 24 mjeseca starostne dobi, drugagrupa, između dvije i sedam godina, a trećoj grupi pripadale su životinje starije od sedamgodina.Od ukupnog broja ispitivanih životinja, kod 21 smo dijagnosticirali dislokacijusirišta, odnosno ukupnu prevalenciju, 5,32%. Kod prve grupe, od ukupno 36 jedinki,utvrđen je samo jedan slučaj dislokacije sirišta (2,77%). U drugoj grupi, od ukupno 289životinja, dijagnosticirali smo 15 slučajeva sa ovim oboljenjem (5,19%). U trećoj grupi,dislokaciju sirišta smo ustanovili kod pet (7,24%) od 69 krava.Ključne riječi: dislokacija sirišta, muzne krave, dob Uvod Dislokacija sirišta je bolest koja se javlja kod goveda i kompleksne je etiologije.Iako se spominjala i ranije, tek od polovine prošlog stoljeća postaje jedan odnajaktuelnijih problema u kliničkoj patologiji digestivnog trakta goveda (1).Bolest se očituje promjenom fiziloškog položaja sirišta sa otklonom na lijevu ilidesnu stranu. U patogenezi ove bolesti, akumulacija gasa u sirištu je krucijalna. Gasovi,koji se nakupljaju u abomazusu prevalentno su metan (70%) i karbon-dioksid (16).Među predisponirajućim rasama, navodi se holšajn-frizijsko govedo (17), koje je vrlozastupljeno na farmama u BiH.Najrizičniji period je prvi mjesec nakon oteljaja, sa porastom rizika povećanjemživotne dobi (3, 18). Visoka produkcija mlijeka kod goveda ima uticaj na rizik oddislokacije sirišta (6). Pojedini autori navode faktor ishrane, kao ključni u nastanku dislokacija sirištakod goveda. (13, 15). Pored naprijed iznijetih faktora, koji imaju uticaj na nastanak dislokacija sirišta,kao faktori rizika u literaturi su navedeni i metritisi (14).Ekonomske štete koje nastaju različite su prirode. Česta su uginuća oboljelihživotinja, ili bolest samim tokom doprinosi različitim gubicima. Oni se odnose nasmanjenje produkcije mlijeka, permanentno mršavljenje, a smatra se da bolest ima
Page 47
Sinanović N. i sar.: Prevalencija dislokacija sirišta muznih krava različitih dobnih kategorija Veterinaria 58 (1-2),39-45, Sarajevo 2009.41negativan uticaj i na reprodukciju. Ukupni gubici zbog šteta nastalih usljed dislokacijeabomazusa u SAD su između 250-450.000 $ (7).Obzirom da, prema nama dostupnoj literaturi, u Bosni i Hercegovini nemaevidentiranih podataka o prevalenciji navedene bolesti kod goveda, naš cilj bio jeustanoviti prevalenciju dislokacija sirišta muznih krava različitih dobnih kategorija.Također, cilj je bio i podstaći mjere monitoringa navedene bolesti na farmama muznihgoveda, ali i u individualnim uzgojima. Rad daje bazne podatke i podstiče istraživanjakoja bi putem sagledavanja kompleksne etiologije mogla u narednom periodu datiznačajne odgovore na mjere prevencije nastanka bolesti na uzgojima u BiH. Materijal i metode rada Tokom 2008 godine, vršili smo kllinički monitoring muznih krava, a našaistraživanja obuhvatila su ukupno 394 grla holštajn-frizijske pasmine. Prema starosnojdobi svrstali smo ih u tri skupine: prva skupina, goveda od 15 do 24 mjeseca, drugaskupina, od dvije do sedam godina, i treća skupina, starija od sedam godina.Sistem ishrane, način uzgoja, ambijentalni i drugi uvjeti za sve životinje bili sujednaki.Pregled životinja podrazumijevao je uzimanje anamnestičkih podataka, općiklinički pregled, naročito onih vezanih za mliječnost, partus i broj telenja. Svi podaci oživotinjama, koji su procijenjeni kao dijagnostički relevantni, korišteni su iz veterinarsko-tehnološke dokumentacije farme. Pored općeg kliničkog pregleda, kod oboljelih grlaizvršen je i hematološki, odnosno biohemijski pregled krvi (analizator IdexxLaboratories, Vet Test 8008). Rezultati Pozitivna grla pokazivala su stanovite kliničke promjene ispoljavane kod nekihživotinja u obliku dijareje, dok je kod određenog broja oboljelih grla evidentiranozauzimanje položaja karakterističnog za defekaciju, ali sa manjim količinama fecesa.Pored toga, u određenim slučajevima ustanovili smo selektivan apetit i izostanakpreživanja. Ubrzan puls i frekvencija disanja utvrđeni su kod težih slučajeva, dok jetjelesna temperatura kod oboljelih životinja bila u granicama normalnih vrijednosti.Kontrakcije buraga bolesnih krava su bile minimalne ili su potpuno izostale. Deformacijau obliku ispupčenja sličnog manjoj lopti mogla se zapaziti kod jednog broja grla upodručju lijeve gladne jame. Navedene promjene abdomena kod desnostrane dislokacijebile su znatno izraženije. Kod bolesnih životinja ustanovljena je povećana koncentracijaglukoze, ali i smanjena koncentracija natrijuma i hlora u krvnom serumu.
Page 48
Sinanović N. i sar.: Prevalencija dislokacija sirišta muznih krava različitih dobnih kategorija 42Na osnovu našeg istraživanja, od 394 grla uključena u proces kliničkogmonitoringa, sa oboljenjem dislokacije sirišta ukupno je dijagnosticirano 21 grlo, te jeutvrđena ukupna prevalencija od 5,32%.U odnosu na ukupni broj utvrđenih dislokacija, prevalencija pomjeranja sirištana lijevu stranu iznosila je 85,71%, dok su dislokacije na desnu stranu ustanovljene kod14,29 % oboljelih životinja.Detaljniji podaci sa ukupno ustanovljenim brojem oboljelih grla, prevalencijom,kao i analitičkim podacima vezano za dobne kategorije i tip dislokacije dati su u narednojtabeli. Tabela 1. Podaci o ustanovljenim dislokacijama tokom monitoringaTable 1. Data on detected abomasal displacement during monitoringDobnaskupinaBrojživotinjau tokumonitori-ngaBrojdislokaci-ja nalijevustranu%u odnosunaukupnibrojdislokaci-jaBrojdislokaci-jana desnustranu%u odnosunaukupnibrojdislokaci-jaUkupanbrojživotinjakod kojihse javiladislokaci-ja sirištaPrevale-ncija(%)15-24mjese-ca3611000012,772-7godina2891386,66213,34155,19Preko 7godina69480,00120,0057,24Ukupno3941885,71314,29215,32 DiskusijaUtvrđena ukupna prevalencija (5,32%) ukazuje da se radi o bolesti na koju trebaobratiti pažnju, naročito kod goveda u intenzivnom uzgoju. Evidentirana prevalencija dislokacija sirišta kod goveda kretala se unutarvrijednosti za koje neki autori (2, 11) smatraju da predstavljaju prosječno zabilježenevrijednosti prevalencije u većini zemalja (od 0 do 7%). Ukupno utvrđeni stepen oboljenjatokom našeg monitoringa, daleko je ispod onog utvrđenog istraživanjima u SAD (5) iHong Kongu (10), gdje je oboljenje dijagnosticirano kod oko 20% mliječnih grla. U obaistraživanja navodi se visoka produkcija mlijeka kod ispitivanih stada (900-1.200
Page 49
Sinanović N. i sar.: Prevalencija dislokacija sirišta muznih krava različitih dobnih kategorija Veterinaria 58 (1-2),39-45, Sarajevo 2009.43l/mjesec), što je znatno više u odnosu na goveda koja smo mi ispitivali (500-700 l).Slične rezultate (5,8%), dobili su Correa i sar. (4), koji navode da su istraživanja provelina 32 farme holštajn-frizijskih goveda u postpartalnom periodu. Međutim, Jordan iFourdraine (8) ističu znatno niži stepen prevalencije (3,3%), kod goveda sa visokomprodukcijom mlijeka (11.096 l/godišnje), ukazujući pri tom na izbalansiranost ishranekao faktor koji znatno smanjuje pojavu ovog oboljenja.Iako određene studije (14) tvrde da ne postoji jasan odnos između prevalencijedislokacije sirišta i životne dobi, naši nalazi pokazuju 7,24% ustanovljenost bolesti kodgoveda starijih od 7 godina, u odnosu na najmlađu ispitivanu starosnu dob, i prevalencijuod 2,77%. Naša zapažanja, koja govore o tome da je prevalencija viša kod starijihživotinja, odnosno životinja sa većim brojem partusa, podudaraju se sa navodima većineautora (3, 8, 9, 16). Rezultati govore, da je dislokacija sirišta na lijevu stranu imala izrazito većuprevalenciju (85,71%). Taj nalaz bio je i očekivan, jer svi literaturni podaci koji obrađujuovu problematiku, ističu izrazitu prevalentnost takvog pomjeranja, zahvaljujućianatomskoj strukturi probavnog trakta goveda.Ukupna prevalencija dislokacija na lijevu stranu od 85,71%, ipak je manja uodnosu na nalaze u nekim zemljama, kao što je nalaz kod krava u Iranu (95,45%) (12).Dislokacija sirišta kod mladih grla na lijevu stranu, koju smo ustanovili bila je100%, dok je u skupini goveda od dvije do sedam godina bila 86,66%. Prevalencijapomjeranja sirišta na lijevu stranu kod grla starijih od sedam godina bila je 80,00%. Zaključak Na osnovu naših rezultata može se zaključiti da postoji odnos između starosti iporasta prevalencije dislokacija na desno, koje su klinički manje povoljne.Navedeni rezultati ukazuju na pojavu bolesti kod farmskih grla u BiH, alinepostojanje dosadašnje evidencije govori o nedovoljnom obraćanju pažnje na ovupojavu, što ima za posljedicu ekonomske gubitke izražene kroz opadanje proizvodnje,ekonomska klanja, a u nekim slučajevima i ugibanja životinja. Pored monitoringa i diferencijalne dijagnostike u odnosu na druga oboljenjaprobavnog sistema goveda, menadžment program mora biti usmjeren na prevencijupojave ove bolesti, odnosno smanjenja njene prevalencije.Zdravstveni menadžment mora biti usmjeren na održavanje što optimalnijetjelesne mase goveda sa naročitim programom balansiranja ishrane dvije do četirisedmice prije telenja i četiri do šest sedmica nakon telenja. Pored navedenog, starija grla bi trebalo isključivati iz uzgoja, kao i grla sklonaponovnim pojavama navedene bolesti.
Page 50
Sinanović N. i sar.: Prevalencija dislokacija sirišta muznih krava različitih dobnih kategorija 44 LITERATURA 1. Begg H. Diseases of the stomach of the ruminant. The Veterinary Record. 1950;62: 797.2. Cameron, RE, Dijk PB, Herdt TH i sar. Dry cow diet, management, and energybalance as risk factors for displaced abomasum in high producing dairy herds.Journal of Dairy Science. 1998; 81:132-139.3. Constable PD, Miller GY, Hoffsis GF i sar. Risk factors for abomasal volvulusand left abomasal displacement in cattle. American Journal of VeterinaryResearch. 1992; 53: 1184-1192.4. Correa MT, Erb HE i Scarlett JM. Path analysis for seven postpartum disordersof Holstein cows. Journal of Dairy Science. 1993; 76:1305-1312.5. Dawson L. J., Aalseth E. P., Rice L. E. i sar. Influence of fiber form in acomplete mixed ration on incidence of left displacement abomasums inpostpartum dairy cows. Journal of the American Veterinary MedicineAssociation. 1992; 200; 1989-1992.6. Fleischer P., Metzner M., Beyerbach M i sar. The relationship between milkyield and the incidence of some diseases in dairy cows. Journal of DairyScience. 2001; 84: 2025-2035.7. Geishauser T., Leslie K., Duffield T. Metabolic aspects in the etiology ofdisplaced abomasum. Veterinary Clinics of North America, Food AnimalPractice. 2000; 16: 255-265.8. Jordan ER, Fourdraine RH. Characterization of the management practices of thetop-producing herds in the country. Journal of Dairy Science. 1993; 76: 3247.9. Jubb TF, Malmo J., Davis G. M i sar. Left-side displacement of the abomasumin dairy cows at pasture. Australian Veterinary Journal. 1991; 68: 140-142.10. Kane P. Displaced abomasums on a dairy farm in Hong Kong. The VeterinaryRecord. 1983; 113: 96.11. Kelton DF, Lissemore KD, Martin RE. Recommendations for recording andcalculating the incidence of selected clinical diseases of dairy cattle. Journal ofDairy Science. 1998; 81: 2502-2509.12. Mohamadnia AR, Arabi M., Zohrabi A. Displaced Abomasum on Dairy Farm inIran. Pakistan Journal of Biological Sciences. 2006; 9(6): 1169-1172.13. Østergaard S., Gröhn YT. Concentrate feeding, dry-matter intake, and metabolicdisorders in Danish dairy cows. Livestock Production Science. 2000; 65: 107-118.14. Rohrbach BW, Cannedy AL, Freeman K. i sar. Risk factors for abomasaldisplacement in dairy cows. Journal of the American Veterinary MedicalAssociation. 1999; 214: 1660-1663.15. Shaver RD. Nutritional risk factors in the etiology of left displaced abomasum indairy cows: a review. Journal of Dairy Science. 1997; 80: 2449-2453.
Page 51
Sinanović N. i sar.: Prevalencija dislokacija sirišta muznih krava različitih dobnih kategorija Veterinaria 58 (1-2),39-45, Sarajevo 2009.4516. Svendsen P. Etiology and pathogenesis of abomasal displacement in cattle.Nordisk Veterinærmedicin 1969; 21. Supplement I: 1-60.17. Uribe HA, Kennedy BW, Martin SW i sar. Genetic parameters for commonhealth disorders of Holstein cows. Journal of Dairy Science. 1995; 78: 421-430.18. Van Widen SC, Kuiper R. Left displacement of the abomasums in dairy cattle:Recent developments in epidemiological and etiological aspect. VeterinaryResearch. 2003; 34: 47-56.Uredništvo primilo rukopis 14.05.2009.
Page 52
Page 53
Rexhepi A. et al.: Occurrence of infectious pancreatic necrosis virus (IPNV) in farmed rainbow... Veterinaria 58 (1-2),47-53, Sarajevo 2009..47 OCCURRENCE OF INFECTIOUS PANCREATIC NECROSIS VIRUS(IPNV) IN FARMED RAINBOW TROUT (ONCHORHYNCHUS MYKISS)IN KOSOVOPOJAVA VIRUSA ZARAZNE NEKROZE GUŠTERAČE (IPNV)KALIFORNIJSKE PASTRMKE (ONCHORHYNCHUS MYKISS) NAKOSOVURexhepi A., Scheinert P., Bërxholli K., Hamidi A., Sherifi K.•• Abstract - This article describes the research carried out for the detection ofviruses responsible for VHS, IHN and IPN diseases in farmed rainbow trout(Oncorhynchus mykiss) in Kosovo for the three-year period between 2006 and 2008.Losses are often reported in trout fingerlings, but no virus has ever been isolated in therainbow trout in Kosovo. A research project was carried out to determine the occurrenceof VHSV, IHNV & IPNV from the samples of fish tissue and ovarian fluids from maturebroodfish. In total, 467 fishes from 113 (pools) in 10 rainbow trout aquaculture facilitieswere screened. Laboratory analysis was performed at the TGD (TiergesundheitsdienstBayern e. V) laboratory in Germany using the biomolecular method of RT-PCR andnested-PCR. The Infectious Pancreatic Necrosis virus was detected in seven trout farms,and prevalence from total samples (pools) was 11.5 %. This is the first research andreport for IPN virus diagnosis in farmed rainbow trout fry, on-growing fish and broodfishin Kosovo.Keywords: Rainbow trout, viral diseases, IPN, RT-PCR, nested PCRKratak sadržaj - Rad se odnosi na otkrivanje virusa odgovornih za VHSV,IHNV i IPNV bolesti kalifornijske pastrmke na Kosovu tokom trogodišnjeg periodaizmeđu 2006-2008. Gubici u mlađi su često prijavljivani, mada virus nikad nije izolovanna Kosovu. Istraživanja su provedena da se odredi pojava virusne hemragične septikemijepastrmki (VHSV), zarazne hematopoetske nekroze (IHNV) i zarazne nekroze gušterače(IPNV) iz uzoraka tkiva jedinki i uzoraka ovarijalne tečnosti polno zrelih jedinki.Ukupno 467 riba, iz 113 zbirnih uzoraka, sa 10 ribljih farmi je pretraženo. Laboratorijskeanalize su izvršene u TGD (Tiergesundheitsdienst Bayern e. V) laboratoriji u Njemačkoj, •• Rexhepi Agim, DVM, MSc, PhD student at Faculty Veterinary Medicine, Agricultural University of Tirana agimrexhepi@yahoo.com; Berxholli Kristaq, PhD., Professor of Virology,Department of Veterinary Public Health at Faculty of Veterinary Medicine, Agricultural Universityof Tirana; Scheinert Peter, PhD, Head of Fish Health Service (FGD) in Animal Health Service(TGD- tiergesundheitsdienst) Bayern e.v., Germany; Hamidi Afrim, PhD, Professor Assistant,Department of Meat Hygiene, Agricultural and Veterinary Faculty in Prishtina; Sherifi Kurtesh,PhD, Professor Assistant, Department of Parasitology, Agricultural and Veterinary Faculty inPrishtina
Page 54
Rexhepi A. et al.: Occurrence of infectious pancreatic necrosis virus (IPNV) in farmed rainbow... 48koristeći biomolekularnu metodu RT-PCR i nested-PCR. Virus IPN-a je otkriven nasedam farmi i prevalencija u ukupnom broju uzoraka bila je 11,5%. Ovo je prvoistraživanje i izvještaj za IPN dijagnozu kod mlađi kalifornijske pastrmke na rastilištima imatičnjacima na Kosovu. Ključne riječi: Kalifornijska pastrmka, viralne bolesti, IPN, RT-PCR, nestedPCR Introduction Table size trout of around 350 g is commonly cultured in the concrete walledraceways with concrete bottoms. In the vast majority of trout farms in Kosovo, the freshwater is sourced directly from the natural springs without undergoing a pre-treatment,maintaining a constant temperature of around 11 oC. Trout farming has become a rapidlygrowing industry in Kosovo, but several disease problems have developed. Recently, theimport of rainbow trout summer eggs to Kosovo has increased, about 500.000 eggs wereimported from Germany and the United States of America in the years 2007 and 2008. Viral hemorrhagic septicaemia virus (VHSV) and infectious haematopoieticnecrosis (IHNV) are both important disease agents in farmed rainbow trout, and thedisease outbreaks cause major losses in fish farming worldwide. Both VHSV and IHNVare viruses of the Rhabdoviridae family, genus Novirhabdovirus (2). Diseases may infectsalmonid fish of all ages and cause 80% to 100% mortality (13). Disease outbreaks aremainly in fingerlings less than 6 months of age. Transmission of virus occurshorizontally, however vertical transmission has been evidenced for IHNV (8). Infectiouspancreatic necrosis virus (IPNV) belongs to the Birnaviridae family, genusAquabirnavirus (9), which can cause high mortality in the salmonids. In rainbow trout,only young fish become clinically ill and as such, it has been classified as a disease offirst feeding fry (9). The disease can be spread horizontally as well as vertically throughovarian fluids (4, 10). Horizontal spread of IPN disease depends on the age of fish andmanagement/husbandry conditions (13). In farms with IPN outbreaks, lifelongasymptomatic fish with latent infection may carry the virus in adult stages withoutshowing any evidence of disease (9, 12). The highest mortality for all three diseasesoccurs when the water temperature is between 10 oC to 14 oC (8, 10).Sano (11) considers viral diseases in fish very serious due to the fact that theirdiagnosis is difficult, in a significant number of cases they are acute or sub-acutediseases. Noga (8) described viral disease characteristics as a temperature-dependedpathogenicity, host-specific, with a higher sensitivity relating to young fish and viruscarriers after infection, and without a possibility to be treated adequately by medication.The three viruses investigated in this study all contain a RNA viral genome and thereforeRT-PCR (reverse transcriptase PCR) is used for RNA transcription and cDNAamplification (1).The viral disease status of cultured rainbow trout in Kosovo had been unknownuntil this research commenced. This study is important for the development ofaquaculture and fisheries in Kosovo, from both a fish health and economic aspect.
Page 55
Rexhepi A. et al.: Occurrence of infectious pancreatic necrosis virus (IPNV) in farmed rainbow... Veterinaria 58 (1-2),47-53, Sarajevo 2009..49 Material and method Samples for laboratory analysis were collected from: complete fry visceralorgans (liver, kidney and spleen) from table size fish, and ovarian fluid from femalebroodfish. Pools of 3-5 fishes or organs from the same fish farm have been preserved inplastic tubes in ethanol 70% and isopropanol 98%, and ovarian fluids pools are savedfrozen in 1.5 ml tubes. In total, 113 pools were sampled containing 467 fish, from 10rainbow trout farms over the three year period between 2006 and 2008, in five samplingperiods (Table 1). RNA extraction, reverse transcription and amplification: Total RNA wasextracted from the fish tissue collected from the whole fish (fry), pooled organs (liver,kidney, spleen) and ovarian fluids using RNasy Mini Handbook, (Qiagen, June 2001)following Rnasy Mini protocol for isolation of total RNA from animal tissue. RT-PCRmixture contained: Reverse IT Master mix (Thermoprime plus DNA polymerase1.25U/50 µl, optimized reaction buffer dNTP 0.2 mM, MgCl2 1.5 mM, RTase Blend(50U/µl) including RNase inhibitor), 50pmol/μl of sense and antisense primer, 1μlreverse IT Blend, 19 μl distilled water and 3 μl from sample. Nested PCR mixturecontained: Master Mix contained Thermoprime plus DNA polymerase 1.25U/50 µl, 75mM Tris-HCl, 20 mM (NH4)2SO4, 2.5 mM MgCl2, 0.01% Tween, 0.2 mM of each dATP,dCTP, dGTP and dTTP; 50 pmol/μ of sense and antisense primer, and 3 μl of theamplification products obtained by RT-PCR.Primers: The aquatic IPNV-specific primers, 1 μl sense primer WB1(CCGCAACTTACTTGAGATCCATTATGC) and 1 μl antisense primer WB2(CGTCTGGTTCAGATTCCACCTGAGTG) which recognize a 206-bp cDNA fragmentwithin the VP2 gene of IPNV (13). The IHNV-specific primers, 1 μl sense primer IHN3(GTTCAACTTCAACGCCAACAGG) and 1 μl antisense primer IHN4(TGAAGTACCCCACCCCGAGCATCC) recognize a 371-bp cDNA fragment within theN gene of IHNV (13). The VHSV specific primers for RT PCR amplification 1 μl senseVG1 (ATGGGAATGGAACACTTTTTTC) and 1μl antisense VGR(TCAGACCGTCTGACTTCTGGA) which recognize a 1524-bp cDNA fragment withinthe G gene of VHSV. For Nested PCR primers, 0.5 μl sense VD5(TCCCGTTATCAGTCACCAG)and0.5μlantisenseVD3(TGTGATCATGGGTCCTGGTG) which recognize a 440-bp cDNA fragment within theG gene of VHSV (7). RT PCR and Nested PCR thermal cycler programs: Reverse transcription ofVHSV RNA and amplification of cDNA were performed in a thermal cycler by thefollowing program: 42 ˚C for 60 min and 95 °C for 1 min followed by 40 amplificationcycles of denaturation at 95 °C for 30 s, annealing at 52 °C for 40 s, extension at 72 °Cfor 40 s, and final extension at 72 °C for 5 min. VHSV nested PCR was performed in athermal cycler; 95 °C for 1 min, following 25 amplification cycles of denaturation at 93°C for 30 s, annealing at 52 °C for 40 s, extension at 72 °C for 40 s, and final extension at72 °C for 5 min. Reverse transcription of IHNV and IPNV RNA and amplification ofcDNA were performed in the thermal cycler: 47 ˚C for 60 min and 94 °C for 5 minfollowed by 40 amplification cycles of denaturation at 94 °C for 30s, annealing at 60 °Cfor 30 s, extension at 72 °C for 90 s, and final extension at 72 °C for 10 min.
Page 56
Rexhepi A. et al.: Occurrence of infectious pancreatic necrosis virus (IPNV) in farmed rainbow... 50On each gel, negative controls from uninfected material and positive controlswere run as well. Gel electrophoresis: PCR products were analysed on a 2% agarose gel byelectrophoresis in 120 V for 60 min in TAE buffer (sterile water, Tris, acetic acid andEDTA) loaded with 8 to 10 μl of PCR sample. A PCR marker of 100-bp DNA laddermolecular weight was also loaded and run on each gel. The gels were stained in 1%ethidium bromide and a UV transilluminator (Biorad) was used to visualize the bands,and results were recorded by photography. Results Clinical signs: At the time of sampling, a peculiar swimming motion wasobserved in fry positive with IPNV (2006, 2007 and 2008): fish were swimming on theirsides or with slow spiral movements. The fry were also darker in skin pigmentation andhad swollen abdomens, as previously described (8, 9) According to the fish farm sitemanagers, mortalities with similar signs had occurred in previous years. During thesampling period, the mortality rate ranged from 10% up to 90% in fry stage. The fishsampled in 2008, weighing about 100 g, resulting as IPNV positive were notably darkerin colour and appeared weak and lethargic. No visible signs of disease are seen inbroodfish (2006 and 2007) positive with IPN. Table 1. Number of samples and results of research of IPNV in rainbow trout farms over a three-year periodTabela 1. Broj uzoraka i rezultati istraživanja IPN virusa na farmama kalifornijske pastrmke uperiodu od tri godine Number of examinedFry Brood-fishOn-growing fishTotalNumber ofIPNV positiveYearPoolsFishPoolsFish Pools Fish Pools Fish PoolsFarmsSamplingmaterialIPNVpositive200642040974207713731Fry200712050150--5117085Ovarianfluid, fry200813138--121414022Fry, fishtissue The Table 1 shows the results of the 2006, 2007 and 2008 sample number andlaboratory results on the fry, fish tissue and ovarian fluid.PCR results: All samples were analysed for VHSV, IHNV and IPNV, with onlyIPNV being detected (table 1). From the samples obtained in 2006 from one fish farm,IPNV was detected in 3 of 48 pools. Detection was in fingerlings but not in table sizetrout or ovarian fluids taken from broodfish.
Page 57
Rexhepi A. et al.: Occurrence of infectious pancreatic necrosis virus (IPNV) in farmed rainbow... Veterinaria 58 (1-2),47-53, Sarajevo 2009..511 2 3 4 5 6 78206 bp Figure 1. First detection of the infectious pancreatic necrosis virus (IPNV) in fingerlings tissuesamples by reverse transcription PCR (RT-PCR). Lane 1 and 8: 100 bp ladders (Abgene); lane 2,negative control of RT-PCR; lane 3, negative control of RNA extraction; lane 6 negative IPNV;lanes 4 and 5 positive IPN and lane 7 IPNV-positive control.Slika 1. Prva detekcija virusa zarazne nekroze gušterače (IPNV) u uzorcima tkiva mlađikalifornijske pastrmke tehnikom RT-PCR (reverse transcription polymerase chain reaction). Trakeod 1 do 8 : 100 bp skala (Abgene); traka 2, negativna kontrola RT-PCR tehnike; traka 3 negativanakontrola RNA ekstrakcije; linije 4 i 5 pozitivno na IPN virus; linija 6 negativna kontrola IPNvirusa i linija 7 IPN virus pozitivna kontrola From the samples in the year 2007 from 51 pools, 8 pools were positive forIPNV on 5 trout farms. In 2008, from 14 pools, IPNV was detected in two pools fromtwo trout farms. The total number of IPNV positive pools over the three yearinvestigation was 13, or prevalence was 11.5%. Seven of the 10 trout farms (70.0%)investigated had at least one IPNV positive pool. In all cases with IPNV positive resultsfrom fry, increased mortalities were reported on site (personal communication), and signsof IPN disease outbreaks were observed. In broodfish screened as IPNV positive carriers,no clinical signs of IPN disease were observed. In all fish farms where IPN virus wasdetected by PCR, the water temperatures ranged from 10 °C to 11 °C. VHSV and IHNVwere not detected from any of the fish screened and no gross external signs of VHS andIHN disease were observed during this study. Discussion The aim of this study was to provide an overview on the status of virus presencein rainbow trout in Kosovo. In five surveys of farmed rainbow trout in Kosovo in period2006-2008, a high number of sites with virus-positive occurrence is found among the fishfarms investigated (total 7 sites). Within the 113 tissue samples analyzed, 13 werepositive for IPNV, mostly from rainbow trout fingerlings and reproductive fluid.
Page 58
Rexhepi A. et al.: Occurrence of infectious pancreatic necrosis virus (IPNV) in farmed rainbow... 52The importance of making accurate and rapid IPNV detection is significant dueto the high number of losses, which can be associated with IPNV outbreaks and alsobecause survivors may become lifelong asymptomatic carriers, continuously sheddingvirus in their faeces, urine and reproductive fluids: transmitting it to their progeny and/orother susceptible fish. The finding of IPNV in broodfish supports the hypothesis of latentcarriers for IPNV infections in rainbow trout without signs of disease (4, 10). Milne et al.(6) has reported that growth performance is negatively affected in carrier populations,which is another very important economical factor concerning IPNV.Recently, the fish farmers have been importing eggs from the Europeancountries and some live fish movements occurred from the neighbouring countries(including Bosnia and Herzegovina) within the region. Similar to other Balkan countries,namely Turkey and Greece, IPNV was detected in fry and fingerling stages (3, 12).In none of the trout farms where virus was detected from broodfish, was IPNVdetected from fry or fingerlings. Based on these results, it may be deduced that the mostprobable spread of IPN virus in Kosovo is more likely to be due to horizontaltransmission with regard to equipment, movement of ova/fish and by the fish farmpersonnel/visitors. This RT-PCR method proved to be a rapid, reliable and sensitive technique forthe identification of the IPN virus from infected fish tissue showing clinical sings andfrom IPNV infected ovarian fluids. Lopez-Vazquez et al. (5) reported that RT-PCR hasbecome a commonly used tool for detection of viral fish pathogens. Williams et al. (13)reported the successful amplification of IPNV from virus suspension using the WB1 andWB2 primer set used in our research. Unfortunately, in the absence of very efficient prevention and control measures,IPN disease may cause high loses in trout farms and be very difficult to eradicate. It isultimately a time to perform regular health checks on the trout farms, which includeroutine inspection of broodfish without neglecting asymptomatic carriers of virus withlower titres of virus, as reported in Milne et al. (6). This will minimise the spread ofIPNV when fish are moved to different locations, and wild trout infections.The trout farms where IPNV has been detected are situated in three differentregions in Kosovo. One of the trout farms that tested IPNV positive has a water sourcefrom an adjacent freshwater river system and the rest of the farms have direct water inletfrom the natural springs, with no other fish present within inlet water environment. Allwater outlets without any treatments are connected to the river systems. Conclusion This is the first research carried out for detection of IPNV from farmed troutfingerlings, on-growing fish and broodfish ovarian fluids. The main conclusion that can be drawn from this study is that IPNV is present introut farms in Kosovo with a significant occurrence. IPNV was detected on fingerlings with clinical signs of IPN disease, and inbroodfish as a latent infection.This RT-PCR proved to be a rapid and sensitive technique for the identificationof the IPNV from the infected fish tissue and ovarian fluids.
Page 59
Rexhepi A. et al.: Occurrence of infectious pancreatic necrosis virus (IPNV) in farmed rainbow... Veterinaria 58 (1-2),47-53, Sarajevo 2009..53 REFERENCES 1. Bërxholi K. Hyrje ne virologji. 2004 Julvin 2, Tirane,2. Brudeseth BE, Castaric J, Evensen Ø. Studies on pathogenesis following singleand double infection with Viral Hemorrhagic Septicemia Virus and InfectiousHematopoietic Necrosis Virus in Rainbow Trout (Oncorhynchus mykiss).Veterinary Pathology. 2002; 39, 180–189. 3. Candan A. First report on the diagnosis of infectious pancreatic necrosis (IPN)based on reverse transcription polymerase chain reaction (RT-PCR) in Turkey.Bulletin of the European Association of Fish Pathologists. 2002; 22 (1), 45.4. Lopez-Lastra M, Gonzalez M, Jashes M, et al. A detection method for infectiouspancreatic necrosis virus (IPNV) based on reverse transcription (RT)-polymerase chain reaction (PCR). Journal of Fish Diseases. 1994; 17, 269-282.5. Lopez-Vazquez C, Dopazo CP, Olveira JG, et al. Development of a rapid,sensitive and non-lethal diagnostic assay for the detection of viral haemorrhagicsepticaemia virus. Journal of Virological Methods. 2006; 133, 167–174. 6. Milne SA., Gallacher S, Cash P, et al. A reliable RT-PCR–ELISA method forthe detection of infectiouspancreatic necrosis virus (IPNV) in farmed rainbowtrout. Journal of Virological Methods. 2006; 132, 92–96.7. Miller TA, Rapp J, Wastlhuber U, Hoffman RW, et al. 1998). Rapid andsensitive reverse transcriptase-polymerase chain reaction based detection anddifferential diagnosis of fish pathogenic rhabdoviruses in organ samples andcultured cell. Disease of aquatic organisms. 1998; 34, 13-20. 8. Noga E J. Fish disease diagnosis and treatment. USA: Iowa State UniversityPress; 2000.9. Roberts RJ. Fish pathology. London: W.B Saunders;2001. 10. Saint-Jean SR, Borrego JJ, Perez-Prieto SI. Comparative evaluation of fiveserological methods and RT-PCR assay for the detection of IPNV in fish.Journal of Virological Methods. 2001; 97, 23–31.11. Sano T, Viruses and viral diseases of salmonids. Aquaculture. 1995; 132, 43-52.12. Varvarigos, P. and Way K. (2002). First isolation and identification of theInfectious Pancreatic Necrosis (IPN) virus from rainbow trout Onchorhynchusmykiss fingerlings farmed in Greece. Bulletin of the European Association ofFish Pathologists, 22 (3), 195.13. Willimas K, Blake S, Sweeney A, Singer JT, et al. (1999). Multiplex ReverseTranscriptase PCR Assay for Simultaneous Detection of Three Fish Viruses.Journal of Clinical Microbiology. 1999; 37, 12, 4139–4141.Uredništvo primilo rukopis 08.05.2009.
Page 60
Page 61
Korjenić E. i sar: Populacije riba rijeke Požarne Veterinaria 58 (1-2),55-62, Sarajevo 2009.55 POPULACIJE RIBA RIJEKE POŽARNEFISH POPULATIONS OF THE POŽARNA RIVERKorjenić E., Džano A., Šuta N.• Abstract – Ichthyofaunal research of the river Požarna was conducted duringtwo seasons in the year 2006. The fish was caught with standard fish catching tools. Onthe field, the collected material was stored into 4% formaldehyde solution, and relocatedin a laboratory for further analysis. Biosystematic determination of the caught fish wasperformed according to Vuković (15). The analysis of the total representative sampleshowed that the respective area was populated by the three species of fishes from thethree different families. Specified were the River Trout - Salmo trutta m. fario (Linnaeus,1758) from the Salmonidae family, Thymallus thymallus (Linnaeus, 1758) from theThymallidae family. The Cottidae family was represented with Cottus gobio (Linnaeus,1758). All three fish species were recorded in both sesons in the research area. Salmotrutta m. fario had the largest population size (91 or 68,42% of all caught fish). Suchpopulation size was also reflected in the contribution to the ichthyomass of 4.44 g or78,46%.Key words: fish population, Požarna riverKratak sadržaj - Ihtiofaunistička istraživanja rijeke Požarne obavljena su tokom dvijesezone 2006. godine. Izlov ribe izvšen je standardnim ribolovnim alatom. Sakupljeniihtiomaterijal je na terenu fiksiran u 4%-tnom rastvoru formaldehida i prenesen ulaboratorij na dalju obradu. Biosistematska determinacija ulovljenih riba je izvršenaprema Vukoviću (15). Analizom ukupnog reprezentativnog uzorka je konstatovano daovo područje naseljavaju tri vrste riba iz tri porodice. Iz porodice Salmonidaeevidentirana je potočna pastrmka - Salmo trutta m. fario (Linnaeus, 1758), a iz porodiceThymallidae registrovan je lipljen - Thymallus thymallus (Linnaeus, 1758). PorodicaCottidae predstavljena je pešom - Cottus gobio (Linnaeus, 1758). Sve tri riblje vrste naovom istraživanom području registrovane su u obje sezone istraživanja. Potočna • Dr. sc. Korjenić Enad, biolog, docent; Džano Adil, student; Šuta Nedim, student,Prirodno-matematički fakultet, Univerzitet SarajevoKorjenić Enad, PhD, Biologist, Associate Professor; Džano Adil, Student; Šuta Nedim,Student, Faculty of Science, University of Sarajevo
Page 62
Korjenić E. i sar: Populacije riba rijeke Požarne 56pastrmka je u ovom uzorku bila najbrojnija (91 jedinka), što čini 68,42% od ukupnoulovljenih riba. Ovakva brojnost se odražava i u učešću potočne pastrmke u ihtiomasi uiznosu od 4.44 g ili 78,46%.Ključne riječi: populacije riba, rijeka Požarna Uvod Poznavanje faune riba, sastava i strukture ribljeg naselja, raznih uticaja nanjihove uslove života i ostalih elemenata vodnog ekosistema, predstavlja neophodnupolaznu osnovu za dalja fundamentalna istraživanja, a isto tako i za ona aplikativna, upogledu unapređenja ili iskorištavanja vodnih sistema, odnosno njihovih životnihzajednica.Pregledom literaturnih podataka, može se zaključiti da je u Bosni i Hercegoviniposvećena pažnja istraživanju faune riba, kako u tekućicama, tako i u zatvorenim vodnimekosistemima (vještačke vodene akumulacije, prirodna jezera i sl.). Značajne podatke osastavu i strukturi ribljih populacija, te raznih uticaja na njihove uslove života susrećemou publikovanim radovima: Kosorić i Mikavica (7); Kosorić i sar. (6); Sofradžija, Vukovići Hadžiselimović (13); Aganović i Kapetanović (2); Mikavica, Sofradžija i Dizdarević(8); Škrijelj (14); Korjenić (3); Adrović (1); Sofradžija i sar. (10, 11, 12) i dr.Istraživanje sastava populacija riba, pored naučnog značaja, ima i velikuvrijednost primjene, kako u sportskom, tako i u privrednom ribarstvu. Nedovoljnaihtiofaunistička istraženost rijeke Požarne, koja pripada slivu rijeke Fojnice, bio jetemeljni razlog našeg opredjeljenja za istraživanje kvalitativno-kvantitativnog sastavaihtiopopulacija Požarne. Osnovni cilj ovog rada je usmjeren na utvrđivanje aktuelnogkvalitativno-kvantitativnog sastava ihtiofaune na istraživanoj tekućici. Materijal i metode Ihtiofaunistička istraživanja rijeke Požarne, koja pripada slivu rijeke Fojnice,obavljena su tokom ljetnog (27 i 28.07. 2006. godine) i jesenjeg (28 i 29.10. 2006.godine) perioda. Izlov ribe izvršen je elektroagregatom marke “Elekto-Fischfanggerät“,jačine 2 KW, na dužini riječnog toka od 150 do 250 m. Širina korita je bila različita, pa jevarirala između 10 i 40 m, a dubina vode se kretala od 10 do 100 cm (slika 1.).Sakupljeni ihtiomaterijal je na terenu fiksiran u 4%-tnom rastvoru formaldehidai prenesen na dalju obradu u laboratorij Centra za ihtiologiju i ribarstvo Prirodno-matematičkog fakulteta u Sarajevu. Biosistematska determinacija ulovljenih riba jeizvršena prema Vukoviću (15).Dalja obrada ihtiomaterijala sastojala se u determinisanju spolova disekcijom ipregledom gonada. Osim spolne strukture, određivana je i dobna struktura istraživane
Page 63
Korjenić E. i sar: Populacije riba rijeke Požarne Veterinaria 58 (1-2),55-62, Sarajevo 2009.57ihtiofaune. Za određivanje dobi (starosti) korištene su krljušti, od kojih su se pravili trajnipreparati za svaku ispitivanu jedinku ponaosob. Krljušti su skidane s tijela isptivaneihtiofaune, čišćene blagim rastvorom KOH-a i stavljane na predmetno staklo i pomoćubiokularne lupe (brojanje skleritnih prstenova) vršeno je određivanje dobi. Slika 1. Istraživano područjeFigure 1. Research area Svim analiziranim jedinkama u uzorku su mjerene totalne dužine tijela, dužinetijela bez C (ihtiometrom) i masa (elektronskom vagom), na osnovu kojih su dobivenipodaci o rasponu variranja, odnosno srednjim vrijednostima, ovih morfometrijskihkaraktera. Statistička obrada (srednje vrijednosti ovih morfometrijskih karaktera)izvedena je prema Petzu (9). Rezultati Rezultati kvalitativnog sastava ihtiofaune ovog područja po sezonamaistraživanja su prikazani u tabeli 1. i na slikama 2. i 3. Tabela 1.Kvalitativni sastav ihtiofaune rijeke Požarne po sezonamaTable 1. Qualitative seasonal ichthyofaunal composition of Požarna riverSezona: ljetoSezona: jesenPorodicaVrsta ribaVrsta ribaSalmonidaePotočna pastrmka - Salmo trutta m.fario (Linnaeus, 1758.)Potočna pastrmka - Salmo trutta m.fario Linnaeus, 1758.ThymallidaeLipljen -Thymallus thymallus(Linnaeus, 1758)Lipljen - Thymallus thymallus(Linnaeus, 1758)CottidaPeš -Cottus gobio Linnaeus, 1758.Peš -Cottus gobio Linnaeus, 1758.
Page 64
Korjenić E. i sar: Populacije riba rijeke Požarne 58 Slika 2 i 3. Primjerci registrovanih ribaFigure 2 & 3. Examples of identified fishes(1. Salmo trutta m. fario)(2. Thymallus thymallus)(3. Cottus gobio) Kao što se vidi iz prikazane tabele 1. i slika 2. i 3. (numerisane vrste 1, 2 i 3),sve tri riblje vrste na ovom istraživanom lokalitetu registrovane su u obje sezoneistraživanja. Tokom dvije sezone istraživanja ukupno su ulovljene 133 jedinke, čija jeihtiomasa iznosila 5.664,61 g. Dobiveni podaci o kvantitativnoj strukturi, tj. o brojnosti imasi registrovanih vrsta riba u ukupnom ulovu sa ovoga lokaliteta su prikazani u tabeli 2. Tabela 2. Kvantitativni sastav ihtiofaune rijeke Požarne Table 2. Quantitative ichthyofaunal composition of Požarna riverVrsta ribaBroj (n)Relativnazastupljenost (%)Masa(g)Masa u procentima (%)Potočna pastrmka9168,424.444,7278,46Lipljen107,52397,947,03Peš3224,06821,9514,51Ukupno133100,005.664,61100,00 Potočna pastrmka je u ovom uzorku bila najbrojnija (91 jedinka), što čini 68,42% od ukupno ulovljenih riba. Ovakva brojnost se odražava i u učešću potočne pastrmke uihtiomasi u iznosu od 4.444,72 g ili 78,46 %. Peš je, po brojnosti, u našem uzorkuzastupljen sa 32 jedinke, odnosno 24,06 % od ukupnog ulova. Ihtiomasa peša je iznosila 821,95 g ili 14,51 %. Najmanju brojnost u uzorku imao je lipljen sa svega desetregistrovanih jedinki, što čini 7,52 % od ukupne brojnosti. Masa lipljena je iznosila397,94 g ili 7,03 % od ukupne mase uzorka.Nakon analize ukupnog ulova, urađena je i analiza brojčanog i masenog udjelavrsta riba u ihtiofauni ovog područja po sezonama istraživanja, a dobiveni rezultati suprikazani u tabeli 3.
Page 65
Korjenić E. i sar: Populacije riba rijeke Požarne Veterinaria 58 (1-2),55-62, Sarajevo 2009.59 Tabela 3. Brojčano i maseno učešće vrsta riba u ihtiofauni rijeke Požarne po sezonama Table 3. Numerical and mass contribution of fish species to total ichthyofauna of Požarna riverSezona ljetoSezona jesenVrstaribaBroj(n)Relativnazastupljenost(%)Masa(g)Masa(%)Broj(n)Relativnazastupljenost(%)Masa(g)Masa(%)Potočnapastrmka4459,46 2.200,00 73,904779,66 2.244,72 83,52Lipljen79,46247,948,3335,09150,005,58Peš2331,08529,00 17,77915,25292,95 10,90Ukupno74100,00 2.976,94 100,0059100,00 2.687,67 100,00 Sezona: ljetoU toku ovog perioda istraživanja izlovljene su 74 jedinke, čija je ihtiomasaiznosila 2.976,94 g. U ovome uzorku, potočna pastrmka je bila najbrojnija vrsta (44jedinke) i čini više od polovine uzorka. Njeno relativno učešće u uzorku je iznosilo 59,46% od ukupno ulovljenih riba. Ihtiomasa potočne pastrmke je bila 2.200,00 g ili 73,90 % od ukupne mase uzorka. Raspon variranja totalne dužine tijela kod potočne pastrmke sekretao od 8,50 do 24,10 cm. Srednja vrijednost ovog karaktera je bila 15,69 cm.Varijaciona širina dužine tijela do osnove repnog peraja potočne pastrmke je iznosila od7,50 do 21,60 cm, sa srednjom vrijednosti 13,96 cm. Raspon variranja mase tijela jeiznosio od 7,00 do 169,00 g, a srednja vrijednost ovog parametra je bila 50,00 g. Analizadobne strukture potočne pastrmke je pokazala da je ova vrsta predstavljena jedinkama od0+ do 3+. Najbrojnije su jedinke u trećoj godini starosti (uzrasna klasa 2+), gdje suevidentirana 23 primjerka (52,28 %). Slijede jedinke druge godine starosti (uzrasne klase1+) sa deset primjeraka (22,72 %) i jedinke iz četvrte godine starosti (uzrasna klasa 3+) sašest primjeraka (13,63 %). Najmanja brojnost ustanovljena je kod jedinki prve godinestarosti (uzrasna klasa 0+), gdje je bilo svega pet primjeraka (11,37 %). Uporedo saanalizom dobne strukture, provedena je i analiza spolne strukture ove vrste. Utvrđeno jeda ženke sa 28 primjeraka (63,63 %) preovladavaju u odnosu na 16 primjeraka mužjaka(36,37 %).U ovom ulovu peš je registrovan sa 23 jedinke ili 31,08 % od ukupnog ulovariba. Ihtiomasa peša je iznosila 529,00 g, što čini 17,77 % od ukupne mase uzorka. Kodpeša totalna dužina tijela je varirala od 9,00 do 13,10 cm, a srednja vrijednost je iznosila11,36 cm. Varijaciona širina dužine tijela do osnove repnog peraja se kretala od 7,30 do11,20 cm (srednja vrijednost: 9,61 cm). Srednja vrijednost mase tijela peša je iznosila23,00 g sa rasponom variranja od 9,00 do 38,00 g.Lipljen je u ovom uzorku bio zastupljen sa svega sedam jedinki ili 9,46 % od ukupno ulovljenih riba. Masa evidentiranih primjeraka lipljena je iznosila 247,94 g ili8,33 % od ukupne mase uzorka. Totalna dužina tijela ulovljenih primjeraka lipljena variraod 14,70 do 17,00 cm (srednja vrijednost: 15,84 cm). Granica variranja dužine tijela doosnove repnog peraja kretala se od 12,65 do 14,60 cm, sa srednjom vrijednosti od 13,69cm. U ulovu su mase tijela lipljena varirale od 27,00 do 40,00 g (prosjek: 35,42 g).
Page 66
Korjenić E. i sar: Populacije riba rijeke Požarne 60Analizom dobne strukture lipljena ustanovili smo da sve analizirane jedinke pripadajuuzrasnoj klasi 1+ . Analizom spolova ustanovljene su četiri ženske (57,14 %) i tri muškejedinke (42,86 %).Sezona: jesenU toku ihtioloških istraživanja u ovom periodu ukupno je ulovljeno 59 jedinki,čija je ihtiomasa iznosila 2.687,67 g. I u ovom periodu istraživanja, najbrojnija je bilapotočna pastrmka sa 47 jedinki ili 79,66 % od ukupno ulovljenih riba. Ihtiomasa potočnepastrmke je iznosila 2.244,72 g, što čini 83,52 % od ukupne mase uzorka. Totalna dužinatijela potočne pastrmke u ovom ulovu se kretala od 9,00 do 25,00 cm (prosjek: 16,50cm). Srednja vrijednost dužine tijela (do osnove repnog peraja) je iznosila 14,65 cm, sagranicom variranja od 7,90 do 22,40 cm. U ovom ulovu, srednja vrijednost mase tijelapotočne pastrmke bila je 47,76 g, sa rasponom variranja od 6,00 do 144,00 g. Ispitivanejedinke potočne pastrmke pripadale su uzrasnim klasama od 0+ do 3+. Analiza uzrasnestrukture potočne pastrmke je pokazala da su najbrojnije jedinke treće godine starosti(uzrasna klasa 2+) sa 22 registrovana primjerka (46,80 %). Druga po brojnosti je uzrasnaklasa 1+ sa evidentiranih 13 primjeraka (27,66 %). Sa sedam primjeraka (14,90 %) slijediuzrasna klasa 3+. Najmanje učešće (brojčano i procentualno) imale su jedinke uzrasneklase 0+ (pet primjeraka ili 10,64 %). Utvrđeni odnos spolova potočne pastrmke ukazujena dominaciju mužjaka u odnosu na ženke u omjeru 41 : 6 ili 87,24 % : 12,76 %.Brojnost peša u ovom uzorku iznosila je svega devet jedinki (15,25 %), što jeniže nego u ljetnom ulovu. Ihtiomasa evidentiranih jedinki peša je iznosila 292,95 g ili10,90 % ukupne ihtiomase uzorka. U ovom ulovu, totalna dužina tijela peša se kretala od11,30 do 14,00 cm (srednja vrijednost: 12,55 cm). Dužina tijela bez repnog peraja jevarirala od 9,70 do 12,10 cm (srednja vrijednost: 10,78 cm). Mase tijela ulovljenihprimjeraka peša su varirale od 24,00 do 44,00 g (srednja vrijednost: 32,55 g).Brojnost lipljena u ovom uzorku bila je svega tri jedinke ili 5,09 % od ukupnoulovljenih riba u uzroku. Masa ulovljenih jedinki lipljena je iznosila svega 150,00 g,odnosno 5,58 % od ukupne mase uzorka. Raspon variranja totalne dužine tijela lipljena sekretao od 8,40 do 22,00 cm (srednja vrijednost: 17,10 cm). Granice variranja dužine tijela(do osnove repnog peraja) su se kretale od 7,20 do 19,30 cm, a srednja vrijednost bila je14,90 cm. Lipljen je u ovom uzorku imao srednju vrijednost mase tijela od 50,00 g, svarijacionom širinom od 3,00 do 89,00 g. Analizom dobne strukture lipljena smokonstatovali da dvije jedinke (66,66 %) pripadaju uzrasnoj klasi 2+, a jedna jedinka(33,34 %) uzrasnoj klasi 3+. Analizirane jedinke bile su muškog spola.
Page 67
Korjenić E. i sar: Populacije riba rijeke Požarne Veterinaria 58 (1-2),55-62, Sarajevo 2009.61 Diskusija Dobiveni podaci u ovom radu o kvalitativno-kvantitativnom sastavuihtiopopulacija se uklapaju u raspoložive literaturne podatke iz različitih planinskihtekućica unutar Bosne i Hercegovine (5, 7, 13, 2 4 i 11). Zaključci Na osnovu rezultata dobijenih tokom ihtiofaunističkih istraživanja rijekePožarne, te utvrđivanja kvalitativne i kvantitativne strukture ihtiopopulacija, moguće jeizvesti nekoliko temeljnih općih zaključaka:1. analizom ukupnog reprezentativnog uzorka konstatovano je da ovo područjenaseljavaju tri vrste riba koje pripadaju porodicama: Salmonidae, Thymallidae iCottidae. Iz porodice Salmonidae evidentirana je potočna pastrmka Salmo truttam. fario Linnaeus 1758., iz porodice Thymallidae registrovan je lipljenThymallus thymallus (Linnaeus 1758), a iz porodice Cottidae evidentiran je pešCottus gobio Linnaeus, 1758.2. u ukupnom uzorku potočna pastrmka je bila najbrojnija (91 jedinka) što čini68,42% od ukupno ulovljenih riba, a najmanju brojnost imale su jedinkelipljena, svega deset registrovanih jedinki, što čini 7,52% od ukupne brojnosti);3. Potočna pstrmka u ukupnom uzorku imala je najveću ihtiomasu u iznosu od4.444 g ili 78,46 % od ukupne mase uzorka. Najmanju vrijednost mase uukupnom uzorku imale su jedinke lipljena (394 g ili 7,03 % od ukupne maseuzorka);4. prisustvo salmonidnih i timalidnih vrsta riba u ovako malom vodotoku rijekePožarne, te na osnovu važećih znastvenih kriterijuma, vode rijeke Požarnepripadaju vodama prve klase boniteta, odnosno, vodama oligosaprobnogkaraktera;5. neophodno je obezbijediti kontinuiranu kontrolu ribljih populacija na područjusliva rijeke Fojnice, uz poduzimanje konkretnih mjera zaštite, a posebnosalmonida i6. potrebno je spriječiti neplansko poribljavanje i unošenje novih vrsta,nekontrolisan ribolov i sve oblike zagađivanja vodotoka. LITERATURA 1. Adrović A. Populacije riba rijeke Gostilje: magistarski rad. Prirodno-matematičkifakultet Univerziteta u Sarajevu, Sarajevo: 2002.
Page 68
Korjenić E. i sar: Populacije riba rijeke Požarne 622. Aganović M, Kapetanović, N. Uzrasna struktura u populacijama nekih vrsta riba izrijeke Neretve. Ichthyologia. 1987; 10 (1): 1-7.3. Korjenić E. Morfološke karakteristike digestivnog trakta kod Alburnus alburnusalburnus iz gornjeg toka rijeke Drine. Veterinaria. 1999;48(1-2):99-110.4. Korjenić E. Ishrana potočne pastrmke-Salmo trutta m. fario Linnaeus, 1758. iz slivarijeke Fojnice. Radovi Poljoprivrednog fakulteta Univerziteta u Sarajevu.2003;XLVIII,(53):19-26.5. Kosorić Đ. Ribe rijeke Rame. Ichthyologia. 1974; 6 (1): 69-78.6. Kosorić Đ, Kapetanović N, Guzina N i sar. Ribarska osnova: za ribolovno područje“Bosna I”. Biološki institut Univerziteta u Sarajevu, Sarajevo: 1983.7. Kosorić Đ, Mikavica D. Populacije riba rijeke Krivaje. Godišnjak Biološkog InstitutaUniverziteta u Sarajevu,1981; 34: 57-71.8. Mikavica D, Sofradžija A, Dizdarević, F. (1991): Ekološko-ihtiološke karakteristikerijeke Drine. Sarajevo: Poljoprivredni fakultet Univerziteta u Sarajevu; 1991.9. Petz B. Osnove statističke metode. Zagreb: SNL; 1984.10. Sofradžija A, Hadžiselimović R, Spahić M i sar. Ribarstveno-gospodarska osnovaOpćine Bihać. Sarajevo: Centar za ihtiologiju i ribarstvo Prirodno-matematičkogfakulteta Univerziteta u Sarajevu; 2002.11. Sofradžija A, Hadžiselimović R, Škrijelj Š. i sar. Ribarstveno-gospodarska osnovaOpćine Gračanica. Sarajevo: Centar za ihtiologiju i ribarstvo Prirodno-matematičkogfakulteta Univerziteta u Sarajevu; 2003. 12. Sofradžija A, Hadžiselimović R, Spahić M i sar. Ribarstveno-gospodarska osnovaOpćine Velika Kladuša. Sarajevo: Centar za ihtiologiju i ribarstvo Prirodno-matematičkog fakulteta Univerziteta u Sarajevu; 2004.13. Sofradžija, A., Vuković, T., Hadžiselimović, R. Ihtiofauna rijeke Mlječanice na širempodručju Banjsko-turističkog centra u Međuvođu (Bosanska Dubica). RibarstvoJugoslavije. 1984;39(2):25-29.14. Škrijelj, R. Stanje populacija riba Jablaničkog jezera: magistarski rad.Prirodnoslovno-matematski fakultet Sveučilišta u Zagrebu, Zagreb: 1991.15. Vuković, T. Ribe Bosne i Hercegovine: Ključ za određivanje. Sarajevo: Svjetlost;1977.Uredništvo primilo rukopis 19.03.2009.
Page 69
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... Veterinaria 58 (1-2),63-76, Sarajevo 2009.63 HEMATOLOŠKI STATUS KLJENA LEUCISCUS CEPHALUS(LINNAEUS, 1758.) IZ RIJEKE KRUPICE I ŽELJEZNICEHEMATOLOGICAL STATUS OF CHUB FISH LEUCISCUS CEPHALUS(LINNAEUS, 1758.) FROM KRUPICA AND ŽELJEZNICA RIVERSMitrašinović Maja, Suljević D.• Abstract – The research comprised 95 individuals Leuciscus cephalus in threedifferent seasons and two different rivers. Analyzed were the hematological parameters inthe chub blood samples, and then compared by region and seasons. We analyzed: red cellcount, white cell count, hematocrit, hemoglobin, and hematological indices (MCV, MCHand MCHC). Statistical data (Microsoft Excel and SPSS 11.5) showed statisticallysignificant results of the white cell count by region and seasons (0.000), red cell count(0.000), hematocrit (0.00) and hematological indices: MCH (0.000) and MCHC (0.000 ).Key words: chub fish, hematological parameters, erythrocytes, leucocytes,hemoglobin.Kratak sadržaj - Istraživanja su obuhvatila 95 jedinki Leuciscus cephalus u trirazličite sezone i dvije različite rijeke. Analizirani su hematološki parametri u krvi kljenai komparirani po lokalitetima i sezonama. Analizirani su: ukupan broj eritrocita ileukocita, hematokrit, hemoglobin i hematološki indeksi (MCV, MCH i MCHC).Statistička obrada podataka (Microsoft Excel i SPSS 11.5) pokazala je statistički značajnerezultate ukupnog broja leukocita po lokalitetima i sezonama (0,000), ukupnog brojaeritrocita (0,000), vrijednosti hematokrita (0,00) i hematoloških indeksa: MCH (0,000) iMCHC (0,000).Ključne riječi: kljen, hematološki parametri, eritrociti, leukociti, hemoglobin Mr. sc. Mitrašinović Maja, biolog, viši asistent,: mitrasinovicmaja@gmail.com; SuljevićDamir, biolog, asistent Odsjek za biologiju, Prirodno-matematički fakultet, Univerzitet u Sarajevu.Mitrašinović Maja, MSc, Biologist, Senior Assistant; Suljević Damir, Biologist,Assistant; Department of Biology, Faculty of Science, University of Sarajevo
Page 70
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... 64 Uvod Fiziologija pruža podatke značajne kako za taksonomiju tako i za ekologiju riba.Definisanje fizioloških karakteristika vrste omogućava razumijevanje funkcionalnihadaptacija vrste na njenu nišu i posebno je značajno u proučavanju blisko srodnih vrsta,odnosno individua iste vrste u različitim uslovima sredine (16).Podaci o vrijednostima određenih fizioloških parametara date vrste doprinosepoznavanju granica variranja ovih parametara u različitim fazama životnog ciklusa, kao iodređivanju normalnih vrijednosti, tipičnih za tu vrstu (15). Treba naglasiti da promjenekoje se javljaju u krvnoj slici riba pri određenim fiziološkim stanjima mogu bitispecifičnog ili nespecifičnog karaktera. Specifične promjene omogućavaju neposrednudijagnostiku datog fiziološkog ili patofiziološkog stanja u organizmu, dok nespecifičnesamo ukazuju na postojanje određenih promjena u organizmu (14). Potrebno je istaći dasvaka vrsta ima svojstvene karakteristike pojedinih hematoloških parametara, tj. broja iveličine eritrocita, te broja i distribucije leukocita (27, 25).Činjenica da se organske vrste u prirodi održavaju pod stalno promjenjivimuslovima okoliša objašnjava se njihovom fiziološkom prilagodbom na promjeneekoloških faktora. Ovaj tip adaptacija označava se fiziološkim adaptacijama. KlasičnaHartova klasifikacija (1962) fizioloških adaptacija je opšte prihvaćena i još i danasvažeća (17). Raspon kolebanja jednog ekološkog faktora, u čijim je granicama mogućopstanak određene organske vrste, naziva se njenom ekološkom valencijom. Veličinaekološke valencije za jedan određeni faktor varira od vrste do vrste, a njezine granicemogu biti ili vrlo široke ili vrlo uske (23).Kod riba svaka promjena sredine izaziva i prouzrokuje određeni fiziološkiodgovor, kojim se pokušava održati ravnoteža unutar određenih granica, odnosno postićiprilagođavanje promjenjivim uslovima ( 21).Promjene kvaliteta vode dovode do značajnih promjena kod riba, što se ogleda uporastu broja i inteziteta bolesti, kao i u samom hematološkom statusu date vrste ribe (1,29). Dugotrajno izlaganje tako izmijenjenim uslovima dovodi do opadanja odbrambenog imunološkog sistema, kao i povećane osjetljivosti organizama (2, 3, 8). Prisustvo nekogod polutanata u vodi takođe dovodi kod riba do određenih promjena krvi koje se moguprikazati preko hematološkog statusa (9, 11). Rano otkrivanje prisutnosti polutanta unekom vodenom ekosistemu može se utvrditi na molekularnoj razini, abnormalnosti tkivai organa ili omogućuje istraživačima pravovremeno poduzimanje mjera koje će spriječitidaljnju degradaciju organizama i životnih zajednice (5, 4, 30). Povećanje onečišćenjaokoliša organizmi uspijevaju savladati bez nekih značajnih metaboličkih oštećenja.Međutim, kod viših koncentracija polutanata velika su biohemijska ili fiziološkaoštećenja organizama koja niti jedan mehanizam nije u stanju popraviti. Kod još višihkoncentracija dolazi do uginuća organizma (28). Praćenje hematoloških parametaraomogućuje brzu detekciju promjena stanja kod riba, jer se narušavanje hematološkogstatusa pojavljuje veoma brzo i prethodi promjenama u ponašanju kao i oštećenjima.Brzina toksičnih efekata, uzrokovana teškim metalima povezana je s transportnom
Page 71
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... Veterinaria 58 (1-2),63-76, Sarajevo 2009.65funkcijom krvi, pri čemu krv distribuira metale u sve dijelove tijela (10). Kao polazneciljeve ovoga rada postavili smo utvrđivanje hematološkog statusa kljena na različitimlokalitetima i u različitim sezonama, kao i utjecaj fizičko-hemijskih osobina vode(kvaliteta) na zdravstveno stanje ovih populacija. Materijal i metode Proučavanje hematološkog statusa urađeno je na vrsti Leuciscus cephalus(Linnaeus, 1758.). Prema savremenim shvatanjima vrsta Leuciscus cephalus L. jesvrstana u rod Squalius, tako da je njen novi naziv Squalius cephalus (Linnaeus, 1758.)(22). U istraživanjima su obuhvaćene rijeke Krupica i Željeznica. Krupica (N 43035' 50";E 19021'40") je tekućica sa dužinom vodotoka od 850metara. Izdašnost izvora Krupice je mjerena u više uzastopnih godina, i u periodu suše iminimalnih vodostaja je izmjerena količina od oko 350 litara u sekundi. Maksimalnoizmjereni protok je bio oko 600 litara u sekundi. Mjerenja u septembru 2003. godine,uprkos izuzetnoj suši pokazala su protok od oko 400 litara u sekundi. Spada u umjerenotermalne i blago mineralizovane vode. Željeznica (N 43048'55"; E 18017 '35") nastaje od Hrasničkog i Godinjskogpotoka, koji izviru na planini Treskavici (2.088 m), a sastaju se kod sela Turova. Ušćerijeke Željeznice u Bosnu leži nasuprot selu Osijeku, na zapadu Sarajevskog polja.Dužina rijeke Željeznice od izvora do ušća u rijeku Bosnu je 26,9 kilometara.Željeznica čitavim svojim tokom protiče kroz najnaseljenija i industrijski vrlo razvijenuregiju Bosne i Hercegovine - Sarajevsku regiju. Na rijeci se nalazi hidrocentrala Bogatić,s instaliranom snagom od 6,5 MW, koja je sagrađena nekoliko godina poslije krajaDrugog svjetskog rata. ElektroribolovRibe, korištene u radu, lovljene su pomoću monofaznog elektroagregata snage 1kW. Ovakav ribolov ne dovodi do uginuća ribe, već do galvanonarkoze, a pokazao seveoma dobrim za hematološka proučavanja, s obzirom da izaziva samo kratkotrajni stres,nakon kojeg se riba brzo oporavlja. Hematološke metodePunkcija srcaUzimanje krvi za hematološke analize vršeno je punktiranjem srca oštrom iširokom sterilnom iglom (1,0 do 1,2 mm). Prilikom uzimanja krvi vršena je dezinfekcijamjesta uboda, a prilikom punktiranja primijenjena su sva pravila sterilnog rada. Nativnakrv bez dodatka antikoagulacionog sredstva koristila se za dalju analizu.Određivanje broja eritrocitaOdređivanje broja eritrocita izršeno je postupkom brojanja u hemocitometrumetodom Kekića i Ivanca (20). Ovaj postupak zahtijeva korišćenje melanžera
Page 72
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... 66(prilagođene pipete za brojanje eritrocita) i odgovarajućih rastvora za razblaženje ibojenje krvnih ćelija. Broj eritrocita izražen je u terama na litar (1012).Određivanje koncentracije hemoglobinaOdređivanje koncentracije hemoglobina vršeno je Drabkinovom hemiglobincijanidskom metodom (7, 18). Korišten je Drabkinov reagens, pomoću kojeg jehemoglobin preveden u hemiglobin-cijanid, čija je ekstinkcija (absorbancija) očitana nakolorimetru pri talasnoj dužini od 546 nm.Određivanje hematokritaHematokrit je određen centrifugiranjem korištenjem mikrohematokrit centrifuge, pri brziniod 16. 000 obrtaja u minuti. Krv u cjevčice je uzimana u oko 2/3 njene dužine, dok su prijeupotrebe cjevčice bile heparinizirane kako bi se izbjegla koagulacija krvi. Da bi se izbjeglocurenje krvi jedna strana cjevčica je zatvorena kitom (26, 12, 13).Hematološki indeksiSrednja vrijednost zapremine eritrocita (MCV)Ova vrijednost se može dobiti pomoću sljedeće formule: leritrocitaBrHctMCV/.= Rezultat se izražava u femtolitrima (fl).Srednja vrijednost količine hemoglobina u eritrocitu (MCH)Ovaj indeks daje prosječnu količinu hemoglobina u jednom eritrocitu i izražava se u pg. leritrocitaBrlHbMCH/./= Srednja vrijednost hemoglobina u litri eritrocita (MCHC)MCHC pokazuje koncentraciju hemoglobina u jednoj litri eritrocita, ili odnos izmeđumasene vrijednosti hemoglobina i određene zapremine eritrocita.Ova vrijednost se može dobiti pomoću sljedeće formule: HctlHbMCHC/= Statistička obrada podataka Svi rezultati istraživanja su obrađeni metodama deskriptivne i analitičke statistike (24, 6),uz primjenu statističkih programa SPSS 11.5 i Microsoft Excel. Rezultati Fizičko-hemijske karakteristike vode KrupiceRijeka Krupica spada u kalcijum bikarbonatnu vodu, blago kiselu i tvrdu. Nepostoji organsko zagađenje niti povećane količine nutrijensa. Malo povećana količinabakra ne bi se smjela uzimati za ozbiljan nalaz na osnovu samo jedne analize. Postojismanjena količina rastvorenog kiseonika, a time i zasićenje kiseonikom ove vode kaojedini parametar koji nije u granicama za I klasu (on je u granici predviđenoj za III klasupovršinskih voda).
Page 73
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... Veterinaria 58 (1-2),63-76, Sarajevo 2009.67Fizičko-hemijske karakteristike vode ŽeljezniceNa osnovu sprovedenih fizičko-hemijskih i mikrobioloških istraživanja rijekeŽeljeznice u periodu od oktobra 2005. do marta 2007. godine, možemo zaključiti da jevoda u rijeci Željeznici (kao većina voda u našoj zemlji) kalcij-bikarbonatna, blagoalkalna (u jednom slučaju je čak i kisela). Provodljivost i tvrdoća jako variraju(vjerovatno zbog jakog antropogenog uticaja), ali su i dalje u granicama predviđenim za Iili II klasu (I i V serija, provodljivost veća od 400 μS/cm). Izvori zagađenja atmosfere ipovršinskih voda su: industrija boja, baterija, aditiva, konzervisanja hrane, olovne cijevi iispušni gasovi motornih vozila koji sadržavaju proizvode razgradnje tetraetilolova.Praćeni parametri kljena iz rijeke Krupice i ŽeljezniceIstraživanje kljena iz rijeke Krupice i Željeznice obuhvatalo je praćenjeosnovnih hematoloških karakteristika: koncentracija hemoglobina, hematokrit, brojeritrocita, prosječna zapremina eritrocita (MCV), srednja vrijednost količine hemoglobinapo eritrocitu (MCH), srednja vrijednost količine hemoglobina po litri eritrocita (MCHC) ibroj leukocita. Tabela 1. Hematološki parametri kljena iz rijeke KrupiceTable 1. Hematological parameters of chub fish from the Krupica rivern=42Hb(g/ l)Hct(l/l)Brojeritrocita(1012/L)MCV(fl)MCH(pg)MCHC(g/l)Brojleukocita(109/L) Srednjavrijednost 81,580,3821,404285,465 61,005221,101 4,258 Standardnadevijacija 10,450,0682,90245,89618,45350,8552,016 Kurtozis 2,110,230-0,831,4520,4780,3471,58 Skjunis 1,40-0,832-0,540,1061,3241,1021,53 Minimalnavrijednost 66,670,2088,640153,571 43,554159,682 2,300 Maksimalnavrijednost 111,340,48719,300411,538 106,692 358,077 10,700 Koeficijentvariranja 12,8117,8320,6616,0730,2423,0047,34 Iz rijeke Krupice analizirane su 42 jedinke kljena, a rezultati istraživanjapredstavljeni su u tab. 1. Na osnovu dobivenih vrijednosti mogu se uočiti veoma izraženaindividualna variranja navedenih parametara, a na što ukazuje visok koeficijent variranja,posebno kada su u pitanju vrijednosti ukupnog broja leukocita i eritrocita. Visokkoeficijent variranja hematoloških indeksa posljedica je individualnih vrijednosti brojaeritrocita i koncentracije hemoglobina.
Page 74
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... 68 Tabela 2. Test normaliteta raspodjele hematoloških parametara kljena iz rijeke KrupiceTable 2. Normality test distribution of hematological parameters of the chub fish in the Krupicariver Shapiro-Wilk Test značajnostiStatisticdfSig.Broj eritrocita.92142.007Hematokrit.93941.030Hemoglobin.85441.000MCV.96441.215MCH.77941.000MCHC.87741.000Broj leukocita.77442.000 Tabela 3. Pregled hematoloških parametara kljena iz rijeke Krupice po sezonama (I-proljeće, II-ljeto, III-zima)Table 3. Overview of hematological parameters of the chub fish in the Krupica river by season (I-spring, II- summer, III-winter) ParametriSEZONASrednja vrijednostStandardna devijacijaI81,1228,95II76,234,68Hb (g/ l)III81,5484,452I0,2950,113II0,3910,06Hct (l/l)III0,4220,025I1,0361,628 x 1011II1,5561,193 x 1011Broj eritrocita (1012/L)III1,5821,662 x 1011I310,0548,54II281,6749,23MCV (fl)III269,3433,26I86,2114,62II49,173,96MCH (pg )III51,894,11I281,3948,80II198,5230,85MCHC (g/ l)III193,9514,78I3,1624,950 x 108II3,1504,776 x 108Broj leukocita (109/L )III6,2432,217 x 108 Na osnovu navedenih vrijednosti skjunisa i kurtosisa iz prethodne tabele za svakiod praćenih parametara, te na osnovu provedenog Shapiro-Wilkovog testa normalitetaraspodjele (tab. 2) može se zaključiti da većina parametara ima značajno odstupanje odnormalne raspodjele. Prema provedenom testu raspodjele koja ne odstupa od normalne,konstatovana je za vrijednosti MCV.
Page 75
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... Veterinaria 58 (1-2),63-76, Sarajevo 2009.69Vrijednosti ispitivanih parametara u krvi kljena po sezonama prikazani su u tab. 3.Vrijednosti hematokrita i ukupnog broja eritrocita rastu od proljeća do jeseni, dok suvrijednosti koncentracije hemoglobina niže u ljetnom periodu, a u periodu proljeća i zimese ne mijenjaju. Veoma izražena variranja hematoloških parametara konstatovana su zavrijednosti ukupnog broja leukocita koji bilježe veliki rast u periodu zime. Vrijednostihematoloških parametara padaju od proljeća do jeseni, a što je razumljivo zbog manjegbroja eritrocita konstatovanog u periodu proljeća. Osnovna statistička obrada hematoloških parametara kljena iz rijeke Željezniceprikazana je u tabeli 4. Tabela 4. Hematološki parametri kljena iz rijeke ŽeljezniceTable 4. Hematological parameters of the chub fish in the Zeljeznica rivern=53Hb(g/ l)Hct(l/l)Broj eritrocita(1012/L)MCV(fl)MCH(pg)MCHC(g/l)Brojleukocita(109/L)Srednjavrijednost75,60 0,3761,315 288,072 58,901 216,93822,23Standardnadevijacija12,03 0,0901,918 x 101165,9228,11868,9416,541Kurtozis2,80 0,694-0,725,6212,39421,9700,08Skjunis-1,260,170,051,13-0,113,830,94Minimalnavrijednost34,96 0,1339,600 x 101188,300 35,13694,8331,225Maksimalnavrijednost94,36 0,6001,710 545,455 79,063 617,40037,200Koeficijentvariranja15,91 23,99614,59222,884 13,78231,77929,430Tabela 5. Test normaliteta raspodjele hematoloških parametara kljena iz rijeke ŽeljezniceTable 5. Normality test distribution of hematological parameters of the chub fish in the ŽeljeznicariverShapiro-Wilk Test značajnostiStatisticdfSig.Broj eritrocita.92142.007Hematokrit.93941.030Hemoglobin.85441.000MCV.96441.215MCH.77941.000MCHC.87741.000Broj leukocita.77442.000 Vrijednosti hemoglobina u rijeci Željeznici, tokom cijele godine, ispitivane naukupno 53 jedinke, kretale su se u dijapazonu od 34,96 do 94,36 g/l, a srednja vrijednost
Page 76
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... 70je iznosila 75,60 g/l. Najveće vrijednosti su zabilježene u sezoni proljeće (94,36 g/l), anajniže u sezoni ljeto (34,96 g/l). U ovom slučaju također se uočavaju velike razlikepojedinačnih vrijednosti u ukupnom broju leukocita, a što pokazuje veoma visokkoeficijent variranja.Provedeni test normaliteta (tab.5) raspodjele po sezonama pokazuje neštodrugačije rezultate, pri čemu je statistički značajno odstupanje od normalne raspodjelekonstatovano samo u slučaju broja eritrocita u proljetnom aspektu, kao i u slučajukoncentracije hemoglobina u ljetnom periodu, dok ostali praćeni parametri po sezonamane pokazuju značajna odstupanja. Tabela 6. Pregled hematoloških parametara kljena iz rijeke Željeznice po sezonama (I-proljeće, II-ljeto, III-zima)Table 6. Overview of hematological parameters of the chub fish in the Željeznica river by season(I-spring, II- summer, III-winter) ParametriSEZONASrednja vrijednostStandardna devijacijaI75,3215,25II74,8512,40Hb (g/ l)III76,888,15I0,3490,114II0,3630,061Hct (l/l)III0,4200,09I1,3152,292II1,2891,873Broj eritrocita (1012/L)III1,3531,652I280,961106,943II287,35247,129MCV (fl)III295,7236,10I58,43810,609II59,1068,680MCH (pg )III59,054,27I242,846118,245II211,36634,037MCHC (g/ l)III200,3128,16I2,090 x 10106,815II2,280 x 10107,719Broj leukocita (109/L )III2,265 x 10104,368 Na osnovu dobivenih vrijednosti za koncentraciju hemoglobina kod jedinkikljena iz rijeke Željeznice (tab. 6) može se konstatovati da nema sezonskih fluktuacijakoncentracije hemoglobina. Vrijednosti ukupnog broja leukocita pokazuju značajan rastod proljeća do zime, dok su vrijednosti eritrocita smanjene u ljetnom periodu, a povećaneu zimskom.Vrijednosti hematokrita značajnu razliku pokazuju u poređenju proljetnog izimskog aspekta (p ≤ 0,026) i ljetnog i zimskog aspekta (p ≤ 0,047), pri čemu su najvećevrijednosti hematokrita konstatovane u zimskom aspektu.
Page 77
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... Veterinaria 58 (1-2),63-76, Sarajevo 2009.71Vrijednosti ostalih hematoloških parametara ne pokazuju značajne statističkerazlike u poređenju po sezonama.Poređenje nalaza u rijekama po sezonama Tabela 7. Pregled hematoloških parametara kljena iz rijeke Željeznice i Krupice po sezonama (I-proljeće, II- ljeto, III-zima)Table 7. Overview of hematological parameters of the chub fish from the Krupica and Željeznicariver by season (I-spring, II- summer, III-winter)KrupicaŽeljeznicaParametriSEZONASrednja vrijednostI81,1275,32II76,2374,85Hb (g/ l)III81,5476,88I0,2950,349II0,3910,363Hct (l/l)III0,4220,420I1,0361,315II1,5561,289Broj eritrocita (1012/L)III1,5821,353I310,05280,96II281,67287,35MCV (fl)III269,34295,7I86,2158,43II49,1759,10MCH (pg )III51,8959,05I281,39242,84II198,52211,36MCHC (g/ l)III193,95200,31I3,1620,90 II3,1522,80 Broj leukocita (109/L )III6,2422,65
Page 78
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... 72 Hemoglobin 75,681,58KrupicaŽeljeznica Leukociti 4,2622,22KrupicaŽeljeznica Grafikon 1. Odnos srednjih vrijednosti koncentracije hemoglobina i ukupnih leukocitaGraph 1. Relation between mean values of hemoglobin concentration and total white cell count Na grafikonu su predstavljene vrijednosti honcentracije hemoglobina i ukupnogbroja leukocita kao najznačajnije razlike među posmatranim parametrima komparirajućioba vodotoka. Jedinke kljena iz Krupice imaju veće vrijednosti hemoglobina, dok jedinkeiz Željeznice imaju veoma povećan broja ukupnih leukocita u ukupnom uzorku. Diskusija U tabeli 7. predstavljene su vrijednosti hematoloških istraživanja u krvi kljenatokom sve tri sezone. Koncentracija hemoglobina kretala se u toku cijele godine udijapazonu od 66,67 do 111,34, a srednja vrijednost je iznosila 81,58 g/l. Najvišepojedinačne vrijednosti su bile zastupljene u proljeće. Ova konstatacija se ne uklapa uistraživanja Kekića (19), jer su kod njegovih istraživanja najniže vrijednosti hemoglobinabile u ljeto. Na osnovu koeficijenta variranja mogu se uočiti velike individualne razlike ubroju leukocita.Hematološki parametri kljena iz rijeke KrupiceSrednje vrijednosti broja eritrocita pokazuju značajnu razliku proljeće i ljeto (p= 0,000), kao i u proljeće i jesen (p = 0,000), pri čemu je najmanja vrijednost brojaeritrocita konstatovana u proljeće.Vrijednosti hematokrita pokazuju značajnu razliku u poređenju vrijednosti izproljetne i ljetne sezone (p = 0,000), kao i proljetne i zimske (p ≤ 0,004). Najmanjavrijednost hematokrita konstatovana u proljeće, a najveća u zimu. Značajna razlika (p ≤0,004) u vrijednostima koncentracije hemoglobina konstatovana je u poređenjuvrijednosti iz proljetnog i ljetnog perioda sa većim proljetnim vrijednostima. Prosječnazapremina eritrocita značajnu razliku pokazuje u poređenju vrijednosti dobijenih u
Page 79
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... Veterinaria 58 (1-2),63-76, Sarajevo 2009.73proljeće sa vrijednostima iz zimskog perioda (p ≤ 0,021). Poređenje vrijednosti MCHpokazuje značajnu razliku između proljetnog i zimskog perioda (p = 0,000) i proljetnog iljetnog aspekta (p = 0,000) sa najnižom vrijednošću (43, 550 pg) u ljetnom periodu.Vrijednosti MCHC značajnu razliku pokazuju u poređenju s vrijednostima iz proljeća iljeta (p = 0,000), kao i vrijednosti iz proljeća i zime (p = 0,000), pri čemu su najvećevrijednosti konstatovane u proljetnom periodu. Vrijednosti broja leukocita značajnurazliku (p = 0,000) pokazuju u poređenju s vrijednostima iz proljetnog i zimskog aspekta. Poređenje rijeka u ukupnom uzorkuPoređenje hematoloških parametara kljena iz vodotoka Krupica i Željeznicapokazuje postojanje značajnih razlika u vrijednostima koncentracije hemoglobina (p ≤0,012) i broja leukocita (p= 0,000), pri čemu su veće vrijednosti koncentracijehemoglobina konstatovane kod jedinki iz rijeke Krupice, dok su jedinke iz rijekeŽeljeznice imale značajno veće vrijednosti broja leukocita. Kod ostalih praćenihhematoloških parametara nisu konstatovane značajne razlike u poređenju s jedinkama izdva vodotoka.ProljećeKomparacija dobijenih rezultata po sezonskim aspektima pokazuje postojanjeznačajne razlike u poređenju vrijednosti između dva vodotoka iz sezonskog aspekta.Statistički značajno veće vrijednosti (p= 0,000) broja leukocita konstatovane sukod jedinki kljena iz rijeke Željeznice, a značajno veće vrijednosti (p= 0,001) kod ovihjedinki utvrđene su i u slučaju broja eritrocita. Veće vrijednosti MCH (p= 0,000), uproljetnom aspektu konstatovane su kod jedinki iz rijeke Krupice. Jedinke iz rijekeKrupice imale su i veće vrijednosti koncentracije hemoglobina, sa razlikom blizu granicestatističke značajnosti (p ≤ 0,053). Ostali praćeni hematološki parametri ne pokazujuznačajnu razliku u poređenju navedenih rijeka u proljetnom aspektu.LjetoJedinke iz rijeke Krupice imale su značajno veće (p=0,000) vrijednosti brojaeritrocita, dok su jedinke iz rijeke Željeznice imale značajno veći broj leukocita (p=0,000) i vrijednosti MCH (p< 0,010). Ostali parametri ne pokazuju značajne razlike.ZimaJedinke iz rijeke Krupice imale su i značajno veće vrijednosti broja eritrocita (p<0,001), dok su kod jedinki iz rijeke Željeznice konstatovane značajno veće vrijednostiMCV (p< 0,047), vrijednosti MCH (p=0,000) i broja leukocita (p=0,000).
Page 80
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... 74 Zaključci Istraživan je hematološki status kljena iz rijeke Krupice i Željeznice1. Kod kljena iz rijeke Željeznice konstatovan je veći broj leukocita (p=0,000), doksu kod kljena iz rijeke Krupice prisutne veće vrijednosti koncentracijehemoglobina (p≤ 0,012). Kod ostalih praćenih hematoloških parametara(hematokrit, broj eritrocita, prosječna zapremina eritrocita (MCV), srednjavrijednost količine hemoglobina po eritrocitu (MCH) i srednja vrijednostkoličine hemoglobina po litri eritrocita (MCHC), nisu konstatovane značajnerazlike kod kljena iz dva različita vodotoka.2. Konstatovano je i postojanje sezonskih variranja hematoloških parametara kodproučavanih kljenova iz oba vodotoka. U rijeci Krupici u proljetnom perioduuočene su najmanje vrijednosti hematokrita, koncentracije hemoglobina ivrijednosti broja eritrocita, dok je vrijednost MCHC bila najveća. 3. U rijeci Željeznici kljen ima najveće vrijednosti hematokrita konstatovane uproljetnom periodu. Vrijednosti ostalih hematoloških parametara kljena iz rijekeŽeljeznice ne pokazuju značajne razlike u poređenju po sezonama.4. Kada se porede hematološki parametri kljena iz jednog i drugog vodotoka u istojsezoni, konstatovano je postojanje sezonskih variranja hematoloških parametarakljena iz oba vodotoka. Kod kljena iz rijeke Željeznice u proljeće zabilježene sustatistički značajno veće vrijednosti broja leukocita i broja eritrocita. U rijeciKrupici statistički je značajna razlika MCH u proljetnom periodu. 5. U ljetnom periodu komparacija dobijenih rezultata za jedinke kljena izistraživanih rijeka pokazuju postojanje značajnih razlika u vrijednostima brojaleukocita i vrijednosti MCH. Jedinke iz rijeke Krupice u ljetnom periodu imalesu značajno veće vrijednosti broja eritrocita.6. U zimskom periodu vrijednosti broja eritrocita pokazuju statistički značajnurazliku, u poređenju dvije rijeke, pri čemu su veće vrijednosti utvrđene kodjedinki iz rijeke Krupice, dok je kod jedinki iz rijeke Željeznice konstatovanaznačajno veća vrijednost MCV, MCH i broja leukocita. LITERATURA1. Amend DF and Smith L. Pathophysiology of infectious hematopoietic necrosisvirus disease in rainbow trout (Salmo gairdneri): early changes in blood andaspects of the immune response after injection of IHN virus. Journal of theFisheries Research Board of Canada. 1974; 27: 265-270.2. Anderson DP. Immunological indicators: effects of environmental stress onimune protection and disease outbreaks. American Fisheries SocietySymposium. 1990; 8: 38-50.
Page 81
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... Veterinaria 58 (1-2),63-76, Sarajevo 2009.753. Arkoosh MR, Casillas E., McCain B. and Varanasi U. Suppression ofimmunological memory in juvenile chinook salmon (Oncorhynchus tsawytscha)from an urban estuary. Fish & Shellfish Immunology. 1991; 1: 261-277.4. Barton BA and Iwama GK. Physiological changes in fish from stress inaquaculture with emphasis on the response and effects of corticosteroids.Annual Review of Fish Diseases. 1991; 1: 3-26.5. Beitinger TL and McCauley WR. Whole animal physiological processes for theassessment of stress in fishes. Journal of Great Lakes Research. 1990; 16: 542-575.6. Blažić RM i Dragović V. Opšta statistika. Osnovi i analiza. „Savremenaadministracija”izdavačko-štamparsko-knjižarska radna organizacija, Beograd.19887. Blaxhall PC and Daisly KW. Routine hematological methods for use with fishbloоd. J. Fish. Biol. 1973; 5:771-781.8. Cross ML and Mathews RA. Ichthyophthiriasis in carp, Cyprinus carpio L. -fate of parasites in immunized fish. J. Fish diseases. 1992; 15, 6:497-505.9. Durand JD, Unlu E, Doadrio I, Pipoyan S, and Templeton AR. Origin, radiation,dispersion and allopatric hybridization in the chub Leuciscus cephalus.; Proc BiolSci. 2000; 22; 267 (1453): 1687-97.10. Fijan N. Zaštita zdravlja riba. Poljoprivredni fakultet u Osijeku. 2006.11. Guerriero G. Seasonal steroids variations and maturity stages in the female chub,Leuciscus cephalus L. (Pisces, Cyprinidae). Italian Journal of Zoology. 2007.12. Heckner F. Praktikum der mikroskopischen Haematologie. Urban undSchwarzenber, Muenchen, Wien, Baltimore. 1975.13. Hasković E, Ivanc A, Mitrašinović M. Autorizovana skripta „Uporednafiziologija životinja i čovjeka“, Univerzitet u Sarajevu, Prirodno-matematičkifakultet, Odsjek za biologiju. 2006.14. Ivanc A, i Jeremić S. Hematološki status u dijagnostici oboljenja riba. Umonografiji "Zaštita životne sredine pri intenzivnom gajenju riba", Univerzitet uNovom Sadu, Prirodno-matematički fakultet, Institut za biologiju, Ekološki pokretgrada Novog Sada Urednici: Smiljka Šimić i Aleksandar Ivanc, Novi Sad. 1999;86-95. 15. Ivanc A, i Miljanović B. Hidroakumulacije, Multidisciplinovani pristupodrživom razvoju, Monografija, Prirodno-matematički fakultet Novi Sad,Ministarstvo za zaštitu prirodnih bogatstava i životne sredine, Zavod za zaštituzdravlja "Timok" Zaječar, JVP "Vode Srbije", JVP "Vode Vojvodine" Novi Sad.2003.16. Ivanc A, Hasković E, Jeremić S, Dekić R. Hematological Evaluation of welfareand health of fish. Praxis veterinaria. 2005; 53 (3) 191-202.17. Ivanc A, Hasković E, Dekić R, Sarić M. Mehanizmi fizioloških adaptacija. Prvisimpozijum biologa Republike Srpske. Banjaluka, Novembar 2005. Knjigaplenarnih referata i saopštenja. 2006; 120-137.
Page 82
Mitrašinović Maja i sar.: Hematološki status kljena Leuciscus cephalus (Linnaeus, 1758.) iz ... 7618. Ivanc A, Hasković E, Mitrašinović M. Autorizovana skripta „Opšta fiziologijaživotinja i čovjeka“, Univerzitet u Sarajevu, Prirodno-matematički fakultet,Odsjek za biologiju; WUS Austria. 2007.19. Kekić H. Sezonske oscilacije broja eritrocita i koncentracije hemoglobina u krviklena (Leuciscus cephalus L.) iz srednjeg toka rijeke Željeznice. 1967.20. Kekić H, i Ivanc A. A new direct method for counting fish blood cells.Ichtyologia. 1972; 14, 1: 55.21. Kirin D. Ecological Study of the Intestinal Helminth Communities of Leuciscuscephalus (L., 1758) and Appraisal of the Conditions of the Studied FreshwaterEcosystems from the Chepelarska River, Bulgaria. Acta zool. bulg. 2002; 54 (2),73-85.22. Lelo S. Fauna Bosne i Hercegovine, Biosistematski pregledi, Udruženje zainventarizaciju i zaštitu životinja Ilijaš, Kanton Sarajevo, Federacija Bosne iHercegovine, Bosna i Hercegovina. 2007.23. Maguran A. Ecological diversity and its measurement. Princeton, PrincetonUniversity. 1988; Press, 189p.24. Petz B. Osnovne statističke metode. Izdavački zavod JAZU, Zagreb. 1974.25. Rambhaskar B, & Srinivasa RK. Comparative haematology of ten species ofmarine fish from Visakhapatnam coast. J. Fish. Biol. 1987; 30: 59-66.26. Richterich R. Klinische Chemie. S. Karger, Basel-Muenchen-Paris-London-NewYork-Sydney. 1971.27. Romestand B, Halsband E, Bragoni G, Knežević B, Marić D, & Prochnow F.Etude hematologique comparé des constantes erythrocytaires de quelquespoissons marins et d'eaux douces. Rev. Trav. Inst. Pech. marit. 1983; 46: 147-156.28. Yilmaz F, Ozdemir N, Demirak A, and Levent TA. Heavy matal levels in twofish species Leuciscus cephalus and Lepomis gibbosus. 2005.29. Wedemeyer GA. Physiology of fish in intensive culture system. InternationalThomson Publishing, Japan. 1996.30. Witeska M. Stress in fish-hematological and immunological effects of heavymetals, Electronic Journal of Ichthyology. 2005;1: 35-4135.Uredništvo primilo rukopis 27.04.2009.
Page 83
Korjenić E. i sar.: Brojnost populacije divokoze - Rupicarpa rupicarpa (Linnaé) u planinskom ... Veterinaria 58 (1-2),77-81, Sarajevo 2009.77 BROJNOST POPULACIJE DIVOKOZE – Rupicarpa rupicarpa (Linnaé)U PLANINSKOM KOMPLEKSU DIVE GRABOVICEPOPULATION SIZE OF CHAMOIS – Rupicarpa rupicarpa (Linnaé) INDIVA GRABOVICA MOUNTAIN CHAINKorjenić E., Džano A., Šuta N.• Abstract - Field work research of the Chamois (Rupicarpa rupicarpa) in theDiva Grabovica mountain chain was conducted from January, 2007 until January, 2008.In this period, the research was conducted during all four seasons. In research, a relative-count method was used, based on the estimation of the number of the Chamois in thearea.In the investigated area, about 30 specimens of the Chamois were assessed, 15females (50,0%), 5 males (16,7%), and 10 juveniles (33,3 %). In addition to the counting,a visual analysis of the stools was performed rendering nutritional information about theChamois. It was established that the food was mostly represented by all types of themountain herbs and grass, and also the leaves, buds and green branches of the mountaintrees. In the winter time, the Chamois also eat lichen, moss, bark, and different pineleaves.Key words: Chamois, male, female, juvenile, Diva Grabovica, Kratak sadržaj - Terenska istraživanja aktuelnog stanja divokoze (Rupicaprarupicapra) u planinskom kompleksu Dive Grabovice trajala su od januara 2007. dojanuara 2008. godine. U navedenom periodu istraživanja su obavljana tokom sva četirigodišnja doba. Na analiziranom području, u cilju istraživanja, korištena je metodarelativne brojnosti, koja se zasniva na procjeni brojnosti divljači na nekom prostoru.Na istraživanom području procijenjeno je oko 30 jedinki divokoze, od čega jebilo 15 ženki divokoza (50,0%), 5 mužjaka divojaraca (16,7%) i 10 mladih jaradi • Dr.sc. Korjenić Enad, biolog; docent, Džano Adil, student; Šuta Nedim, student,Prirodno-matematički fakultet, Univerzitet u SarajevuRad je predstavljen na VI Simpoziju poljoprivrede, veterinarstva, šumarstva ibiotehnologije, održanom u Goraždu od 23 do 25.10.2008.Korjenić Enad, PhD, Biologist; Associate Professor, Džindo Adil, Student; Šuta Nedim,Student, Faculty of Science, University of SarajevoThe work was presented at the VI Symposium of Agriculture, Veterinary, Forestry andBiotechnology held in Goražde, October 23-25, 2008
Page 84
Korjenić E. i sar.: Brojnost populacije divokoze - Rupicarpa rupicarpa (Linnaé) u planinskom... 78(33,3%). Pored brojnosti, na istraživanom području, vizuelnim pregledom izmeta jedinki,došlo se do osnovnih podataka o ishrani divokoza. Utvrđeno je da im glavninu ishranepredstavljaju sve vrste planinskog bilja i trava te lišće, pupovi i mladi izbojci planinskogdrveća, a u zimskom periodu jedinke divokoze su se hranile i lišajem, mahovinom, koromi iglicama četinara. Ključne riječi: divokoza, divojarac, jarad, Diva Grabovica Uvod Divokoza ima veoma kvalitetno meso, fine strukture, koje je vrlo ukusno, te jeza njim velika potražnja. Neistraženost populacije divokoze u poslijeratnom periodu (od1996. godina pa nadalje) bio je temeljni razlog za istraživanje aktualnog stanja brojnostidivokoze, te strukture ishrane ove životinje u planinskom kompleksu Dive Grabovice. Uzto, pretpostavljamo da dobiveni podaci iz ovog rada mogu poslužiti i kao dobra osnova zadaljnja istraživanja i unapređenje uzgoja divokoze u ovom lovištu. Materijal i metode Terenska istraživanja aktualnog brojnog stanja divokoze u planinskomkompleksu Dive Grabovice trajalu su od januara 2007. do januara 2008. godine. Unavedenom periodu istraživanja su obavljana tokom sva četiri godišnja doba. Naistraživanom području korištena je metoda relativne brojnosti. Slika 1. Istraživano područje Dive GraboviceFigure 1. Investigated area of Diva Grabovica Metoda relativne brojnosti se zasniva na principu odnosa broja tragova divljačiprema broju prisutne divljači u lovištu, a koristi se uglavnom za procjenu brojnostidivljači na nekom prostoru. Kao indeks brojnosti određene vrste divljači obično se uzima
Page 85
Korjenić E. i sar.: Brojnost populacije divokoze - Rupicarpa rupicarpa (Linnaé) u planinskom ... Veterinaria 58 (1-2),77-81, Sarajevo 2009.79broj presijecanja putanje koju pređe lice koje vrši brojanje, sa brojem tragova određenevrste divljači. Osnovni uslov za primjenu ove metode u zimskom periodu je sniježniprekrivač, 24 sata bez novih padavina, te tragovi na zemljištu u ostalim godišnjimdobima. Registruje se svako ukrštanje traga određene vrste divljači sa putanjom kroz kojuprolazi brojač, bez obzira da li se radi o istom primjerku. Dužina putanje treba da jenajmanje 10 km i da ide u pravoj liniji kroz određeni dio lovišta.U svrhu pravilne procjene brojnosti u istraživanom području Dive Grabovice,zbog nepristupačnosti terena, prebrojavanje divljači (divokoze) vršeno je u tri jednakadijela unutar ovog lovišta (cca 10 km x 1,5 km). U svakom dijelu prebrojavanje je vršenoistovremeno i vršili su ga po jedan brojač i jedan pomagač. Istraživanja brojnostidivokoze u ovom dijelu Dive Grabovice najintenzivnija su bila u februaru, martu i aprilu.U navedenim mjesecima su se svaki peti dan u sva tri dijela ovog lovišta istovremenovršila prebrojavanja divljači, a u ostalim mjesecima jednom. U ljetnom periodu su u svatri navedena dijela lovišta istovremeno vršena i vizuelna osmatranja dvogledom.U svakom godišnjem dobu sa istraživanih dijelova lovišta uzimani su i uzorciizmeta divokoza (po pet uzoraka) čiji je sastav u laboratoriju podvrgavan makroskopskoji mikroskopskoj analizi.U toku istraživanja u opažajni list je upisivan broj presijecanja putanje kretanjaispitivača s brojem tragova divokoze. Dobiveni broj presijecanja putanje u perioduistraživanja dijeljen je brojem izlazaka na teren i tako je utvrđeno stvarno stanje brojnostidivokoze u palninskom kompleksu Dive Grabovice. Rezultati Dobiveni podaci o brojnosti populacije osnovnog fonda divokoze u planinskomkompleksu Dive Grabovice prikazani su u tabeli 1.U prvom i drugom dijelu lovišta registrovano je po 12 presjecanja putanjekretanja ispitivača sa brojem tragova divokoze, dok ih je u trećem konstatovano 11.Dijeljenjem ukupnog broja presijecanja putanje ispitivača i tragova divokoze (35) sabrojem izlazaka na teren dobivene su vrijednosti brojnosti populacije osnovnog fondadivokoze u planinskom kompleksu Dive Grabovice (tabeli 1.). Tabela 1. Brojnost populacije osnovnog fonda divokoze - Rupicarpa rupicarpa (Linnaé) uplaninskom kompleksu Dive GraboviceTable1. Population size of Chamois Rupicarpa rupicarpa (Linnaé) on Diva Grabovica mountainchainVrsta lovne divljačiŽenke - ♀♀(divokoze)Mužjaci - ♂♂(divojarci)JaradUkupnoRupicarpa rupicarpa (Linnaé)1551030% učešća u osnovnom fondu501733100
Page 86
Korjenić E. i sar.: Brojnost populacije divokoze - Rupicarpa rupicarpa (Linnaé) u planinskom... 80Brojnost populacije osnovnog fonda divokoze u planinskom kompleksu DiveGrabovice je procijenjena na oko 30 jedinki. Dominantnije mjesto u osnovnom fondudivokoze na ovom području zauzimale su ženke divokoze. Prema podacima na ovompodručju registrovano je 15 jedinki ženki divokoza, što iznosi 50% od osnovnog fonda.Na lokalitetu Dive Grabovice evidentirano je pet mužjaka divojaraca što čini 17% odukupnog broja stada. Na ovom području registrovano je 10 jaradi (što čini 33% odukupnog stada).Na osnovu analize sastava uzoraka izmeta može se generalno zaključiti da je naispitivanom području ishrana ovih životinja različita, zavisno od godišnjeg doba, uvjetahabitata, uzrazta, spola i produkcionog perioda. Prema dobijenim podacima divokoza uishrani nije izbirljiva te da joj glavnu ishranu čine sve vrste planinskog bilja, trava i lišća,pupova i mladih izbojaka planinskog drveća, a u zimskom periodu divokoze se hranelišajem, mahovinom, korom i iglicama četinara. Diskusija Dobijeni podaci o brojnosti populacije na istraživanom području su u skladu sapodacima niza autora: Andrašić (1, 2, 3), Car (4), Čeović (5), Sofradžija (6), Svanderson(7), Treer i Tucak (8) i Tucak i sar. (9) i drugih koji navode da divokoze preferirajuvisoke, teško pristupačne planine i planinske rudine. Ljeti se penju do granice snijega, azimi se spuštaju na niže nadmorske visine. Istraživanja u ovom radu su potvrdila da sudivokoze društvene životinje. Žive u stadima (krdima) i stada su sastavljena oddivokoza, jaradi i mladih divojaraca (starih najviše tri godine). Prema dobijenimpodacima istraživanja izvan perioda parenja stari divojarci žive sami ili se udruže po 2-3.Stado predvodi stara divokoza.Dobijeni podaci o ishrani divokoze na planinskom kompleksu Dive Grabovicese podudaraju sa podacima drugih autora: Andrašić (1, 2), Car (4), Čeović (5), Sofradžija(6), Svanderson (7), Treer i Tucak (8) i Tucak i sar. (9). Zaključci Na osnovu provedenih istraživanja brojnosti i strukture ishrane divokoze uplaninskom kompleksu Dive Grabovice moguće je izvesti nekoliko temeljnih zaključaka:1. U planinskom kompleksu Dive Grabovice metodom relativne brojnostiregistrovano je 30 jedinki divokoze (15 ženki, 5 mužjaka i 10 jaradi);
Page 87
Korjenić E. i sar.: Brojnost populacije divokoze - Rupicarpa rupicarpa (Linnaé) u planinskom ... Veterinaria 58 (1-2),77-81, Sarajevo 2009.812. Makro- i mikroskopskom analizom izmeta divokoze je utvrđeno da je ishranaove životinje različita, zavisno od godišnjeg doba, uvjeta habitata, uzrasta, spolai reprodukcionog perioda. Prema podacima dobijenim u ovom radu divokoza uishrani nije izbirljiva i utvrđeno je da joj glavninu hranu predstavljaju sve vrsteplaninskog bilja i trava te lišće, pupovi i mladi izbojci planinskog drveća, a uzimskom periodu divokoze su se hranile i lišajem, mahovinom, korom iiglicama četinara; 3. Generalno se može zaključiti, da je ova vrsta ugrožena i da joj, ukoliko se hitnone poduzmu odgovarajuće zaštitne mjere, prijeti nestanak na ovim prostorima. Stim u vezi, da bi se održala i, eventualno, uvećala populacija divokoze nanavedenom području, predlažemo sljedeće uzgojno-zaštitne mjere:− proglašavanje područja na kojima se nalaze ove životinje šumsko-uzgojnim izaštitnim rezervatima;− stalno praćenje brojnosti populacije i kartiranje užeg i šireg areala divokoze naistraživanom području;− trajnu zabranu odstrela divokoze u planinskom kompleksu Dive Grabovice;− edukaciju lovaca, izviđača, planinara, sakupljača ljekovitog bilja i gljiva,sportista i uopće javnog mjenja s ciljem razvijanja svijesti o značaju očuvanja izaštite populacije divokoze. LITERATURA 1. Andrašić D. Uređivanje lovišta (lovna privreda IV dio). Zagreb: Šumarski fakultet;1973.2. Andrašić D. Lovna privreda III (lovljenje divljači i lovna ekonomika). Kućna tiskaraSveučilišta u Zagrebu, Zagreb, 1974.3. Andrašić D. Zoologija divljači lovna tehnologija. Zagreb: SNL; 1979.4. Car Z. Bonitiranje lovišta jelena, srna, divokoza i tetrijeba. Zagreb: Lovačka knjiga;1961.5. Čeović I. Lovstvo. Zagreb: Lovačka knjiga; 1953.6. Sofradžija A. Lovna divljač. Sarajevo: Savez lovačkih organizacija Bosne iHercegovine; 1999.7. Svanderson T. Sisari-ilustrovana enciklopedija životinjskog carstva. Ljubljana:Mladinska knjiga; 1967.8. Treer T, Tucak Z. Agrarna zoologija. Zagreb: Školska knjiga; 1991.9. Tucak Z, Florijančić T, Grubešić M i sar. Lovstvo. Osijek: Poljoprivredni fakultet;2001.Uredništvo primilo rukopis 04.03.2009.
Page 88
Page 89
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... Veterinaria 58 (1-2),83-96, Sarajevo 2009.83MORFOMETRIJSKI PARAMETRI KOSTIJU GLAVE I POSTKRANIJALNOGSKELETA ŠPILJSKOG MEDVJEDA (Ursus spelaeus Rosenmüller & Heinroth,1794) IZ LUKINE PEĆINE I MEGARE U BOSNI I HERCEGOVINIMORPHOMETRIC PARAMETERS OF CRANIAL AND POSTCRANIALSKELETON IN CAVE BEAR (Ursus spelaeus Rosenmüller & Heinroth, 1794)FROM LUKINA PEĆINA CAVE AND MEGARA IN BOSNIA ANDHERZEGOVINALukić-Bilela Lada, Mulaomerović J., Tulić Una, Habul A., Softić Almira, Katica V.•Abstract – During the investigation of the Lukina pećina cave (Srednja stijena,Ravan mountain) the bone remains of the cave bear (Ursus spelaeus Rosenmüller &Heinroth, 1794) were found. We demonstrate for the first time the morphometricproportions of the cave bear from this locality. Our reasearch also included the newfindings from the Megara cave (Bjelašnica). Analyzed morphometric proportionscompletely fell within the variation range of the Pleistocene cave bear population inBosnia and Herzegovina, and the general variation range.Key words: Ursus spelaeus, Lukina pećina Cave, Megara, mandible, postcranialskeleton Kratak sadržaj - Istraživanjem Lukine pećine (Srednja stijena, Ravanmountain) nađeni su ostaci pleistocenske faune špiljskog medvjeda (Ursus spelaeusRosenmüller & Heinroth, 1794). U radu donosimo prvi prikaz morfometrijskih proporcijaove vrste sa spomenutog lokaliteta. Analizom su obuhvaćeni i novi nalazi iz špiljeMegara (Bjelašnica). Dobivene morfometrijske proporcije se u potpunosti uklapaju u • Dr. sc. Lukić-Bilela Lada, biolog, naučni saradnik, INGEB, Gajev trg 4,lada.lukic@ingeb.ba; mr. sc. Mulaomerović Jasminko, Centar za karstologiju, ANUBiH, Sarajevo;Tulić Una biolog, Institut za genetičko inženjerstvo i biotehnologiju, Sarajevo; Habul Adi, biolog,FONDEKO, Sarajevo; mr. sc. Softić Almira, DVM; dr. sc. Katica Velija DVM, vanredni profesor,Veterinarski fakultet, Univerzitet u Sarajevu.Lukić-Bilela Lada, PhD, Biologist, Research Associate, INGEB, Gajev trg 4,lada.lukic@ingeb.ba; Mulaomerović Jasminko Msc, Center For Karstology, ANUBiH, Sarajevo;Tulić Una, Biologist, Institut for Genetic Engineering and Biotechnology, Sarajevo; Habul Adi,biologist, FONDEKO, Sarajevo; Softić Almira, DVM; Katica Velija, PhD, DVM, AssociateProfessor, Veterinary Faculty, University of Sarajevo.
Page 90
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... 84opći varijacijski raspon populacija pleistocenske faune špiljskog medvjeda u Bosni iHercegovini, te su u granicama općeg varijacijskog raspona.Ključne riječi: Ursus spelaeus, Lukina pećina, Megara, mandibula,postkranijalni skelet Uvod Lukina pećina (X=6509068, Y=4907584, Z=910) nalazi se na Ravan planini, upredjelu Mašica, točnije u dnu Srednje stijene (kota 1002 m) (sl. 1). Najlakši prilaz ješumskom cestom od sela Mitrovići uz rijeku Mašicu, do podnožja sjevernih obronakaSrednje stijene. Slika 1. Topografska karta lokaliteta Lukina pećina (inv. br. 2249) (1:25.000)Figure 1. Topographic map of Lukina pećina cave locality (inv. no. 2249) (1:25.000) Tijekom detaljnijih speleoloških istraživanja koja su imala za cilj pronaćitragove kulture čovjeka u ranim periodima historije (u jednoj špilji su nađeni paleolitskikameni artefakti, a u nekoliko špilja fragmenti keramičkog posuđa iz ranog srednjegvijeka), nedavno je u krajnjem kanalu (na sl. 2 označenog sa „+“) na površini nađen većibroj kostiju i dijelova lubanje špiljskog medvjeda (sl. 2). Lukina pećina je kao paleontološki lokalitet poznata od osamdesetih godinaprošlog stoljeća, kada su izvršena probna sondiranja. Tom su prigodom u špiljskimsedimentima pronađeni ostaci faune koja je preliminarno determinirana, te je konstatiranaautohtona gornjopleistocenska fauna (2).
Page 91
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... Veterinaria 58 (1-2),83-96, Sarajevo 2009.85 Slika 2. Nacrt Lukine pećine. Medvjeđi brlozi označeni su strelicama, dok je nalazište kostijušpiljskog medvjeda označeno znakom „+“Figure 2. The plan of the Lukina pećina cave. The cave bear lairs marked with arrows, and bonesfinding site marked with „+“ Sistematska istraživanja nisu nikada provedena, iako je na površini sakupljenveći broj kostiju (osamdesetih godina kosti su poslane na determinaciju u Zavod zageologiju kvartara u Zagrebu), a u završnim dijelovima kanala opaženi su karakterističnimedvjeđi brlozi i tzv. „medvjeđa brušenja“ (sl. 3), koja predstavljaju siguran pokazateljda se u taložinama ispod njih nalaze uklopljene kosti špiljskog medvjeda (19). Slika 3. Tragovi „medvjeđeg brušenja“ nastijeni, Lukina pećina, Srednja stijena, TajanFigure 3. The traces of „Bärenschliffe“ on therock. Lukina pećina cave, Srednja stijena, Tajan
Page 92
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... 86Geološki i speleološki odnosiLukina pećinaGeološki odnosi neposredne okolice Lukine pećine vrlo su zanimljivi (15).Rijeka Mašica teče duž rasjeda na kontaktu dijabaza sa titonskim naslagama donje kredekoje se pružaju sve do podnožja Srednje stijene, sačinjene od masivnih krečnjakasrednjeg i gornjeg trijasa. Sa južne strane ovu „oazu krša“ djelomično zatvara jurskavulkanogeno-sedimentna formacija na koju se nastavlja masiv lerzolita. Ovakvookruženje uslovilo je pojavu brojnih podzemnih tokova kroz Mašicu i Bijeli kamen(Srednju stijenu), koji su se tijekom geološke historije spustili na niže nivoe i iza sebeostavili brojne špilje. Lukina pećina je „dvostruka špilja“ s obzirom da se dvije špilje nalaze uneposrednoj blizini. Obje su formirane duž pukotina pravca pružanja jugozapad-sjeveroistok i jugoistok-sjeverozapad erozionim djelovanjem vode. Ukupna duljinakanala je 247 m. Desna špilja (gledano od ulaza) morfološki je složenija, te bogatijašpiljskim nakitom. U površinskom sloju na više mjesta nađeni su fragmenti zemljanogposuđa. MegaraŠpilja Megara (poznata još i kao Kuvija, te Mijatova pećina) na planiniBjelašnici je kao bogato nalazište ostataka špiljskog medvjeda (Ursus spelaeusRosenmüller & Heinroth, 1794) poznata još od kraja 19. stoljeća (12). Prva iskapanjanačinio je kustos Zemaljskog muzeja u Sarajevu F. Fiala 1892. godine (3). Tom jeprigodom prikupljen vrlo bogat paleontološki materijal, koji je uz koštani materijal koji jeiskopao M. Malez 1970. godine obrađen i publiciran u većem broju znanstvenih radova(7, 8, 9, 10, 13.). Osim po bogatim paleontološkim nalazima, Megara je poznata i po bogatstvušpiljskih ukrasa, pa je kao takva zanimljiva i za eventualnu turističku eksploataciju. Sciljem njene valorizacije kao turističkog objekta špilja je posjećena tijekom 2001. godine(14). Tada je primijećen veći broj svježih iskopa u različitim dijelovima špilje osobito uzavršnoj, tzv. „Fialinoj dvorani“. Prema navodima mještana u špilju su dolazili vojniciSFOR-a u potrazi za skrivenim oružjem. U jednom od kopova nađena je donja čeljust ikosti ekstremiteta (sakupljene po površini) špiljskog medvjeda koje su morfometrijskiopisane u ovome radu. Ciljevi rada su:• izvršiti morfometrijske izmjere ostataka postkranijalnog skeleta izLukine pećine, te novih nalaza iz Megare prema utvrđenimproporcijama,• utvrditi korelaciju dobivenih morfometrijskih proporcija sapopulacijama pleistocenske faune špiljskog medvjeda iz Bosne iHercegovine (špilja Megara), te Hrvatske i Slovenije u odnosu na općivarijacijski raspon,
Page 93
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... Veterinaria 58 (1-2),83-96, Sarajevo 2009.87• izvršiti morfometrijske izmjere zubnog materijala iz Lukine pećine inovih nalaza iz Megare, te utvrditi korelaciju njihovih vrijednosti saopćim varijacijskim rasponom, • načiniti varijacijski raspon proporcija zuba nađenih u Lukinoj pećini,• ukoliko je moguće, odrediti spolnu i dobnu pripadnost nađenihprimjeraka. Materijal i metode Uzorci kostiju špiljskog medvjeda prikupljeni su tijekom nekoliko speleloškihekspedicija u periodu od više godina, u špiljama Lukina pećina (Srednja stijena, Ravanplanina) i špilji Megara (Bjelašnica). Mjerenja su vršena šublerom, kefalometrom i pelvimetrom, ovisno odimenzijama objekata mjerenja. Pelvimetar je mjerni instrument za mjerenjetransverzalnih mjera koji se sastoji od dva zaobljena kraka spojena vodoravnom prečkomsa mjernom skalom raspona 60 cm uz preciznost od 0,1 cm. Kefalometar je mjerniinstrument konstruiran analogno pelvimetru, manjih dimenzija (mjerna skala 30 cm, uzpreciznost 0,1 cm). Dobiveni podaci o morfometrijskim proporcijama uspoređeni su sapostojećim varijacijskim rasponima, kako bi se stekao uvid u populaciju špiljskogmedvjeda iz Lukine pećine, odnosno usporedili novi nalazi iz Megare sa postojećimpodacima. Rezultati Donja čeljust (Mandibula)Za morfometrijsku analizu na raspolaganju smo imali gotovo u potpunostiočuvanu lijevu polovicu mandibule (sl. 4), dio lijeve gornje čeljusti i prikupljenepojedinačne zube iz Lukine pećine (sl. 5A i 5B), te lijevu polovicu mandibule iz Megare.Njihove morfometrijske proporcije su uspoređene sa proporcijama dobivenim izmjeramana populaciji iz Megare (13), te populacijama sa nekoliko lokaliteta u Hrvatskoj (4) iSloveniji (17), u odnosu na opći varijacijski raspon (5) (tab. 1). Zubi (Dentes)Zubi su u izravnom odnosu sa načinom ishrane životinje, koreliraju sa odnosimau morfologiji skeleta, te su stoga od iznimnog značaja za istraživanje morfoloških, ali ibioloških odlika svih sisavaca (4). U opisu zuba u svrhu njihovih morfoloških odnosnomorfometričkih odlika koristili smo shemu opisanu ranije (4, 18).Odontološkom opservacijom obuhvaćeni su u potpunosti očuvani i usidrenipremolar (P4), kanin i tri molara (M1, M2 i M3) koji pripadaju očuvanoj lijevoj polovici
Page 94
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... 88donje čeljusti (sl. 4), potom dva molara – M1 i M2 iz gornje lijeve čeljusti nađene uLukinoj pećini (sl. 5B, br. 1) te zubi pojedinačno pronađeni u Lukinoj pećini: pet očnjaka(sl. 5A, br. 1-5) i dva molara (M2) (sl. 5B, br. 2 i 3). Morfometrijske proporcije navedenihzuba prikazane su u tabelama 2A, 2B, 2C i 2D. Iz Megare smo morfometrijski analiziralizube iz lijevog ogranka mandibule: kanin i molare (M2 i M3) čije su proporcije prikazaneu tabeli 2. Usidreni zubi su za potrebe mjerenja pažljivo ekstrahirani iz zubnih alveola.Nakon dobivenih morfometrijskih podataka sačinjen je varijacijski raspon za zube nađeneu Lukinoj pećini (tab. 3). Slika 4. Donja lijeva polovicamandibule špiljskog medvjeda izLukine pećineFigure 4. Lower left body of cavebear mandible from Lukina pećinacaveSlika 5. A) Očnjaci nađeni uLukinoj pećini označeni subrojevima od 1-5. B) Lijevi diogornje čeljusti sa molarima (M1 iM2) označen je brojem 1 a dvapojedinačna donja molara (M2)označena su brojevima 2 i 3Figure 5. A) The canines fromLukina pećina cave marked 1-5. B)The left body part of maxilla withmolars (M1 and M2) marked with 1and lower molars (M2) marked with2 and 3
Page 95
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... Veterinaria 58 (1-2),83-96, Sarajevo 2009.89 Tabela 1. Usporedba morfometrijskih proporcija mandibule Ursus spelaeus Rosenmüller &Heinroth, 1794 iz Lukine pećine i Megare (novi nalazi) sa proporcijama špiljskih medvjeda izMegare (13), te pleistocenskih lokaliteta u Hrvatskoj (4) i Sloveniji (17) sa općim varijacijskimrasponom (5) Table 1. The comparison of Ursus spelaeus Rosenmüller & Heinroth, 1794 mandiblemorphometric proportions from Lukina pećina cave and Megara (new findings) with the cave bearproportions from Megara (13), Pleistocene localities from Croatia (4) and Slovenia (17),concerning general variation range (5)BOSNA I HERCEGOVINA HRVATSKA SLOVENIJARavanPlaninaMegara,BjelašnicaUrsusspelaeusRosenmüller& Heinroth,1794Lukinapećina, SrednjastijenaNovinalaziMalez iSlišković,1989.Cerovac,Krapina,Lokve,Vrapče(Herak,1947.)Mokriškajama,Potočkazijalka(Rakovec,1967.)Općivarijacijskiraspon( Hütter,1955.)Najvećaduljinamandibule341.0- 230.5-323.0274.0-348.0223.0-337.0 270.0-374.0Duljina P4-M3108.5 114.5 93.1-110.8 90.2-110.293.2-106.290.2-116.2duljinakrune15.9- 14.1-17.511.9-18.913.2-17.611.0-19.2P4širinakrune10.5-9.2-11.59.0-13.08.8-12.47.0-16.8duljinakrune30.0- 26.5-30.726.6-33.723.4-34.922.0-38.1M1širinakrune14.0- 12.8-15.212.9-17.011.2-18.711.0-18.0duljinakrune 30.031.5 27.0-30.826.6-34.325.5-35.624.0-36.7M2širinakrune18.017.5. 16.4-19.816.9-22.015.7-21.914.4-23.4duljinakrune29,229.2 23.5-28.522.1-29.622.0-32.319.0-34.0M3širinakrune20.120.5 16.8-20.518.0-21.316.0-22.515.0-23.4Duljinadijasteme60.543.0 32.5-78.0-31.3-65.0-Visina tijelamandibuleizmeđu M1 iM279.571.0 42.0-71.5-45.9-78.2-
Page 96
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... 90 Tabela 2A. Morfometrijske proporcije zubi špiljskog medvjeda, nađenih na lijevoj polovicimandibule iz Lukine pećineTable 2A. The cave bear teeth morphometric proportions, belonging to the left body of mandiblefrom Lukina pećina caveUrsus spelaeus Rosenmüller & Heinroth, 1794širina ant.-post.30,3 mmširina med.-lat.20,5 mmC inf.ukupna visina zuba105,5 mmširina ant.-post.15,9 mmširina med.-lat.10,5 mmvisina krunice8,0 mmP4ukupna visina zuba24,0* mmširina ant.-post.30,0 mmširina med.-lat.14,0 mmvisina krunice5,0 mmM1ukupna visina zuba30,5 mmširina ant.-post.30,0 mmširina med.-lat.18,0 mmvisina krunice5,0 mmM2ukupna visina zuba31,5 mmširina ant.-post.29,2 mmširina med.-lat.20,1 mmvisina krunice5,1 mmMandibula (lijeva polovica) Lukina pećina, Srednja stijena, Ravan planinaM3ukupna visina zuba28,9 mmLegenda: * oštećeni zubi (preciznost +/- 2 mm)Legend: * damaged teeth (precision +/- 2 mm)Tabela 2B. Morfometrijske proporcije molara (M1 i M2) špiljskog medvjeda sa lijevog dijelagornje čeljusti iz Lukine pećineTable 2B. The cave bear molar (M1 i M2) morphometric proportions, belonging to the left body ofmaxilla from Lukina pećina caveUrsus spelaeusRosenmüller & Heinroth, 1794Lukina pećina, Srednja stijena, Ravan planinaširina ant.-post.28,5 mmširina med.-lat.20,0 mmvisina krunice10,1 mmM1ukupna visina zuba37,2 mmširina ant.-post.44,0 mmširina med.-lat.22,0 mmvisina krunice10,5 mmGornja čeljust(lijevi dio) M2ukupna visina zuba39,5 mm
Page 97
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... Veterinaria 58 (1-2),83-96, Sarajevo 2009.91 Tabela 2C. Morfometrijske proporcije donjih molara (M2) špiljskog medvjeda nađenih u LukinojpećiniTable 2C. The cave bear lower molar (M2) morphometric proportions from Lukina pećina caveLukina pećina, Srednja stijena, RavanplaninaUrsus spelaeus Rosenmüller & Heinroth, 179412širina ant.-post.32,1 mm30,5 mmširina med.-lat.19,0 mm18,0 mmvisina krunice7,0 mm5,5 mmPojedinačnizubiM2ukupna visina zuba37,5 mm36,0 mmTabela 2D. Morfometrijske proporcije očnjaka špiljskog medvjeda nađenih u Lukinoj pećini (1-5) iMegari. Očnjak označen brojem 6 pripada mandibuli iz Lukine pećineTable 2D. The cave bears canine morphometric proportions found in Lukina pećina cave andMegara. The canine marked with 6 belongs to mandible from Lukina pećina caveLukina pećina, Srednja stijena, RavanplaninaMegara novinalaz123456Ursus spelaeusRosenmüller & Heinroth, 1794Izmjere izražene u milimetrima (mm)širina ant.-post.30.3 29.0 31.5 26.5 31.5 25.529.0širina med.-lat.20.5 22.5 21.0 16.3 22.0 16.120.0C inf.ukupna visina zuba 105.5 102.5 97.0* 98.5 106.5 98.5105.0 Postkranijalni skelet U radu su korišteni podaci dobiveni morfometrijskim mjerenjem ukupno 10kostiju (samo dvije cjelovite) koje potječu iz špilje Megare. Determinirane su četiri desnei jedna vrlo krupna lijeva nadlaktična kost (humerus), jedna cjelovita desna lakatna kost(ulna), lijeva i desna palčana kost (radius), dio desne natkoljenične kosti (femur), te diolijeve goljenične kosti (tibia). U Lukinoj pećini nađena je vrlo oštećena bedrena kost (uneposrednoj blizini donje čeljusti) te kao takva, nije uzeta u razmatranje. Sve mjere suizražene u milimetrima. Nadlaktična kost (Humerus)Budući da je na tri od pet sakupljenih nadlaktičnih kostiju nedostajao iproksimalni i distalni dio, bilo je moguće izvršiti mjerenje medio-lateralne širine ianteriorno-posteriorne širine dijafize. Dobiven je raspon od 33.5 - 51,5 mm za medio-lateralnu širinu dijafiza, te 40.0-51.6 mm za anterio-posteriornu širinu dijafiza.Nadlaktične kosti prikazane su na slici 6, brojevima 4, 5, 6, 7 i 10.Za preostale dvije nadlaktične kosti na kojima je distalni dio (djelomično ilipotpuno) očuvan, dobiveni su sljedeći podaci: medio-lateralna širina (92,1 i 136,2 mm),te anterio-posteriorna širina distalnog zgloba (56,9 i 76,2 mm).
Page 98
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... 92Lakatna kost (Ulna)Desna lakatna kost je cjelovita i dobro očuvana (sl. 6, br. 3), sa dobro istaknutimspeleoidnim obilježjima (masivnost, veći olekranon, cavitas sigmoidea polukuglastogoblika) kako je opisano na populaciji špiljskih medvjeda iz Megare (13). Na ulni je bilomoguće izvršiti morfometrijsko mjerenje prema Athenu (1). Sve su mjere izražene umilimetrima. Tabela 3. Varijacijski raspon zubi nađenih u Lukinoj pećini i Megari u odnosu na varijacijskiraspon zubi iz Megare (13), te opći varijacijski raspon (6)Table 3. The teeth variation range of Lukina pećina cave and Megara, concerning teeth variationrange from Megara (13) and general variation range (6)Megara, BjelašnicaUrsus spelaeusRosenmüller &Heinroth, 1794Lukina pećinaSrednja stijena,Ravan planinaNovi nalaziMalez iSlišković,1989.Opći varijacijskiraspon (M. Malez, 1965.)širina ant.-post.25.5-31.529.020,7-21,612.5-33.5širina med.-lat.16.1-22.520.015,2-16,212.1-26.5Cinf. ukupna visinazuba97.0*-106.5105.0--širina ant.-post.28.5-28,022.3-33.2širina med.-lat.20.0-19,815.2-23.7M1ukupna visinazuba37.2---širina ant.-post.30,5-44.0-43,5-48,033.9-61.2širina med.-lat.18,0-22.0-22,0-25,217.0-27.0M2ukupna visinazuba36,0- 39.5---širina ant.-post.15.9-14,5-16,011.0-19.2širina med.-lat.10.5-9,5-10,47.0-16.8P4ukupna visinazuba24.0*---širina ant.-post.30.0-29,7-34,622.0-38.1širina med.-lat.14.0-14,4-17,211.0-18.0M1ukupna visinazuba30.5---širina ant.-post.30.0-32.132.028,8-33,324.0-36.7širina med.-lat.18.0-19.019.216,5-20,514.4-23.4M2ukupna visinazuba31.5-37.5---širina ant.-post.29.228.526,4-27,519.0-34.0širina med.-lat.20.120.017,5-20,715.0-23.4M3ukupna visinazuba28.9---Legenda: * oštećeni zubi (preciznost +/- 2 mm)Legend: * damaged teeth (precision +/- 2 mm)
Page 99
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... Veterinaria 58 (1-2),83-96, Sarajevo 2009.93 Slika 6. Duge kosti špiljskog medvjeda nađene u špilji MegariFigure 6. The cave bear long bones from Megara cave Morfometrijska mjerenja su obuhvatila sljedeće proporcije: najveću duljinu ulne(387,0 mm), anteriorno-posteriornu širinu ulne (dijafiza medijalno, 37,9 mm), medio-lateralnu širinu ulne (dijafiza medijalno 25,5 mm), najveću širinu olekranona (94,2 mm),najveću debljinu olekranona (41,0 mm), najmanju debljinu olekranona (11,0 mm),udaljenost između processus coronoideus i najproksimalnijeg dijela olekranona (107,0mm), udaljenost između vanjskih margina cavitas sigmoides major (incisura trochlearis)(47,5 mm), anteriorno-posteriornu širinu kosti u proksimalnom dijelu, u nivou processuscoronoideus (62,0 mm), najveću debljinu processus anconaeus (22,5 mm), najveću širinuprocessus coronoideus (39,0 mm), najveću širinu oba processi coronarii (60,0 mm),anterio-posteriornu širinu kosti u distalnom dijelu (56,0 mm), medio-lateralnu širinu kostiu distalnom dijelu (35,5 mm), anterio-posteriornu širinu processus styloideus (31,5 mm) imedio-lateralnu širinu processus styloideus (22,9 mm). Palčana kost (Radius) Nađena desna i lijeva palčana kost označene su brojevima 1 i 2 (sl. 6).Morfometrijska analiza je uključivala sljedeće proporcije: ukupnu duljinu kosti (321.0mm), medio-lateralna duljina proksimalnog zgloba (51,5 mm), anterio-posteriorna duljinaproksimalnog zgloba (40,3 mm) za cjelovitu palčanu kost. Za obje nađene kosti, mjerilismo medio-lateralnu duljinu distalnog zgloba (80,2; 76,0 mm), anterio-posteriornuduljinu distalnog zgloba (47,0; 46,3 mm), medio-lateralnu širinu dijafize (debljinudijafize) (38,2; 35,1 mm) i anterio-posteriornu širinu dijafize (debljinu dijafize) (24,1;26,1 mm). Nakon izvršenih mjerenja nađeno je da su njihove vrijednosti u okviru općegvarijacijskog raspona kojeg su uspostavili Malez i Slišković (13). Bedrena kost (Femur)Na bedrenoj kosti nađenoj u Megari (sl. 6, broj 9) izmjerena je medio-lateralnaširina dijafize (37,4 mm) i anterio-posteriorna širina dijafize (29,2 mm). Širinu distalnogzgloba nije bilo moguće mjeriti zbog prisutnog oštećenja. Dobivene proporcije su u
Page 100
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... 94rasponu određenom za populacije špiljskih medvjeda sa lokaliteta iz Bosne i Hercegovine(13).Goljenična kost (Tibia)Medio-lateralna širina goljenične kosti proksimalno iznosi 100,6 mm dokanterio-posteriornu širinu zgloba nije bilo moguće izmjeriti zbog prisutnog oštećenja.Medio-lateralna i anterio-posteriorna širina dijafize nije mjerena zbog vertikalnograscjepa kosti, te mjere ne bi mogle biti smatrane pouzdanima (sl. 6, br. 8). Diskusija Lijeva polovica donje čeljusti iz Lukine pećine je oštećena na mjestu alveolapripadajućih inciziva I1 i I2, dok je očuvana alveola I3. Od zuba je prisutan očnjak,premolar P4 i molari M1, M2 i M3. Premolar i molari su snažno abradirani. Na mandibulije dobro istaknut spolni dimorfizam, sa jasno izraženim hvatištima mišića, te se možezaključiti da pripada snažnom, krupnom mužjaku u senilnoj životnoj dobi. Na mandibuliiz Megare također je izražen spolni dimorfizam, odnosno obilježja karakteristična zaženku.Varijacijski raspon za zube iz Lukine pećine, postavljen u ovome radu općenitose uklapa u opći varijacijski raspon za populacije špiljskog medvjeda koji je postavioMalez (6). Pronađene varijacije odnose se na podizanje gornje granice za vrijednostianterio-posteriorne i medio-lateralne širine očnjaka iz Lukine pećine, ali i novog nalaza izMegare u odnosu na postojeće vrijednosti za očnjake iz populacije špilje Megara (13).No, pronađena odstupanja još su uvijek u okvirima općeg varijacijskog raspona premaMalezu (6).Dobiveni nalazi upućuju na potrebu sistematskog istraživanja speleološkihobjekata u Bosni i Hercegovini kako bi se, dobivanjem većeg broja morfometrijskihpodataka stekao cjelovitiji i pouzdaniji uvid u populacije špiljskog medvjeda sa različitihlokaliteta.Broj pronađenih zuba špiljskog medvjeda u Lukinoj pećini je nedovoljan da bise moglo govoriti o frekvenciji morfotipova, kako je to bilo moguće odrediti na temeljuzubi pronađenih u špilji Orlovači prema Malezu i sar. (11) i Đurkovini prema Paunoviću(16). Na temelju morfometrijskih proporcija dugih kostiju nađenih u špilji Megarimože se reći da se uklapaju u varijacijski raspon iz Megare kojeg su uspostavili Malez iSlišković (13). Morfometrijske vrijednosti dobivene za nadlaktičnu kost spuštaju donjugranicu ovoga raspona, ali vjerujemo da je razlog tome necjelovitost i oštećenostkoštanog materijala što neosporno utječe na preciznost mjerenja.Od ostalih kostiju nađenih u Megari spominjemo tri necjelovite i vrlo oštećenelubanje (juvenilnih jedinki), dijelove kostiju zdjelice, metatarzusa i necjelovitu skapuluna kojima nije bilo moguće izvršiti mjerenja.
Page 101
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... Veterinaria 58 (1-2),83-96, Sarajevo 2009.95 Zaključci Na temelju morfometrijskih proporcija analiziranih koštanih ostataka špiljskogmedvjeda iz Lukine pećine Megare, doneseni su sljedeći zaključci:Nakon izvršenih morfometrijskih mjerenja donjih čeljusti iz Lukine pećine iMegare zaključeno je da se dobivene proporcije uklapaju opći varijacijski raspon kojegsu uspostavili Malez i Slišković 1989. Na temelju morfološko-anatomskih odlikazaključeno je da mandibula iz Lukine pećine pripada mužjaku senilne dobi, dokmandibula iz Megare pripada mladoj ženki. Morfometrijske proporcije analiziranih zubitakođer koreliraju sa općim varijacijskim rasponom, izuzev veličine očnjaka koji pomičeraspon prema gore, kada je u pitanju Lukina pećina. Na temelju morfometrijskihproporcija zuba nađenih u Lukinoj pećini načinjen je varijacijski raspon, međutim natemelju malog broja analiziranih zubi nije moguće donijeti konačni zaključak o populacijišpiljskim medvjeda sa ovoga lokaliteta.Na temelju morfometrijskih proporcija dugih kostiju nađenih u špilji Megariutvrdili smo da se uklapaju u varijacijski raspon iz Megare kojeg su uspostavili Malez iSlišković (13), izuzev nadlaktične, kosti čije pojedine proporcije spuštaju donju granicuvarijacijskog raspona. Lukina pećina je nastala u dobro uslojenim trijaskim krečnjacima erozionim, akasnije i korozionim djelovanjem vode. Špilja je u gotovo svim svojim dijelovima vrlobogata sedimentima koji sadrže brojne ostatke pleistocene faune.Lukina pećina služila je neosporno špiljskim medvjedima tijekom gornjegpleistocena za brloženje, budući da su na nekoliko mjesta pronađeni tragovi „medvjeđihgnijezda“ i „medvjeđeg brušenja“ što upućuje na njihove životne aktivnosti na ovomlokalitetu. Paleobiološka, kvartarnogeloška i paleontološka istraživanja u ovoj špiljiplanirano je nastaviti, kako bi se dobilo više podataka u pleistocenskoj fauni ovogalokaliteta. LITERATURA 1. Athen K. Biostatistical investigations of long bones and metapodial bones ofUrsus spelaeus and Ursus deningeri. Scientific Annals. 2006;(98):159-162.2. Brajković D, Gužvica G, Kapel, A, Lenardić J, Paunović M, Poje M, Slišković,T: Nova nalazišta pleistocenskih vertebrata u Bosni i Hercegovini (Newlocalities on the Pleistocene Vertebrates in Bosnia and Herzegovina). Geološkizbornik. 1997;(12):224-240. 3. Fiala F. Pretraživanje pećina u Bosni. Glasnik Zemaljskog muzeja u Bosni iHercegovini. 1892; 4(3):237-243.4. Herak M. Starost i sistematske značajke spiljskog medvjeda Hrvatske. Geološkivjesnik. 1947;(1):12-47.
Page 102
Lukić-Bilela Lada i sar: Morfometrijski parametri kostiju glave i postkranijalnog skeleta... 965. Hütter E. Der Höhlenbär von Merkstein. Ann. Naturhist. Mus. Wien.1955;60:122-168.6. Malez M. Novi opći varijacijski raspon vrste Ursus spelaeus Rosenmüller &Heinroth, 1794. Geološki vjesnik. 1965;18(1):133-139.7. Malez M. Izvještaj o kvartargeološkim istraživanjima u 1970. godini. LjetopisJAZU. 1971; 75(1969-1970):411-424.8. Malez M, Slijepčević A, Srdoč D. Određivanje starosti metodom radioaktivnogugljika kvartarnim naslagama na nekim lokalitetima u Dinarskom kršu. RadJAZU. 1979;(383):227-271.9. Malez M. Speleokronološki odnosi u nekim spiljama Bosne i Hercegovine. Naškrš. 1980; 6(9):3-32.10. Malez M, Slišković T. Kvartarnogeološki i paleontološki odnosi u spilji Megarina planini Bjelašnici (SR Bosna i Hercegovina). Zbornik predavanja 9.jugoslovenski speleološki kongres; 1984 Karlovac; Zagreb; 1984. str. 697-710. 11. Malez M, Lajtner I, Paunović M, Slišković T. Kvartanogeološka i paleontološkaproučavanja u špilji Orlovači kod Sarajeva (SR Bosna i Hercegovina). KršJugoslavije. 1987;12(3):39-75.12. Malez M, Slišković T. Kenozojski sisavci (Mammalia) Bosne i Hercegovine.Zemaljski muzej Bosne i Hercegovine. Zbornik referata naučnog skupa„Minerali, stijene, izumrli i živi svijet BiH“. Sarajevo, 7-8. oktobar 1988.13. Malez M., Slišković T.: Kronostratigrafske i morfometrijske značajke spiljskogmedvjeda (Ursus spelaeus Rosenm. & Heinroth) iz Megare na Bjelašnici.Poseban otisak iz „Glasnika Zemaljskog muzeja Bosne i Hercegovine“. Prirodnenauke. 1989;NS(28):7-53.14. Mulaomerović J. Mogućnosti pećinskog turizma na području Sarajeva. U:Strategija razvoja turizma grada-kantona Sarajevo. Sarajevo: InstitutEkonomskog fakulteta, 2001; 1-19. 15. Olujić J, Pamić O, Pamić J, Mihajlović R, Veljković D, Kapelar J. Osnovnageološka karta SFRJ. Vareš: List, 1977.16. Paunović M. Morfogenetsko proučavanje kutnjaka vrste Ursus spelaeus iz spiljeĐurkovine u Hercegovini. Glasnik Zemaljskog Muzeja (Prirodne Nauke).1988;NS (27):51-56.17. Rakovec I. Jamski medved iz Mokriške jame v Savinskih Alpah. (Slovenia,Yugoslavia). Razprave, IV razr. SAZU. 1967;10(4):121-203.18. Rode K. Untersuchungen über das Gebiss der Bären, Monographien zurGeologie und Paläontologie. 1935; Ser. II, Leipzig (7):1-163. 19. Rosendahl W, Döppes D. Trace fossils from bears in caves of Germany andAustria. Scientific Annals. 2006;(98):241-249.Uredništvo primilo rukopis 13.04.2009.
Page 103
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... Veterinaria 58 (1-2),97-109, Sarajevo 2009.97 NOVO NALAZIŠTE ŠPILJSKOG MEDVJEDA (Ursus spelaeusRosenmüller & Heinroth, 1794) U BOSNI I HERCEGOVINI:MORFOLOŠKO-ANATOMSKE ODLIKE KOSTIJU GLAVE NAĐENE UŠPILJI NA VRELU MOKRANJSKE MILJACKENEW LOCALITY OF CAVE BEAR (Ursus spelaeus Rosenmüller &Heinroth, 1794) IN BOSNIA AND HERZEGOVINA: MORPHO-ANATOMICAL CHARACTERISTICS OF CRANIAL SKELETONFOUND IN CAVE AT VRELO MOKRANJSKA MILJACKA Lukić-Bilela Lada, Mulaomerović J., Tulić Una, Lačević Amela, SoftićAlmira, Katica V., Pojskić N.• Abstract – During the investigation of the Cave at Vrelo Mokranjska Miljacka,the bone remains of the cave bear (Ursus spelaeus Rosenmüller & Heinroth, 1794) wasfound. This is the new Pleistocene fauna locality of this extinct species in Bosnia andHerzegovina. Almost complete cranial skeleton belongs to a young adult male. Analyzedmorphometric proportions completely fit within the variation range of the Pleistocenecave bear populations in Bosnia and Herzegovina.Key words: Ursus spelaeus, skull, teeth, Cave of Vrelo Mokranjska Miljacka Kratak sadržaj - Istraživanjem Špilje na Vrelu Mokranjske Miljacke nađeni suostaci pleistocenske faune špiljskog medvjeda (Ursus spelaeus Rosenmüller & Heinroth, • Dr. sc. Lukić-Bilela Lada, biolog, naučni saradnik, INGEB, Gajev trg 4,lada.lukic@ingeb.ba; mr. sc. Mulaomerović Jasminko, Centar za karstologiju, ANUBiH, Sarajevo;Tulić Una. biolog, Institut za genetičko inženjerstvo i biotehnologiju, Sarajevo; mr. sc. LačevićAmela, Stomatološki fakultet, Univerzitet u Sarajevu; mr. sc. Softić Almira, DVM, dr. sc. KaticaVelija DVM, vanredni profesor, Veterinarski fakultet, Univerzitet u Sarajevu. dr. sc. Pojskić Naris,biolog, naučni saradnik, Institut za genetičko inženjerstvo i biotehnologiju, Sarajevo;Lukić-Bilela Lada, PhD, Biologist, Research Associate, INGEB, Gajev trg 4,lada.lukic@ingeb.ba; Mulaomerović Jasminko Msc, Center For Karstology, ANUBiH, Sarajevo;Tulić Una, Biologist, Research Associate, Institut for Genetic Engineering and Biotechnology,Sarajevo;; Lačević Amela, DDS, Msc, Stomatology Faculty, University of Sarajevo; Softić Almira,DVM, Msc, Katica Velija, DVM, PhD, Associate Professor, Veterinary Faculty, University ofSarajevo. Pojskić Naris, PhD, Biologist, Research Associate, Institut for Genetic Engineering andBiotechnology, Sarajevo
Page 104
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... 981794). Ovaj lokalitet predstavlja novo nalazište špiljskog medvjeda u Bosni iHercegovini. Gotovo u potpunosti očuvan kranijalni skelet pripada mladom, adultnommužjaku. Na temelju morfometrijskih proporcija zaključeno je da se u potpunosti uklapau opći varijacijski raspon populacija pleistocenske faune špiljskog medvjeda u Bosni iHercegovini.Ključne riječi: Ursus spelaeus, lubanja, zubi, Špilja na Vrelu MokranjskeMiljacke Uvod Paleontološka istraživanja u Bosni i Hercegovini datiraju s kraja 19. stoljeća, sapočecima rada Zemaljskog muzeja Bosne i Hercegovine u Sarajevu (12). Među prvim inajbrojnijim su istraživanja skeletnih ostataka špiljskog medvjeda (Ursus spelaeusRosenmüller & Heinroth, 1794) (2, 5). Posebno su intenzivna istraživanja koja od krajapedesetih godina 20. stoljeća provodi M. Malez sa Instituta za geologiju kvartara HAZU,u suradnji sa nekoliko domaćih istraživača (1). Slika 1. Topografska karta lokaliteta Špilje na Vrelu Mokranjske Miljacke (inv. br. 1834)(1:25.000)Figure 1. Topographic map of the Cave of Vrelo Mokranjska Miljacka locality (inv. no. 1834)(1:25.000) Do sada su poznata sljedeća nalazišta fosilnih ostataka špiljskog medvjeda:Megara na Bjelašnici, Gigića pećina kod Bosanskog Grahova, Pećina kod Ugljevika na
Page 105
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... Veterinaria 58 (1-2),97-109, Sarajevo 2009.99planini Majevici (11), špilja Orlovača kod Mokrog, špilja Đurkovina kod Grebaca uHercegovini, špilja Hrustovača kod Sanskog Mosta, Gornja Bijambarska pećina kodOlova, Očauša pećina i Rastuša pećina kod Teslića (9), Mračna pećina u kanjonu Prače,špilja Kuk u kanjonu Bistrice, Lukina pećina na Tajanu. Od spomenutih špilja sva jeiskapanja vodio akademik M. Malez, osim u špilji Kuk gdje je iskopavanja vodio.Kulenović (6). Sondažna iskapanja u Lukinoj pećini nisu vršena. Ovim nalazištima semože još pribrojati Okrugla pećina, nedaleko od Orlovače, ali samo na nivou generičkedeterminacije (7). Posljednjih nekoliko godina ponovo su intenzivirana speleološka istraživanja uBosni i Hercegovini (15, 16) tijekom kojih su otkrivena nova paleontološka i paleolitskanalazišta. Dosadašnjim nalazištima špiljskog medvjeda sada se mogu dodati još dva novalokaliteta, kamenolom Stijene kod Vareša (17) i špilja Vrelo Mokranjske Miljacke kodMokrog. Također je sakupljen novi koštani materijal špiljskog medvjeda u pećini Megarina Bjelašnici i Lukinoj pećini na Tajanu. Prva istraživanja pećine na Vrelu MokranjskeMiljacke učinjena su u dva navrata tokom 1983. godine u okviru obimnih speleološkihistraživanja ondašnjih deset sarajevskih općina za potrebe projekata „Speleološki objektiza sklanjanje i zaštitu ljudi i materijalnih dobara”. Istraživanja su tada obuhvatila samoulazni vodeni i dio fosilnog kanala zbog nedostataka odgovarajuće opreme (kvalitetangumeni čamac) i nisu nastavljena sve do 2007. godine, kada su u špilju ponovo ušličlanovi Speleološkog društva „Speleo dodo“ iz Sarajeva. Po otkrivanju novih kanala iperspektivama koje ova špilja nudi, u daljnja istraživanja uključili su se speleolozi izSarajeva, „SNIK ATOM“ iz Zavidovića, „Ponir“ i „Netopir“ iz Banja Luke, a u nekolikoistraživanja sudjelovali su i speleolozi iz Italije (grupe iz Novare i Bolonje). U jednoj odtakvih istraživačkih ekspedicija otkriven je i usamljeni nalaz lobanje špiljskog medvjeda.Do sada je ukupno istraženo blizu 6.000 m, što uz špiljski sustav Vjetrenice čininajduljim u istraženim sustavom Bosni i Hercegovini.Geološki i speleološki odnosi Špilja na Vrelu Mokranjske Miljacke nalazi se nedaleko od Kadinog sela, upodnožju krečnjačkog masiva Gradina (sl. 1). Zavedena je pod inventarnim brojem 1834.u novourađenom popisu Katastar speleoloških objekata Bosne i Hercegovine, koji je2006. izradilo Speleološko društvo „Speleo dodo” (16). Ulaz (X=6548226, Y=4864656, Z=997) je smješten na jasno izraženom rasjedupravca pružanja jugoistok-sjeverozapad koji je u najvećem dijelu i predisponiraonastanak špilje. Prilaz špilji je vrlo jednostavan - od posljednjih kuća obitelji Novak,stotinjak metara niz livadu do rječice, te još desetak metara do samog ulaza.
Page 106
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... 100 Slika 2. Glavni aktivni kanal Špilje na Vrelu Mokranjske MiljackeFigure 2. The main active channel in the Cave of Vrelo Mokranjska Miljacka Geološki odnosi šire okolice pećine na Vrelu Mokranjske Miljacke su zanimljivii zorno pokazuju razloge njenog nastanka i složenosti. Čitavu širu regiju od Bukovika(Vučije Luke) prema Romaniji čine stijene trijaske starosti. Sama špilja je razvijena usrednjetrijaskim bankovitim i masivnim krečnjacima koji su kao otok okruženinepropusnim donjotrijaskim kvarc-liskunskim pješčarima, škriljavim pješčarima iglincima sa sjeverne, istočne i južne strane, a na istočnoj strani srednjetrijaskimkrečnjacima, rožnacima, tufovima i glincima ladinskog kata, a na kojima su formiranibrojni manji stalni ili povremeni vodeni tokovi. Ovi tokovi zbog konfiguracije terenanestaju u većem broju ponora na rubu srednjetrijaske krečnjačke navlake koja jeizlomljena brojnim rasjedima te uslovljavaju pravac pružanja podzemnih vodnih tokova iformiranje vrela Mokranjske Miljacke, odnosno špilje. Špilju čini vrlo složen sustav sastavljen iz jednog glavnog aktivnog kanala (sl.2A i 2B) (na slici 3 označen plavom bojom) i većeg broja bočnih kanala koji su u vezi sanekoliko aktivnih ponora na sjeveru i sjeverozapadu. Veza sa nekim od tih ponorautvrđena je i bojenjem. Pored aktivnog kanala postoji i nekoliko fosilnih kanala (na slici 3 označencrvenom bojom), od kojih je najveći onaj na početku pećine i koji se, skoro paralelnoaktivnom, pruža u dužini od oko 500 m. Ulaz u ovaj fosilni kanal je, u ne tako davnojprošlosti, zatrpan velikom količinom zemlje i kamenja. To je na neki način konzerviralo isačuvalo ovaj kanal veoma bogat sigastim ukrasima od oštećenja kakva su zadesilabrojne naše pećine od početka 20. st. Prema nalazima (metalni predmeti, keramika) uprednjem dijelu fosilnog kanala, ulaz u ovaj kanal je zatrpan negdje u kasnom srednjemvijeku, vjerojatno kao posljedica nekog većeg potresa. Slično se dogodilo i u nedalekojšpilji Orlovači kod Sumbulovca gdje je također zatrpan stari ulaz u špilju koji su koristilišpiljski medvjedi (10, 14).
Page 107
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... Veterinaria 58 (1-2),97-109, Sarajevo 2009.101 Slika 3. Nacrt ulaznog dijela Špilje na VreluMokranjske Miljacke. (Neobjavljeni rezultati,Simone Milanolo) Plavom bojom označen je aktivnikanal, a crvenom bojom fosilni kanali. Nalazištelubanje špiljskog medvjeda označeno je znakom „+“Figure 3. The entrance part plan of the Cave ofVrelo Mokranjska Miljacka. (Unpublished results,Simone Milanolo). The main active channel colouredin blue and fosil channels coloured in red. The cavebear skull finding site marked with „+“ Paleontološki prikazLubanja je nađena u krajnjem dijelu fosilnog kanala, na dosta neočekivanommjestu za tu vrstu nalaza (povišeni dio, uski kanal) i bez ijedne druge kosti (na planuoznačeno sa „+“). Ovakve okolnosti za sada nas upućuju na pomisao da se vjerojatno radio njenom sekundarnom položaju, ali za odgovor na pitanje kako je ona tamo dospjelapotrebna su dodatna istraživanja. Osim samog izgleda pećine i njenog položaja u širojokolici koji su bili vrlo pogodni za boravak pećinskog medvjeda, o nekimspeleobiološkim odnosima za sada se ne može govoriti. Zato će u nastavku biti riječiisključivo o morfometrijskim odlikama nađene lubanje.Kranijalni skelet špiljskog medvjeda je prvi poznati paleontobiološki nalaz izšpilje na Vrelu Mokranjske Miljacke. Biospeleološka istraživanja špilje na VreluMokranjske Miljacke nalaze se u samom začetku, stoga je zbog temeljite studije opleistocenskoj fauni iz ove špilje neophodno istraživanja nastaviti postavljanjemistraživačkih sondi kako bi se stekao potpuniji uvid o postojanju populacije špiljskihmedvjeda na ovome lokalitetu. Proporcije kranijalnih kostiju špiljskog medvjeda nađenogu Špilji na Vrelu Mokranjske Miljacke uspoređene su sa proporcijama špiljskih medvjedasa odabranih lokaliteta iz Bosne i Hercegovine (10, 13, 18), Hrvatske (3) i Slovenije (19).Uvedena su dodatna mjerenja, koja se koriste za morfološka istraživanja recentnihmedvjeda.
Page 108
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... 102Ciljevi rada su:• izvršiti morfometrijske izmjere kranijalnog skeleta špiljskogmedvjeda nađenog u špilji na Vrelu Mokranjske Miljacke premautvrđenim proporcijama,• usporediti dobivene morfometrijske proporcije sa populacijamapleistocenske faune špiljskog medvjeda iz Bosne i Hercegovine izšpilja Orgovača, Đurkovina i Megara, te Hrvatske i Slovenije uodnosu na opći varijacijski raspon,• odrediti spolnu i dobnu pripadnost nađenog primjerka,• procijeniti na temelju određenih pokazatelja („medvjeđa brušenja“ idr.) da li je novonađeni lokalitet služio špiljskom medvjedu zabrloženje ili je nalaz na druge načine dospio u špilju na VreluMokranjske Miljacke. Materijali i metode Uzorak lubanje špiljskog medvjeda (Ursus spelaeus Rosenmüller & Heinroth,1794) opisan u ovoj studiji nađen je u avgustu 2008. godine, u Fosilnom kanalu, tijekomkompleksnih biospeloloških i speleoloških istraživanja špilje na Vrelu MokranjskeMiljacke. Za potrebe morfometrijskih mjerenja kranijalnih kostiju korišteno je kljunastopomično mjerilo (šubler) s nonius skalom, te pelvimetar i kefalometar, ovisno odimenzijama objekata mjerenja. Pelvimetar je mjerni instrument za mjerenjetransverzalnih mjera koji se sastoji od dva zaobljena kraka spojena vodoravnom prečkomsa mjernom skalom raspona 60 cm uz preciznost od 0,1 cm. Kefalometar je mjerniinstrument konstruiran analogno pelvimetru, manjih dimenzija (mjerna skala 30 cm, uzpreciznost 0,1 cm). Rezultati Lubanja (Cranium)Iznimno očuvana lubanja špiljskog medvjeda nađenog u špilji na VreluMokranjske Miljacke prikazana je na slici 4 u superiornoj, inferiornoj i lateralnojprojekciji. Nalazište lubanje prikazano je slici 3, označeno znakom „+“. Osnovne morfometrijske proporcije ove lubanje prikazane u tabeli 1, uspoređenesu sa istim proporcijama lubanja na uzorcima populacija špiljskih medvjeda iz špiljeOrlovače (10), Đurkovine (18) i Megare (13), u Bosni i Hercegovini, pleistocenskihlokaliteta iz Hrvatske (Krapina, Lokve, Cerovec) (3) i Slovenije (Mokriška jama, Potočka
Page 109
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... Veterinaria 58 (1-2),97-109, Sarajevo 2009.103zijalka) (19), u odnosu na opći varijacijski raspon kod vrste Ursus spelaeus Rosenmüller& Heinroth, 1794 prema Hütteru (4) (tab. 1). Slika 4. Lubanja špiljskog medvjedanađena u Špilji na Vrelu MokranjskeMiljacke prikazana u superiornoj (A),inferiornoj (B) i lateralnoj (C) projekcijiFigure 4. Cave bear skull from the Cave ofVrelo Mokranjska Miljacka in superior(A), inferior (B) and lateral (C) view Osim proporcija navedenih u tab. 1, učinili smo dodatnu morfometrijsku obradu,koristeći proporcije koje se primijenjuju u morfometriji kranijalnog skeleta recentnihmedvjeda (prema usmenom navodu dr. sc. Dalibora Balliana). One uključuju ukupnuduljinu kranijuma: premaksila/bazilarni nastavak (406,0 mm), premaksila/bregma (320,0mm), bregma/protuberantia occipitals externa (349,0 mm), palatinalnu duljinu (205,0mm), duljinu C-M2 (149,0 mm), duljine nosne kosti (45,5 mm), supraorbitalnu širinu(110,9 mm), interorbitalnu širinu (92,0 mm), preorbitalnu širinu (80,8 mm) te širinuizmeđu mastoinih nastavaka (178,0 mm). Duljina dijasteme iznosi 35,0 mm.
Page 110
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... 104 Tabela 1. Usporedba morfometrijskih proporcija kranijalnog skeleta špiljskog medvjeda (Ursusspelaeus Rosenmüller & Heinroth, 1794) nađenoj u Špilji na Vrelu Mokranjske Miljacke saproporcijama populacija iz Orlovače (10), Đurkovine (18) i Megare (13) (BiH), te populacije izHrvatske (3) i Slovenije (19) u odnosu na opći varijacijski raspon (4)Table 1. The comparison of cranial skeleton morphometric proportions of the cave bear (Ursusspelaeus Rosenmüller & Heinroth, 1794) found in the Cave of Vrelo Mokranjska Miljacka with thesame proportion of populations from Orlovača (10), Đurkovina (18) and Megara (13) (BiH),populations form Croatia (3) and Slovenia (19), in comparison with the general variation range (4) BOSNA I HERCEGOVINAŠpilja na Vrelu MokranjskeMiljacke, Kadinoselo, MokroOrlovača, Mokro(Malez i sur, 1987.)Đurkovina, Grebci(Malez, 1987.)Megara, Bjelašnica(Malez i Slišković, 1989.)HRVATSKAKrapina, Lokve, Cerovac, (Herak, 1947.)SLOVENIJA Mokriška jama, Potočka zijalka, (Rakovec, 1967.)Opći varijacijski raspon(Hütter, 1955.)Ursus spelaeusRosenmüller &Heinroth, 1794Izmjere izražene u milimetrima (mm)Bazilarnaduljina374,5410,0-344,0-412,0326,0-458,0370,0-485,0345,0-421,0320,0-462,0Raspon C-C84,099,8-86,0-115,081,0-115,096,0-110,0102,295,0-128,0RasponM2-M298,2110,0-101,0-115,093,0-113,598,0-118,0103,5-113,0107,0-138,0Širinajagodičnihlukova223,0268,0-ca 290,0198,0-288,5260,0-286,0268,0-296,2234,0-306,6Širina čela110,9123,3138,0101,0-140,0100,0-145,0105,0-144,0100,0-136,5116,4-181,0Širinastražnjegdijela178,5203,0-174,0-224,0142,5-240,0196,0-220,0212,7-224,0188,0-248,0Visinagubice77,578,0-74,0-90,066,0-95,0 75,0-94,0--Visina čela84,079,0-75,0-85,067,0-97,0125,0-158,0--Visinastražnjegdijela122,1125,0128,0112,0-127,0102,5-155,0103,0-118,0133,0-144,0112,0-147,0Duljina P4-M281,099,5-85,0-98,083,0-99,3 83,0-97,389,7-93,792,3-97,2 Zubi (Dentes)U opisu zuba u svrhu njihovih morfoloških odnosno morfometričkih odlikakoristili smo morfometrijske proporcije prema Heraku (3) i Rodeu (20). Dobivenirezultati mjerenja prikazani su u tabeli 2.Odontološkom opservacijom obuhvaćena su u potpunosti očuvana i usidrenadva premolara (P4), te ukupno četiri molara (po dva M1 i M2), koji su za potrebe mjerenja
Page 111
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... Veterinaria 58 (1-2),97-109, Sarajevo 2009.105pažljivo ekstrahirani iz zubnih alveola. Nađeno je da prvi molari (M1) imaju tri korijena:jedan palatinalni i dva vestibularna, od kojih je jedan bukomezijalni a drugi bukodistalni.Drugi molari (M2) imaju četiri zubna korijena: dva palatinalna i dva vestibularna.Budući da su s obje strane prisutne zubne alveole ispred premolara (P4),promatrana je jedinka imala i još po jedan ekstrapremolar (P3) sa jednim zubnimkorijenom. Dodatni premolari su ispali postmortalno i nisu nađeni u blizini lubanje.Izmjerena anterio-posteriorna i medio-lateralna širina alveola iznosi 5,1 sa 5,0 mm nalijevoj, te 5,0 sa 5,0 na desnoj strani strani gornje čeljusti. Na molarima je izražen vrlokompleksan fisurni sustav, pri čemu M2 posjeduju mrežasti fisurni sustav dok je kod M1prisutan jedostavan sustav fisura (sl. 5). Tabela 2. Usporedba anterio-posteriorne i medio-lateralna širine (mm) premolara i molarašpiljskog medvjeda nađenog u špilji na Vrelu Mokranjske Miljacke, sa istim mjerama zubi nađenihu Megari (Bjelašnica) (13), u odnosu na opći varijacijski raspon (8)Table 2. The comparison of anterio-posterior and medio-lateral weight of premolars and molars ofcave bear found in the Cave of Vrelo Mokranjska Miljacka with the same teeth proportions foundin Megara (Bjelašnica) (13) in comparison with the general variation range (8)Špilja na Vrelu MokranjskeMiljackeKadino selo, MokroDentes laterisinistriDenteslateridextriMegara,Bjelašnica(Malez iSlišković,1989.)Općivarijacijskiraspon(Malez, 1965.)Ursus spelaeusRosenmüller &Heinroth, 1794Izmjere izražene u milimetrima (mm)P4širina ant.-post.širina med.-lat.17,112,016,513,018,813,115,0-24,211,0-19,0M1širina ant.-post.širina med.-lat.25,519,025,019,028,019,822,3-33,215,2-23,7M2širina ant.-post.širina med.-lat.41,021,040,121,043,5-48,022,0-25,233,9-61,217,0-27,0 Nakon izvršenih morfometrijskih mjerenja kostiju kranijuma i njihoveusporedbe sa navedenim populacijama, nađeno je da su njihove vrijednosti u okviruvarijacijskog raspona populacija iz Megare (13), te općeg varijacijskog raspona (4), dokse morfometrijske proporcije zuba uklapaju u potpunosti u opći varijacijski raspon koji jepostavio Malez (8).
Page 112
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... 106 Slika 5. Gornji premolari i molari sa izraženim sustavom fisura. Alveole od dodatnog premolara salijeve i desne strane, obilježene su strelicamaFigure 5. Upper premolars and molars with extensive fissure system. Alveoles of extra premolars,right and left, marked with arrows Diskusija Za morfometrijsko proučavanje na raspolaganju smo imali jednu gotovocjelovitu i iznimno očuvanu lubanja špiljskog medvjeda (Ursus spelaeus Rosenmüller &Heinroth, 1794) nađenu u fosilnom dijelu špilje na Vrelu Mokranjske Miljacke. Lubanjaposjeduje anatomsku građu tipičnu za vrstu Ursus spelaeus Rosenmüller & Heinroth,1794. Glabela je istaknuta nešto slabije, no dobro istaknut i razvijen sagitalni greben kojise prema čelu račva u obliku slova „V“ upućuje da lubanja pripada najvjerojatnijemužjaku. Reducirano zubalo i građa kruna na premolarima i molarima ima čistespeleoidne značajke. Na lubanji je postmortalno odbijen desni jugalni luk i desnicondylus occipitalis. Desni jugalni luk nađen je u neposrednoj blizini lubanje. Iz alveolasu postmortalno ispali svi incizivi i oba kanina na što upućuju razvijene alveole bezostatka korjenova. Krune su na gornjim premolarima i molarima izuzetno dobro očuvanebez tragova abrazije, a na drugim molarima osobito je istaknut kompleksan, mrežastisustav fisura (sl. 5). Šavovi na lubanji su uočljivi i nisu u potpunosti srasli. Na temeljupromatranja otvorene medijalne palatinalne suture, te otvorene nazofaringealne suture,možemo izvesti zaključak da se radi o mladom primjerku. Opservacijom kranijalnihkostiju nisu uočene patološke promjene, sve anatomske strukture su normalnog izgleda imorfoanatomskih odnosa. Morfometrijske izmjere lubanje iz špilje na Vrelu Mokranjske Miljacke uklapajuse u varijacijski raspon populacija u Megari (13), izuzev duljine P4-M2 (81,0 mm) kojomse spustila donja granica raspona. Na temelju usporedbe zaključuje se da lubanja nađenau špilji na Vrelu Mokranjske Miljacke pripada krupnom ali mladom primjerku čiji razvoj
Page 113
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... Veterinaria 58 (1-2),97-109, Sarajevo 2009.107nije u potpunosti završen. Stoga se dobivene morfometrijske proporcije moraju uzeti srezervom pri određivanju veličine. Prema Heraku (3), zubi su od ključnog značaja za istraživanje morfoloških ali ibioloških odlika svih sisavaca, budući da stoje u izravnom odnosu sa načinom ishraneživotinje, te koreliraju sa odnosima u morfologiji skeleta. Na temelju morfometrijskihproporcija izmjerenih premolara (P4) i molara (M1 i M2) zuba vidljivo je da se oniuklapaju u opći varijacijski raspon prema Malezu (8). Međutim, nešto manje proporcije uodnosu na populaciju iz Megare (13) potvrđuju naše opažanje da se radi o vrlospecifičnojj jedinki na temelju koje nije moguće donositi konačne zaključke omorfometrijskim proporcijama. Svakako da je broj pronađenih zuba špiljskog medvjeda ušpilji na Vrelu Mokranjske Miljacke premalen da bi se moglo govoriti o frekvencijimorfotipova kako je to bilo moguće odrediti na temelju zuba pronađenih u špiljiĐurkovini prema Paunović (18) i Orlovači prema Malezu (10). Špilja Vrelo Mokranjske Miljacke špiljskim medvjedima najvjerojatnije nijeslužila za brloženje, budući da nisu nađeni tragovi koji bi na tu pretpostavku upućivali.Tragovi „medvjeđeg brušenja“ nisu do sada nađeni u fosilnom kanalu, što je po našemmišljenju posljedica nedovoljne istraženosti. Naime, sva dosadašnja istraživanja imala suisključivo speleološki i speleobiološki karakter (kao dio projekta „Genetičkadeterminacija endemičnih vrsta iz špiljskog sustava Vjetrenica u cilju podizanja znanja obiodiverzitetu u FBiH“ podržanog od Federalnog ministarstva okoliša i turizma). Zaključci Na temelju sprovedenih terenskih istraživanja u špilji na Vrelu MokranjskeMiljacke, na lokalitetu Kadino selo (Mokro), doneseni su sljedeći zaključci:Špilja na Vrelu Mokranjske Miljacke u morfološkom pogledu pripada složenomtipu speleoloških objekata sa aktivnim i brojnim bočnim kanalima. To je druga poveličini špilja u Bosni i Hercegovini sa blizu 6.000 m kanala. Nađena lubanja pripada mladom, ali vrlo krupnom primjerku vrste Ursusspelaeus Rosenmüller & Heinroth, 1794 za kojeg je na temelju opisanih morfološko-anatomskih karakteristika ocijenjeno da se najvjerojatnije radi o mužjaku.Morfološko-anatomskom analizom temeljenom na usporedbi morfometrijskihproporcija kranijalnog skeleta nađenog u Špilji na Vrelu Mokranjske Miljacke, sapopulacijama iz Bosne i Hercegovine (Orlovača, Đurkovina, Megara), Hrvatske iSlovenije, potvrđeno je nedvojbeno uklapanje u raspon utvrđen za populacije iz Megare,te u opći varijacijski raspon. Novonađeni lokalitet najvjerojatnije nije špiljskom medvjedu služio zabrloženje.Paleobiološka, ali i kvartarnogeloška i paleontološka istraživanja u ovoj špiljineophodno je nastaviti kako bi se dobilo više podataka u pleistocenskoj fauni ovogaprostora, što nije upitno s obzirom na blizinu špilje Orlovače iz koje su već opisana
Page 114
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... 108nalazišta kako špiljskog medvjeda Ursus spelaeus Rosenmüller & Heinroth, 1794 ali iholocenske faune (Caprex ibex, Sus scrofa, Bos brachyceros).LITERATURA1. Brajković D. 1992: Bibliografija radova Mirka Maleza. U: Majer, V. (Ur.),Mirko Malez 1924 – 1990. HAZU, Spomenica preminulim akademicima, Sv.66, 19-51, Zagreb.2. Grimmer I. Fosilni ostaci sisavaca iz Save. Glasnik Zemaljskog muzeja u Bosnii Hercegovini. 1898; 10(2-3):377-385.3. Herak M. Starost i sistematske značajke spiljskog medvjeda Hrvatske. Geološkivjesnik. 1947;(1):12-47.4. Hütter E. Der Höhlenbär von Merkstein. Ann. Naturhist. Mus. Wien.1955;60:122-168.5. Fiala F. Pretraživanje pećina u Bosni. Glasnik Zemaljskog muzeja u Bosni iHercegovini. 1892;4 (3):237-243.6. Kulenović E. Geološke i paleontološke karakteristike spilje Kuk u kanjonuBistrice (jugoistočna Bosna). Geološki glasnik.1983;(28):5-63.7. Lenardić J. Nova nalazišta kvartarnih vertebratskih fauna u spiljama Jugoslavije.Speleologica Croatica. 1990;(1):53-59. 8. Malez M. Novi opći varijacijski raspon vrste Ursus spelaeus Rosenmüller &Heinroth, 1794. Geološki vjesnik. 1965;18(1):133-139.9. Malez M. Paleontološka i paleolitska istraživanja u 1972. godini. LjetopisHrvatske akademije znanosti i umjetnosti. 1973; (77): 279-289.10. Malez M, Lajtner I, Paunović M, Slišković T. Kvartanogeološka i paleontološkaproučavanja u špilji Orlovači kod Sarajeva (SR Bosna i Hercegovina). KršJugoslavije. 1987;12(3):39-75. 11. Malez M, Slišković T, Kapel A. Gornjopleistocenski sisavci (Mammalia) izpećine kod Ugljevika (SR Bosna i Hercegovina, Jugoslavija). GlasnikZemaljskog muzeja Bosne i Hercegovine (Prirodne nauke). 1988a;NS(27):11-34.12. Malez M, Slišković T. Kenozojski sisavci (Mammalia) Bosne i Hercegovine.Zemaljski muzej Bosne i Hercegovine. Zbornik referata naučnog skupa„Minerali, stijene, izumrli i živi svijet BiH“. Sarajevo, 7-8. oktobar 1988b.13. Malez M., Slišković T.: Kronostratigrafske i morfometrijske značajke spiljskogmedvjeda (Ursus spelaeus Rosenm. & Heinroth) iz Megare na Bjelašnici.Poseban otisak iz „Glasnika Zemaljskog muzeja Bosne i Hercegovine“. Prirodnenauke.1989;NS(28):7-53.14. Mulaomerović J. Novo nalazište pećinskog medvjeda. Naše jame. 1985;27:44-46.
Page 115
Lukić-Bilela Lada i sar.: Novo nalazište špiljskog medvjeda (Ursus spelaeus Rosenmüller... Veterinaria 58 (1-2),97-109, Sarajevo 2009.10915. Mulaomerović J. Breve storia delle ricerche speleologiche in Bosnia eErzegovina. Labitinti. 2006a;21(41):10-15.16. Mulaomerović J, Zahirović D, Handžić E. Katastar speleoloških objekata Bosnei Hercegovine. Sarajevo: Speleološko društvo „Speleo dodo“; 2006b. str. 1-274.17. Mulaomerović J, Milanolo S, Zukanović A, Husanović H. Speleološki komplekskamenolom Stijene – Ponikva. Susret speleologa Bosne i Hercegovine; 2007Apr 14-15; Zavidovići, Bosna i Hercegovina.18. Paunović M. Morfogenetsko proučavanje kutnjaka vrste Ursus spelaeus iz spiljeĐurkovine u Hercegovini. Glasnik Zemaljskog Muzeja (Prirodne Nauke).1988;NS (27):51-56.19. Rakovec I. Jamski medved iz Mokriške jame v Savinskih Alpah. (Slovenia,Yugoslavia). Razprave, IV razr. SAZU.1967;10(4):121-203.20. Rode K. Untersuchungen über das Gebiss der Bären, Monographien zurGeologie und Paläontologie. 1935; Ser. II, Leipzig (7):1-163. Uredništvo primilo rukopis 13.04.2009.
Page 116
Page 117
Muzaferović Š. i sar.: Analiza sastava biljne zajednice i komponente sitnih sisara gradskog parka... Veterinaria 58 (1-2),111-120, Sarajevo 2009.111 ANALIZA SASTAVA BILJNE ZAJEDNICE I KOMPONENTE SITNIHSISARA GRADSKOG PARKA ILIDŽAANALYSIS OF PLANT COMMUNITIES COMPOSITION AND SMALLMAMMALS COMPONENTS IN TOWN PARK ILIDŽAMuzaferović Š., Aladžuz A.3 Abstract - During the year of 2005, a systematic research was undertaken withan objective to calculate a number of small mammal species in the town area. One of themany explored sites was the town park Ilidža. During the spring and summer season of2005, the traps with the Trapist cheese and chicken were set in this part of town twice perseason.During the spring season, 13 individuals of two species were captured:Apodemus sylvaticus (totally 12 individuals), and only one individual of species Microtussubterranus.During the summer season, 29 individuals of four species were captured:Apodemus sylvaticus (totally 24 individuals), Microtus subterranus (three individuals),and only one individual of two species: Rattus rattus and Sorex araneus.In total, during the spring and summer season, 42 individuals were caught, moreprecisely: 36 individuals of species Apodemus sylvaticus, four individuals of speciesMicrotus subterranus, and only one individual of two species: Rattus rattus and Sorexaraneus.All captured individuals were marked during the spring season, but only onemarked individual of species Apodemus sylvaticus was caught in the summer season.This is a very firm evidence that the populations of the small mammals, especially thesespecies, are extremely large in the town areas, predominantly on the park terrains.

Download full-text

Full-text

Available from: Admir Aladžuz, May 21, 2014
4 Followers
 · 
1,629 Views
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Scientific and professional contribution of assistant professor Šefkija Muzaferović. It has been presented an overview of Šefkija Muzaferović (1966-2012) scientific contribution, an ecologist who dedicated his life to studying micromammalia. As Assistant professor on Faculty of Science, University of Sarajevo he was favoured lecturer and pedagogue as well as author of numerous scientific and professional publication in field of ecology and biodiversity of micrommalia.