Identification of a gene encoding a bacteriophage-related integrase in a vap region of the Dichelobacter nodosus genome

Department of Biochemistry, Microbiology and Nutrition, University of New England, Armidale, N.S.W., Australia.
Gene (Impact Factor: 2.14). 09/1995; 162(1):53-8. DOI: 10.1016/0378-1119(95)00315-W
Source: PubMed


Dichelobacter nodosus is the principal causative agent of ovine footrot. Nucleotide (nt) sequences from the D. nodosus genome have been isolated and a series of overlapping lambda clones defining vap (virulence-associated protein) regions 1, 2 and 3 have been reported [Katz et al., J. Bacteriol. 176 (1994) 2663-2669]. In the present study, the limits of the virulence-associated (va) DNA around vap regions 1 and 3 were determined by dot-blot hybridization experiments using plasmid subclones to probe genomic DNA from the D. nodosus virulent strain A198 and the benign strain C305. This va region was found to be approx. 11.9 kb in length, and to be interrupted by a short DNA segment which is also found in the benign D. nodosus strain. Sequence analysis of the entire region revealed an ORF, intA, which is very similar to the integrases of bacteriophages phi R73, P4 and Sf6. Bacteriophages phi R73 and P4 integrate into the 3' ends of tRNA genes, with the integrase genes adjacent to the tRNA genes. A similar arrangement was found in the D. nodosus va region. A 19-bp nt sequence was found to be repeated at the ends of the va region, and may represent the bacteriphage attachment site. These findings suggest that D. nodosus may have acquired these DNA sequences by the integration of a bacteriophage, or an integrative plasmid that contains a bacteriophage-related integrase gene. The high similarity of the D. nodosus integrase to integrases from coliphages suggests that these va sequences may be transferred between distantly related bacteria.(ABSTRACT TRUNCATED AT 250 WORDS)

4 Reads
  • Source
    • "Comparative analysis of DNA from virulent and benign strains has led to the identification of a series of genetic elements that integrate into the D. nodosus chromosome. These include the intA (Katz et al., 1991, 1992, 1994; Cheetham et al., 1995; Billington et al., 1996), intB (Bloomfield et al., 1997), intC (Bloomfield et al., 1997) and intD elements (Tanjung et al., 2009), each of which contains an integrase gene. A fifth integrated element, the virulencerelated locus, vrl (Katz et al., 1991; Haring et al., 1995; Billington et al., 1999), lacks an integrase gene. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The Gram-negative anaerobe Dichelobacter nodosus is the causative agent of footrot in sheep. Different strains of D. nodosus cause disease of differing severities, ranging from benign to virulent. Virulent strains have greater twitching motility and secrete proteases that are more thermostable than those secreted by benign strains. We have identified polynucleotide phosphorylase (PNPase) as a putative virulence regulator and have proposed that PNPase expression is modulated by the adjacent integration of genetic elements. In this study, we compared PNPase activity in three virulent and four benign strains of D. nodosus and found that PNPase activity is lower in virulent strains. We disrupted the pnpA gene in three benign D. nodosus strains and two virulent strains and showed that deletion of the S1 domain of PNPase reduced catalytic activity. In all but one case, deletion of the PNPase S1 domain had no effect on the thermostability of extracellular proteases. However, this deletion resulted in an increase in twitching motility in benign, but not in virulent strains. Reconstruction of the pnpA gene in two mutant benign strains reduced twitching motility to the parental level. These results support the hypothesis that PNPase is a virulence repressor in benign strains of D. nodosus.
    FEMS Microbiology Letters 10/2009; 302(1):39-45. DOI:10.1111/j.1574-6968.2009.01831.x · 2.12 Impact Factor
  • Source
    • "All three sequences differed for the first 51 nt, and were identical after this point, suggesting that the att site is found 189 nt upstream of the integrase gene. This is the approximate position of the att sites of the intA, intB and intC elements of D. nodosus [4] [8] and of bacteriophages such as P4 [33] [34]. The att site for DinoHI was defined as the 20 nt sequence TTTGTATGATGTGGGCATCA from DinoHI (GenBank accession no EU048235, bold in Fig. 4) which shows 90% identity at the left junction (attL, upstream from intP) and 80% identity at the right junction (attR, Fig. 4B "
    [Show abstract] [Hide abstract]
    ABSTRACT: The Gram-negative anaerobic pathogen Dichelobacter nodosus carries several genetic elements that integrate into the chromosome. These include the intA, intB, intC and intD elements, which integrate adjacent to csrA and pnpA, two putative global regulators of virulence and the virulence-related locus, vrl, which integrates into ssrA. Treatment of D. nodosus strains with ultraviolet light resulted in the isolation of DinoHI, a member of the Siphoviridae and the first bacteriophage to be identified in D. nodosus. Part of the DinoHI genome containing the packaging site is found in all D. nodosus strains tested and is located at the end of the vrl, suggesting a role for DinoHI in the transfer of the vrl by transduction. Like the intB element, the DinoHI genome contains a copy of regA which has similarity to the repressors of lambdoid bacteriophages, suggesting that the maintenance of DinoHI and the intB element may be co-ordinately controlled.
    The Open Microbiology Journal 02/2008; 2(1):1-9. DOI:10.2174/1874285800802010001
  • Source
    • "A comparison of the virulent and benign strains of Dichelobacter nodosus, a principal causative agent of the ovine footrot, revealed that the acquisition of vap and vrl regions encoding several virulence related genes has transformed an otherwise benign strain into a virulent strain [46,47]. Similarly, the virulent strains of Vibrio cholerae acquired a 45 kb PAI that includes the tcp-acf gene cluster involved in colonization and the toxT gene involved in the regulation of cholera toxin. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Bacterial genomes develop new mechanisms to tide them over the imposing conditions they encounter during the course of their evolution. Acquisition of new genes by lateral gene transfer may be one of the dominant ways of adaptation in bacterial genome evolution. Lateral gene transfer provides the bacterial genome with a new set of genes that help it to explore and adapt to new ecological niches. A maximum likelihood analysis was done on the five sequenced corynebacterial genomes to model the rates of gene insertions/deletions at various depths of the phylogeny. The study shows that most of the laterally acquired genes are transient and the inferred rates of gene movement are higher on the external branches of the phylogeny and decrease as the phylogenetic depth increases. The newly acquired genes are under relaxed selection and evolve faster than their older counterparts. Analysis of some of the functionally characterised LGTs in each species has indicated that they may have a possible adaptive role. The five Corynebacterial genomes sequenced to date have evolved by acquiring between 8-14% of their genomes by LGT and some of these genes may have a role in adaptation.
    BMC Evolutionary Biology 02/2007; 7 Suppl 1(Suppl 1):S8. DOI:10.1186/1471-2148-7-S1-S8 · 3.37 Impact Factor
Show more