The human immunodeficiency virus type 1 long terminal repeat is activated by monofunctional and bifunctional DNA alkylating agents in human lymphocytes.

Abstract

The activation of the human immunodeficiency virus, type 1 (HIV-1) by the DNA alkylating agents ethyl methanesulfonate, methyl methanesulfonate, and mitomycin C was observed in human B lymphocytes transiently transfected with plasmids in which the HIV-1 long terminal repeat (LTR) directed the expression of the bacterial chloramphenicol acetyltransferase gene. Deletion of the two NF-kappa B-binding sites of LTR abolished the HIV-1 activation induced by the three mutagens, while deletion of the three Sp1-binding sites slightly reduced it. Electrophoretic mobility shift assays revealed an increased binding to the kappa B sites of HIV-1 LTR in the nuclear extracts of human B lymphocytes upon mutagen treatment, while binding to Sp1 sites was unaffected. The TAR region was also involved in the mutagen-mediated activation of HIV-1 LTR inasmuch as a small deletion in the TAR sequence (nucleotides +34 to +37) greatly decreased the induction of HIV-1 expression. Moreover, an enhanced binding activity to the TAR DNA sequence (nucleotides +24 to +47) was observed in nuclear extracts of mutagen-treated lymphocytes. Thus, both the enhancer and the 5'-untranslated region of HIV-1 functionally cooperate in the mutagen-mediated induction of HIV-1 expression.

Full text

Page 1

THE J~URNAL
0 1993 by The American Soeiety for Biochemistry and Molecular Biology. Inc.
OF BIOLOQICAL
CHEMISTRY
Vol. 268, No. 35, Issue of December 15, pp. 26’719-26724.1993
Printed in U.S.A.
The Human Immunodeficiency Virus Type 1 Long Terminal Repeat Is
Activated by Monofunctional and Bifunctional DNA Alkylating Agents
in Human Lymphocytes*
(Received for publication, June 9, 1993, and in revised form, August 4, 1993)
Ileana Quinto$#1, Maria Rosaria RuoccoSI), Francesca BaldassarreSII, Massimo Mallardo$**,
Emilia DragonettiS, and Giuseppe Scala$
From the SDipartimento di Bwchimica e Bwtecnologie Mediche, Uniuersita degli Studi “Federico II,”80131 N a p l e s and the
BDipartimento di Medicinu Sperimentale e Clinica, Universita degli Studi di Reggw Calabria, 88100 Catanzaro, Italy
The activation of the human immunodeficiency vi-
rus, type 1 (HIV- 1) by the DNA alkylating agents ethyl
methanesulfonate, methyl methanesulfonate, and mi-
tomycin C was observed in human B lymphocytes tran-
siently transfected with plasmids in which the HIV-1
long terminal repeat (LTR) directed the expression of
the bacterial chloramphenicol acetyltransferase gene.
Deletion of the two NF-KB-binding sites of LTR abol-
ished the HIV-1 activation induced by the three muta-
gens, while deletion of the three Spl-binding sites
slightly reduced it. Electrophoretic mobility shift as-
says revealed an increased binding to the KB sites of
HIV-1 LTR in the nuclear extracts of human B lym-
phocytes upon mutagen treatment, while binding to
Spl sites was unaffected. The TAR region was also
involved in the mutagen-mediated activation of HIV- 1
LTR inasmuch as a small deletion in the TAR sequence
(nucleotides +34 to +37) greatly decreased the induc-
tion of HIV- 1 expression. Moreover, an enhanced bind-
ing activity to the TAR DNA sequence (nucleotides
+24 to +47) was observed in nuclear extracts of mu-
tagen-treated lymphocytes. Thus, both the enhancer
and the 5’-untranslated region of HIV-1 functionally
cooperate in the mutagen-mediated induction of HIV-
1 expression.
The human immunodeficiency virus, type 1 (HIV-l),’ the
causative agent of AIDS, is a retrovirus infecting CD4+ T and
B lymphocytes, monocytes, and glia cells (for review see Ref.
1). After a latency period, HIV-1 undergoes activation when
the host cell is stimulated in response to a variety of stimuli
* This study was supported by grants from Istituto Superiore di
Sanitti-Sesto Progetto Ricerche sull’AIDS, Associazione Italiana per
la Ricerca sul Cancro and Consiglio Nazionale delle Ricerche (CNR)
Target Project on Biotechnology and Biostrumentation. The costs of
publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked “aduer-
tisement” in accordance with 18 U.S.C. Section 1734 solely to indicate
this fact.
(I To whom correspondence should be addressed Dipartimento di
Biochimica e Biotecnologie Mediche, Via S. Pansini 5, 1-80131, Na-
ples, Italy. Tel.: 39-81-7463157; Fax: 39-81-7463150.
I( Supported by fellowships from AIRC.
** Supported by a fellowship from the Consiglio Nazionale delle
Ricerche.
‘The abbreviations used are: HIV-1, human immunodeficiency
virus, type 1; PMA, phorbol 12-myristate 13-acetate; LTR, long
terminal repeat; CAT, chloramphenicol acetyltransferase; Mit C,
mitomycin C; MMS, methylmethane sulfonate; EMS, ethylmethane
sulfonate; IL, interleukin.
such as PMA or phytohemagglutinin (PHA) (2-41, antigens
(5), cytokines (6-9), and viruses (10-14). The activation of
HIV-1 results from the expression of regulatory and structural
genes whose transcription is under the control of LTR se-
quences. The LTR sequences include three regions involved
in the positive control of HIV-1 gene expression: the minimal
promoter consisting of a TATA box (15, 16) and three Spl
sites (17), the enhancer region encompassing two NF-KB-
binding sites (2), and the TAR element required for the
binding to the Tat viral transactivator (4, 18-20) as well as
to cellular DNA- and RNA-binding proteins (21-32). The KB
sites are mostly required for the transcriptional induction of
HIV-1 by phorbol esters (2-4,33), cytokines (7,8), and viruses
(12, 14). Moreover, cellular proteins that are induced by
mitogens and bind to the KB motif in the HIV-1 LTR have
been identified (22,34-38).
Mutagens are chemical and physical agents that damage
DNA and promote tumorigenicity (39). Recent evidence in-
dicates that mutagens induce the transcription of different
cellular genes, such as c-fos, metallothionein, and collagenase
(for review see Ref. 40). These genes are also activated by
agents such as PMA and lectins (41,42), which are all involved
in the transcriptional activation of the HIV-1 LTR. This
suggests that mutagens could affect the latency state of HIV-
1 by inducing the transcription of HIV-1 genes. Indeed, a few
mutagens such as UV radiation, Mit C, 4-nitroquinoline oxide,
and photoactivated psoralen were reported to activate the
HIV LTR-cat gene expression (43, 44), while others such as
gamma rays, N-methyl-N’-nitro-N-nitrosoguanidine
MMS were inefficient (45). UV radiation and photoactivated
psoralen also activated the HIV-1 LTR in transgenic mice
(46). Moreover, the replication of HIV-1 was induced in
chronically infected promonocytic cells by benzo(a)pyrene
(47), a well known mutagen and carcinogen. The molecular
mechanisms of the mutagen-mediated activation of HIV-1
expression are still unclear.
In this paper we addressed the question of whether the
induction of HIV-1 expression by mutagens is related to the
nature of DNA lesions and which HIV-1 regulatory elements
are required for this activation. For this purpose, we examined
the expression of the reporter cat gene linked to the HIV-1
LTR sequences transiently transfected in human B lympho-
cytes following the treatment with the bifunctional alkylating
agent Mit C and the monofunctional alkylating agents MMS
and EMS. Mit C causes monoadducts and interstrand or
intrastrand cross-links to DNA, while MMS and EMS pro-
duce exclusively monoadducts to DNA (39). Our data indicate
that all three mutagens significantly induced the HIV-1 LTR-
and
26719

Page 2

26720
Mutagen-mediated Induction of HIV-1 Expression
driven CAT activity. This induction required functional KB
sites in the enhancer, reaching the maximal level when the
Spl sites were present in the promoter. Accordingly, the KB
binding activity was enhanced in the nuclear extracts of cells
treated with mutagens. Moreover, the integrity of the DNA
TAR sequence was required for the full activation of HIV-1
expression by the three mutagens and for the binding of a
cellular protein(s) whose activity was increased by the chem-
ical treatment. These results indicate that the enhancer of
HIV-1 LTR and the 5”untranslated region of HIV-1 func-
tionally cooperate in the up-regulation of HIV-1 expression
during the cellular genotoxic distress.
MATERIALS AND METHODS
plasmid pILIC-CAT, hereafter referred to as
pWTcat, carrying the wild type HIV-1 LTR and the 5’-untranslated
sequence (+1/+80) fused to the cat gene, the derivative mutant
plasmids, and the pSVtat plasmid expressing the Tat transactivator
protein (48, 49) were kindly provided by Dr. A. Rabson. The mutant
plasmids were: pNFA, lacking the two KB sites; pSpA, lacking the
three Spl sites; pTA, lacking both the KB and the Spl sites; and
pTAR, carrying a 4-base pair deletion at the TAR region (Fig. 1).
Cells, Plasmid Transfections, and Mutagen Treatments-MC3 cells,
an Epstein-Barr virus-positive B lymphocyte cell line (50), were
cultured in Dulbecco’s modified Eagle’s medium supplemented with
10% (v/v) heat-inactivated fetal calf serum (Flow Laboratories, Italy),
3 m M glutamine, and 10 m M Hepes buffer pH 7.2 (Gibco Laboratories,
Italy). Cells were transfected by electroporation as previously de-
scribed (50). Briefly, cells (8 X lo6) in exponential growth phase were
washed and resuspended in 0.8 ml of Ca2+- and M$+-free phosphate-
buffered saline in the presence of 10 pg of plasmid DNA. Transfection
efficiency between different plasmids was monitored by co-transfect-
ing the cells with 20 pg of a second independent indicator plasmid,
pRSV-B-gal (51), expressing the ZncZ gene under the transcriptional
control of the Rous sarcoma virus LTR. Cells were subjected to a
single electrical pulse (0.2 kV, 960
apparatus, recovered, cultured in Dulbecco’s modified Eagle’s
supplemented with 10% fetal calf serum, and 2 days later collected
for CAT and @-galactosidase assays. To check the responsiveness of
HIV-1 LTR CAT plasmids (wild type and mutants) to the viral Tat
transactivator, transient expression assays were also performed by
transfecting each HIV-1 LTR plasmid (10 pg) with or without pSVtat
plasmid (2 pg). For mutagen treatments, cells were divided 12 h after
transfection into aliquots to be mutagen-treated or left untreated.
Mit C (Kyowa, Japan) was tested at 5-30 p ~ ;
tested at 0.25-1 mM; and EMS (Sigma) was tested at 2.5-20 mM.
Two days post-treatment the cells were harvested, washed with
phosphate-buffered saline, and collected for CAT assay. The transient
expression experiments were performed at least 5 times for each
chemical treatment using different plasmid preparations.
Assay of CAT and j3-Galactosidase Activities-Cell
prepared by three cycles of freezing-thawing in 0.2 ml of 0.25 M Tris,
pH 7.8, and CAT and j3-galactosidase assays were performed as
described (51, 52). Proteins were measured in each cell extract with
the Bio-Rad protein assay kit, and equal amounts of proteins were
analyzed for each sample. Each CAT assay contained 10-50 pg of
proteins, 20 pl of 4 m M CoASAc (Boehringer Mannheim, Germany),
1 pl (0.5 pCi) of [14C]chloramphenicol (Du Pont NEN) in a final
volume of 150 pl of 0.25 M Tris, pH 7.8. The cell extracts were used
at protein concentrations ensuring linear conversion of substrate in
each reaction. Reactions were incubated at 37 “C for 3 h, extracted
with ethyl acetate, dried, and spotted on Polygram Si1 G silica gel
plates (Macherey-Nagel, Germany). Plates were run in a TLC tank
containing chloroform:methanol(95:5). After a 16-h autoradiography,
the TLC plates were cut and samples were counted in a Beckman
LS5000TD scintillation counter. The percent acetylation of [“C]
chloramphenicol was determined by scintillation counting the una-
cetylated and the acetylated forms resolved by thin-layer chromatog-
raphy. The CAT activity was expressed as the percent of acetylated
chloramphenicol/30 pg of protein/3 h. For the @-galactosidase assay,
200 pg of cell extracts were incubated with 200 p1 of o-nitrophenylp-
D-galactopyranoside (4 mg/ml) in 1 ml of 60 m M Na2HP04, 40 m M
NaHzP04, 10 m M KC1 at 37 “C until a yellow shade appeared, and
the reaction was stopped by adding 0.5 ml of 1 M Na2C03. The @-
Plasmids-The
microfarads) using a Bio-Rad
medium
MMS (Sigma) was
extracts were
galactosidase activity was expressed as A420nm X 100/pg of protein/l
h.
Electrophoretic Mobility Shift Assays-Nuclear extracts and gel
retardation assays were performed as described (44). Briefly, cells
were harvested, washed twice in cold phosphate-buffered saline, and
resuspended in lysing buffer (10 m M Hepes pH 7.9, 1 m M EDTA, 60
m M KC1, 1 m M dithiothreitol, 1 m M phenylmethylsulfonyl fluoride,
0.2% (v/v) Nonidet P-40) for 5 min. Nuclei were collected by centrif-
ugation (500 X g, 5 rnin), rinsed with Nonidet P-40-free lysing buffer,
and resuspended in 150 pl of buffer containing 250 m M Tris-HC1, pH
7.8, 20% glycerol, 60 m M KCl, 1 m M dithiothreitol, 1 m M phenyl-
methylsulfonyl fluoride. Nuclei were then subjected to three cycles of
freezing and thawing. The suspension was cleared by centrifugation
(7000 X g, 15 min), and aliquots were immediately tested in gel
retardation assay or stored in liquid phase NZ until use. Oligonucle-
otide probes used included KB 5”CAAGGGACTTTCCGCTGGGG
ACTTTCCAG-3’ and mutant KB 5’-CAACTCAC’M’TCCGCTGC
TCACTTTCCAG-3’; Spl 5”GGGAGGTGTGGCCTGGGCGGGA
CTGGGGAGTGGCG-3’ and mutant Spl
CTGTTCGGGACTGGGGAGTGGCG-3’; TAR 5”TGAGCCTGG
5”GGGATTTGTGGC
GAGCTCTCTGGCTAA-3’ and mutant ATAR 5”TGAGCCTGG
G C T C T G G C T A A - 3 ’ . Each oligonucleotide was annealed to its
complementary strand and end-labeled with [y3’P]ATP (Amersham
International, Amersham, United Kingdom) using polynucleotide
kinase (New England Biolabs, Beverly, MA). Equal amounts (5 pg)
of cell extracts were incubated in a 20-4 reaction mixture containing
10% glycerol, 60 mM KC1, 1 m M EDTA, 1 m M dithiothreitol, and 2
pg of poly[d(I-C)] (Boehringer Mannheim) for 5 min on ice. One pl
of y-3zP-labeled double-stranded probe (0.2 ng, 4-6 X lo‘ cpm) was
then added with or without a 25-200-fold excess of competitor wild
type or mutant oligonucleotide. The reactions were incubated at room
temperature for 30 min and run on a 6% acrylamide/bisacrylamide
(301) gel in 22.5 m M Tris borate, 0.5 m M EDTA. Gels were dried and
autoradiographed.
RESULTS
Monofunctional and Bifunctional Alkylating Agents Induce
the CAT Activity Driven by the HIV-1 LTR: Role of the KB
Sites, the Spl Sites, and the TAR Regwn”MC3 cells were
electroporated with pWTcat plasmid, carrying the LTR and
the (+1/+80) untranslated region of HIV-1 fused to the cat
gene (Fig. 1). After 12 h the transfected cells were divided
into aliquots, which were treated with the chemicals or left
untreated. CAT activity was induced in a dose-response man-
ner in cells that had been treated with increasing concentra-
tions of Mit C, MMS, or EMS versus the untreated control
(Fig. 2). The activation of pWTcat reached the maximum
effect at 10 p~ Mit C, 0.5 m M MMS, and 5 m M EMS. The
maximum level of induction was consistent in several inde-
pendent experiments using different plasmid preparations
with an average of &fold induction for Mit C and EMS and
up to 10-fold induction for MMS (see pWT CAT in Fig. 3).
To determine the role of KB and Spl sites of LTR in the
induction of HIV-1 expression by alkylating agents, plasmids
carrying deletions of the two KB sites (pNFAcat), deletions of
the three Spl sites (pSpA CAT), or deletions of both KB and
Spl sites (pTA) (Fig. 1) were transfected in cells that were
treated with mutagens or left untreated. These mutant plas-
mids were tested for their basal and Tat-mediated expressions
in MC3 cells (Table I), which were similar to the ones previ-
ously described in other cell lines (48). Following the mutagen
treatment, the induction of CAT activity was absent in cells
transfected with the mutant plasmids deleted of the KB sites
or both the KB and Spl sites (pNFA CAT and pTA CAT,
respectively, in Fig. 3). The mutagen-mediated induction,
even though slightly reduced, was still present in cells trans-
fected with the Spl-deleted plasmid (pSpA CAT in Fig. 3).
These results indicated that the NF-&-binding sites in the
enhancer were the main regulatory element required for the
activation of HIV-1 LTR by Mit C, MMS, or EMS, while the

Page 3

Mutagen-mediated Induction
of HIV-1 Expression
26721
A
FIG. 1 . The enhancer, minimal
promoter, and TAR element of the
wild type and mutant HIV-1 LTR
CAT plasmids. Nucleotide sequences
of the KB site, Spl site, and TATA box
(A), and of the TAR region (-16/+52)
( E ) contained in the wild type HIV-1
LTR CAT plasmid (pWT) and the de-
rivative mutants (pNFA, pSpA, pTA,
and pTAR) are shown. The nucleotides
are numbered with respect to the RNA
start site. Nucleotide deletions are indi-
cated by dashed lines. TATA box is in
boldface, and the binding sites for cellular
transacting factors are indicated.
%Ac-Cm
4 9
19
10
6
4.5
PNFA TAC
.............................
GAGGTDFGGCC~GCGGGAC~AGCCCC
pSpA TACAAOGGAC.CGC.OGAC.CAG
......................................
CrrAGA.TACAlAlMGCAG.
pTA TAC ..................................................................
C K A G A r r r r ' T A C A l A l ~ ~ ~ ~
B
" " " " " " " " L B P - 1 , u B p - l " " " " " " " "
""""uBp-2""""-
-CTF/NFl-
-16 -
C ' 1 7 T I . F G C C ~ T A ~ " P G C ? T A G A C C A G A r r ~ A ~ C ~ A ~ r r ~ C T ~ C T A ~
+52
pWr
10 25
9 2
-
5
10
20
30
-
0.25
0.5
0.75
1
%Ac-Cm
5.0
7
20.5
1
1.5
-
2.5 5 10
20
EMS ImM)
FIG. 2. Activation of the HIV-1 LTR by DNA alkylating
agents. MC3 cells (8 X lo6) were transfected with pWTcat (10 pg)
and the reporter pRSV-@-gal(20 pg), and 12 h later they were divided
into aliquots treated with Mit C, MMS, EMS, or left untreated.
Forty-eight h after treatment, the CAT activity was determined by
incubating 30 pg of cellular extracts with ["C]chloramphenicol for 3
h, as described under "Materials and Methods." For each sample, the
percent of specific acetylation was normalized to the &galactosidase
activity. Ac-Cm, acetylated chloramphenicol.
Spl-binding sites cooperated in achieving the maximal induc-
tion.
To test the role of the TAR region in the induction of HIV-
1 LTR by alkylating agents, the pTAR plasmid, carrying a 4-
base pair deletion (+34/+37) in the TAR element (Fig. l),
was transfected in cells that were then treated with mutagens
or left untreated. In these experiments, the mutagen-mediated
induction of CAT activity was severely reduced (for MMS) or
abolished (for Mit C and EMS), while the basal expression
level was unaffected (pTAR CAT in Fig. 3). These results
suggested the presence in the TAR sequence of a regulatory
element that was specifically required for the full activation
of HIV-1 by mutagens.
Alkylating Agents Increase the Binding Activity of Nuclear
Proteins to the KB Sites and to a Mutagen-Responsive Element
in the TAR Sequence of HIV-1"Gel retardation assays were
performed with nuclear extracts prepared from MC3 cells that
were treated for different times (0.5-2 h) with alkylating
agents at optimal concentrations for the HIV-1 LTR activa-
tion (10 pM Mit C, 0.5 m M MMS, or 5 m M EMS). Nuclear
extracts from untreated cells formed an in vitro specific com-
plex with an oligonucleotide spanning the two KB sites of the
enhancer region of the HIV-1 LTR (Fig. 4A). Nuclear extracts
from mutagen-treated cells showed an increase in KB binding
activity at 0.5 h of treatment with Mit C and MMS, and at 1
h of treatment with EMS (Fig. 4A). In further experiments,
these nuclear extracts were also tested for the binding to a
double-stranded Spl oligonucleotide. As shown in Fig. 4B, the
Spl binding activity, detected as two retarded DNA-protein
complexes, was not significantly enhanced in mutagen-treated
cells as compared with the untreated controls.
Since the deletion (+34/+37) of the TAR region in the
mutant pTAR plasmid significantly reduced the induction of
HIV-1 LTR by the alkylating agents, we verified by electro-
phoretic mobility shift assay experiments the binding of nu-
clear proteins to the (+24/+47) fragment of the TAR region.
As shown in Fig. 4C, a specific DNA-protein complex was
present in untreated cells, which was significantly enhanced
at 0.5 h of treatment with MMS and at 1 h of treatment with
Mit C and EMS. These results suggest that the TAR region
encompassing the sequence from nucleotide +24 to +47 is
responsive to mutagens by interacting with specifically in-
duced protein(s).
DISCUSSION
The main purpose of this study was to understand whether
chemicals causing lesions to DNA of different nature differ
in their abilities to activate the HIV-1 expression. For this
purpose, we analyzed the expression of HIV-1 upon cellular
distress produced by chemical causing DNA monoadducts

Page 4

26722
Mutagen-mediated Induction
of HIV-1 Expression
FIG. 3. CAT activity expressed
from the wild type and mutant HIV-
1 LTR CAT plasmids following the
treatment with DNA alkylating
agents. Cells were transfected with the
wild type or mutant HIV-1 LTR plas-
mids (10 pg) and the reporter plasmid,
pRSV-@-gal(20 pg). Twelve h later, they
were divided into aliquots, which were
treated with Mit C (10 p ~ ) ,
mM), EMS (5 mM), or left untreated.
Forty-eight h after treatment, the CAT
activity was determined as detailed in
the legend to Fig. 2. CAT activities are
expressed as the percent of specific acet-
ylation of [''C]ch1oramphenico1/30 pg of
protein/3 h. The values are the mean k
S.E. of five independent experiments
using different plasmid preparations.
MMS (0.5
ap

2
2 10
-
CI 1 3
4
0
TABLE I
Basal and Tat-mediated transactivation of wild t y p e and mutant
HIV-1 LTR CATplasmids
MC3 cells (8 X 10') were electroporated with 10 pg of HIV-1 LTR-
.cat plasmid in the presence or absence of 2 pg of pSVtat plasmid.
The transfection efficiency was monitored by cotransfecting 20 pg of
pRSV-8-gal plasmid. The CAT and 8-galactosidase activities were
determined 2 days after transfection. The CAT activity is expressed
as the percent acetylation of [14C]chloramphenicol/30 pg of protein/
3 h. -Fold induction is the ratio of percent acetylated chloramphenicol
in Tat-stimulated uersus unstimulated cells.
Acetylation
-Tat
9 %
pWTcat 2.9 97.4 33.6
pNFAcat 0.3
pSpAcat 1.3 20.2
pTAcat 0.4
pTARcat 1.7 3.5
+Tat
Plasmid Activation
-fold
5.1
25.3
0.8
17.1

1.8
2.0
(MMS, EMS) or cross-links (Mit C). Transient expression
experiments of plasmids carrying the regulatory region of
HIV-1 (LTR plus the TAR region) fused to the reporter cut
gene were performed in human B lymphocytes with or without
mutagen treatments. The activation of HIV-1 by the DNA-
damaging agents UV radiation and Mit C was first reported
in HeLa cells that had been stably transfected (HIVcutlHeLa)
or transiently transfected with a HIV-1 LTR plasmid (43,44).
Valerie and Rosenberg (45) reported that in the HIVcutlHeLa
cell line the activation of HIV-1 occurred exclusively following
the treatment with chemical agents producing bulky lesions
to DNA. In that study, mutagens causing DNA breakage or
base modifications, such as gamma rays and the alkylating
agent MMS, failed to activate the integrated HIV-1 LTR (45).
In our study, chemical agents causing cross-links (biadducts,
by Mit C) as well as those producing small lesions (phosphate
backbone methylation and base methylation, by MMS or
EMS) are equally able to enhance the LTR-driven cut expres-
sion in B lymphocytes. These results were also confirmed in
Jurkat cells, a tumorigenic T lymphoblastoid cell line (not
shown). The discrepancy between ours and the previous study
(45) may reside in the type of cell line (human B lymphocytes
versus HeLa cells) and in the experimental strategy (CAT
activity driven by transiently transfected HIV-1 LTR versus
CAT activity driven by chromosomally integrated HIV-1
LTR). Cell line-specific regulatory proteins as well as different
experimental conditions could explain the difference in the
pWT CAT
pSpA CAT
pNFA CAT
pTA CAT pTAR CAT
MllC
MUS
MUS
I U S
orma SI1
EMS
A
P O M LB
MitC
EMS
d -L -
proM TAR
FIG. 4. Gel mobility shifts analysis of the KB, Spl, and TAR
(+24/+47) binding activities induced by DNA alkylating
agents. MC3 cells were treated with Mit C (10 p ~ ) ,
or EMS (5 mM) for the indicated time. 5 pg of nuclear extracts were
incubated with a double-stranded 32P-labeled oligonucleotide span-
ning the KB sites (A), the Spl sites (B), or the TAR (+24/+47)
element (C) of the HIV-1 LTR. Competition experiments were per-
formed by adding the indicated unlabeled oligonucleotides used at
100-fold molar excess in the case of the KB and Spl probes, or at 25-
fold molar excess in the case of the TAR probe.
MMS (0.5 mM),
nature of active stimuli. These results suggest that several
different mechanisms might be involved in the HIV-1 expres-
sion induced by DNA damage.
The basal promoter and the enhancer region of HIV-1
contain a TATA box, three Spl sites, and two KB sites, which
bind to the RNA polymerase I1 transcription complex, Spl,
and NF-KB transacting factors, respectively, resulting in the
expression of viral genes (2,15,17). The TAR region interacts
with the Tat regulatory protein of HIV-1 (4, 18-20) as well
as with cellular DNA- or RNA-binding proteins (21-32). The
induction of HIV-1 expression by Mit C, MMS, or EMS

Page 5

Mutagen-mediated Induction
of HIV-1 Expression 26723
required functional KB sites in the LTR (Fig. 3). However,
the full induction level was achieved when the integrity of
Spl-binding sites and TAR region was conserved (Fig. 3).
These data are consistent with previous reports (17, 49, 54)
and suggest that Spl-binding sites together with the KB en-
hancer, TATA, and TAR regions are required to promote an
efficient basal and stimuli-mediated transactivation of HIV-
1. In fact, both the basal and the mutagen-induced CAT
activities driven by the Spl-deleted plasmid were slightly
reduced as compared with the wild type plasmid (Fig. 3). A 4-
base pair deletion (+34/+37) of TAR greatly reduced the
HIV-1 induction by the tested mutagens without affecting the
basal expression level (Fig. 3). This mutation eliminates the
upper stem loop structure (+18/+44), which is required for
the induction of HIV-1 by the Tat transactivator (4, 18, 20)
(shown in Table I). Thus, the TAR region, in addition to a
sequence required for Tat-mediated transactivation, also con-
tains a regulatory element involved in the Tat-independent
transactivation of HIV-1 by alkylating agents.
Following the mutagen treatment, the binding activities to
the KB sites in the enhancer as well as those to the TAR DNA
(+24/+47) were increased without significant modification of
Spl binding activity (Fig. 4). These results, together with
evidence from transient expression assays, indicate that cel-
lular proteins, interacting with both the enhancer and the
leader region of HIV-1, are specifically activated in response
to the chemical treatment and may be involved in the positive
regulation of HIV-1 expression following the genotoxic dis-
tress. NF-KB-like proteins were also required for the induction
of HIV-1 by UV radiation (44). Thus, a common molecular
mechanism involving the activation of NF-KB transacting
factors may be shared by chemical and physical mutagens to
induce the expression of HIV-1. The KB sites were also re-
quired for the transcriptional
mitogens PMA and phytohemagglutinin (2-4, 33) as well as
by the cytokines IL-1 and tumor necrosis factor (7, 8). At
least two mechanisms could be suggested for the activation of
the HIV-1 LTR by alkylating agents. Similar to phorbol esters
(55), the alkylating agents could directly activate protein
kinases leading to the activation and nuclear translocation of
NF-KB-like proteins. Indeed, the induction of a variety of
genes by DNA-damaging agents, like x-rays and UV radiation,
occurs via protein kinase C activation (53, 56). At the same
time, the alkylating agents could stimulate the production of
cytokines which, in turn, could induce the HIV-1 expression
through the NF-KB activation. This last possibility is sup-
ported by the evidence of the enhanced stability of IL-la, IL-
18, and IL-6 transcripts by Mit C, MMS, or EMS treatments
in human monocytes followed by the increased secretion of
the relative proteins.' The complex interplay between differ-
ent DNA- and RNA- binding cellular proteins at the level of
the TAR region and the resulting effects on the basal and
Tat-induced HIV-1 expression are still poorly understood. We
have shown that a DNA binding activity for the DNA TAR
sequence (+24 to +47) is present in MC3 cells, and it is
increased upon treatment with alkylating agents. A similar
activity was found in Jurkat T lymphocytes (not shown). The
binding site for a cellular protein, termed UBP-2 (20), was
mapped at the HIV-1 DNA sequence (+28/+52), which par-
tially overlaps the mutagen-responsive element in the TAR
region. In addition, a CTF/NFl recognition element was
mapped at the TAR DNA sequence (+40/+45) (21). At the
present, it is not clear whether the TAR DNA binding activity
induction of HIV-1 by the
I. Quinto, M. Mallardo, V. Giordano, E. Dragonetti, and G. Scala,
manuscript in preparation.
induced by mutagens is related to the UBP-2 and CTF/NFl
proteins or whether it is a novel protein. Studies are in
progress to identify these mutagen-induced proteins interact-
ing with TAR DNA and to define their role in the regulation
of HIV-1 transcription.
Acknowledgments-We
plasmids used in the present work and for stimulating the discussion
of the results. We also thank Dr. J. Guardiola for critically revising
the manuscript and F. Dello Stritto for preparing the manuscript.
thank Dr. A. Rabson for providing the
REFERENCES
1. Rosenberg, Z. F., and Fauci, A. S. (1991) FASEB J. 6,2382-2390
2. Nabel, G., and Baltimore, D. (1987) Nature 326,711-713
3. Siekevitz, M., Josephs, S. F., Dukovich, M., Peffer, N., Wong-Staal, F., and
Greene, W. C. (1987) Science 238,1575-1578
4. Tong-Starksen, S. E., Luciw, P. A., and Peterlin, B. M. (1987) Proc. Nutl.
Acud. Sci. U. S. A. 84,6845-6849
5. Tongstarksen, S. E., Luciw, P. A., and Peterlin, B. M. (1989) J. Immuml.
142,702-707
6. Folks, T. M., Justement, J., Kinter, A., Dinarello, C. A., and Fauci, A. S.
(1987) Science 238,800-802
(1989) Proc. Ndd. Acud.' Sci. ci S. A. 86,5974-5978:
8. Osborn, L., Kunkel, S., and Nabel, G. J. (1989) Proc. Nutl. Acud. Sci.
U. S. A. 86,2336-2340
9. Poli, G., Bressler, P., Kinter, A,, Duh, E., Timmer, W. C., Rabson, A.,
Justement. J. S.. Stanlev. S.. and Fauci. A. S. (1990) J. EXO. Med. 172.
151-158
Gendelman, H. E., Phelps, W., Feigenbaum, L., Ostrove, J. M., Adachi, A.,
Howley, P. M., Khoury, G., and Ginsberg, H. S. (1986) Proc. Nutl. Acud.
Sci. U. S. A. 83,9759-9763
Davis, M. G., Kenney, S. C., Kamine, J., Pagano, J. S., and Huang, E.
(1987) Pm.
Nutl. Acud. Sci. U. S. A. 84,8642-8646
Gimble, J. M., Duh, E., Ostrove, J. M., Gendelman, H. E., Max, E. E., and
Rabson, A. B. (1988) J. Viml. 62,4104-4112
Mallon, R., Borkowski, J., Albin, R., Pepitoni, S., Schwartz, J., and Kieff,
E. (1990) J. Virol. 64,6282-6285
Scala, G., Quinto, I., Ruocco, M. R., Mallardo, M., Ambrosino, C., Squitieri,
B., Tassone, P., and Venuta, S. (1993) J. Virol. 67,2853-2861
Rosen, C. A., Sodroski, J. G., and Haseltine, W. A. (1985) CeU 41,813-823
7. Duh. E. J.. Maurv. W. J.. Folks. T. M.. Fauci. A. S.. and Rabson. A. B.
10.
11.
12.
13.
14.
15.
16.
Garcia, J. A., Wu, F. K., Mitauyasu, R., and Gaynor, R. B. (1987) EMBO
J. 6.3761-3770
17. Jones,'K. A., Kadonaga, J. T., Luciw, P. A., and Tjian, R. (1986) Science
232,755-759
,.
_ I I
..
18. Feng, S., and Holland, E. C. (1988) Nature 334,165-167
19. Jakobovita, A,, Smith, D. H., Jakobovita, E. B., and Capon, D. J. (1988)
Mol. Cell. Biol. 8.2555-2561
20. Garcia, -J. A,, Harrich, D., Soultanakis, E., Wu, F., Mitsuyasu, R., and
Gaynor, R. (1989) EMBO J. 8,765-778
~~ ~
21. Jones, K. A,, Luciw, P. A,, and Duchange, N. (1988) Genus &Dew 2,1101-
l l l d
22. W$E :,Garcia,
J. A., Harrich, D., and Gaynor, R. B. (1988) EMBO J.
I , I l l I-IlZY
,~~~~
~~~~
23. Malim, M. H., Fenrick, R., Ballard, D. W., Hauber, J., Bohnlein, E., and
Cullen, B. R. (1989) J. Virol. 63,3213-3219
25. Gatignol, A,, Kumar, A., Rabson, A. B., and Jeang, K. T. (1989) Pm.
Acud. Sci. U. S. A. 86.7828-7832
26. Gaynor, R., Soultanakis; E., Kuwabara, M., Garcia, J., and Sigman, D. S.
(1989) ~ m .
Nutl.
24. Kato, H., Horikoshi, M., and Roeder, R. G. (1991) Science 261,1476-1479
27. Marciniak, R. A., Garcia-Blanco, M. A., and Sharp, P. A. (1990) Proc. Nutl.
Acud. Sci. U. S. A. 87,3624-3628
28. Gatignol, A., Buckler-White, A., Berkhout, B., and Jeang, K. T. (1991)
Science 261,1597-1600
29. Sheline, C. T., Milocco, L. H., and Jones, K. A. (1991) Genus & Deu. 6,
3.5n~359n
30.
Wu, F., Garcia, J., Sigman, D., and Gaynor, R. (1991) Genus & Deu. 6,
"" ""
2128-2140
NU~L. A C ~ . S C ~ . u. s. A. 8 6 , 4 a 8 - m 2
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
Roy, S., Agy, M., Hovanessian, A. G., Sonenberg, N., and Katze, M. G.
(1991) J. Virol. 66, 632-640
Rounseville, M. P., and Kumar, A. (1992) J. Virol. 66, 1688-1694
Kaufman, J. D., Valandra, G., Roderiquez, G., Bushar, G., Giri, C., and
Norcross, M. A. (1987) Mol. CeU. BWL 7,3759-3766
Sen, R., and Baltimore, D. (1986) CeU 46, 705-716
Franza, B. R., Jr., Josephs, S. F., Gilman, M. Z., Ryan, W., and Clarkson,
B. (1987) Nature 330,391-395
Sen, R., and Baltimore, D. (1986) CeU 47,921-928
Maekawa, T., Sakura, H., Sudo, T., and Ishii, S. (1989) J. Biol. Chem. 264,
14591-14593
Korner, M., Bellan, A. H., Brini, A. T., and Farrar, W. L. (1990) Biochem.
J. 266,547-554
Friedberg, E. C. (1985) DNA Repair, W. H. Freeman and Company, San
Francisco
Angel, P., Potting, A,, Mallick, U., Rahmadorf, H. J., Schorpp, M., and
Herrlich, P. (1986) Mol. CeU. Biol. 6,
Holbrook, N. J., and Fornace, A. J. (1991) New Bwl. 3,825-833
Reed, J. C., Alpers, J. D., Nowell, P. C., and Hoover, R. G. (1986) Pm.
Nutl. Acud. Sci. U. S. A. 83,3982-3986
Valerie, K., Delers, A., Bruck, C., Thiriart, C., Rosenberg, H., Debouck, C.,
and Rosenberg, M. (1988) Nature 333, 78-81
Stein, B., Rahmsdorf, H. J., Steffen, A,, Litfin, M., and Herrlich, P. (1989)
Mol. CeU. Biol. 9,5169-5181
1760-1766

Page 6

26724
Mutagen-mediated Induction
of HIV-1 Expression
45. Valerie, K., and Rosenberg, M. (1990) New Biol. 2, 712-718
46. Morrey, J. D.,
Bourn, S. M., Bunch, T. D., Jackson, M. K., Sidwell, R. W.,
Barrows, L. R., Daynes, R. A,, and Rosen, C. A. (1991) J. Virol. 66,
51. Norton, P. A., and Coffin, J. M. (1985) Mol. Cell Biol. 6,281-290
52. Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982) Mol. Cell. Bwl. 2,
1044-1051
Forni, G., and Venuta, S. (1990) J. Erp. Med. 172, 61-68
5045-5051
47. Joshi, B., Epstein, J. S., Riordan, G., Pollock, L., and Hewlett, I. K. (1992)
Vuccines 92 (Cold Spring Harbor) 247-252
48. Leonard, J., Parrott, C., Buckler-White, A. J.,,Turner, W., Ross, E. K.,
49. Parrott, C., Seidner, T., Duh, E., Leonard, J., Theodore, T. S., Buckler-
White, A., Martin, M. A., and Rabson, A. B. (1991) J. Vzrol. 66, 1414-
1419
50. Scala, G., Quinto, I., Ruocco, M. R.,
53. Lin, C. S., Goldthwait, D. A,, and Samols, D. (1990) Proc. Nutl. Acud. Sci.
U. S. A. 87,36-40
54. Harrich, D., Garcia, J., Wu, F., Mitsuyasu, R., Gonzalez, J., and Gaynor,
R. (1989) J. Virol. 63, 2585-2591
55. Nishizuka, Y. (1988) Nature 334,661465
56. Hallahan D. E., Sukhatme, V. P., Sherman, M. L. Virudachalam, S., Kufe,
D., and Weichselbaum, R. R. (1991) Proc. Nuti Acad. Sci. U. S. A. 88,
2156-2160
Martin, M. A., and Rabson, A. B. (1989) J. Vzrol. 63,4919-4924
Arcucci, A., Mallardo, M., Caretto, P.,