Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' End of the Large-Subunit (26S) Ribosomal DNA Gene

National Center for Agricultural Utilization Research, United States Department of Agriculture, Peoria, Illinois 61604, USA.
Journal of Clinical Microbiology (Impact Factor: 3.99). 06/1997; 35(5):1216-23.
Source: PubMed


Clinically important species of Candida and related organisms were compared for extent of nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA (rDNA) gene. This rDNA region is sufficiently variable to allow reliable separation of all known clinically significant yeast species. Of the 204 described species examined, 21 appeared to be synonyms of previously described organisms. Phylogenetic relationships among the species are presented.

1 Follower
42 Reads
  • Source
    • "C. Primers NL-1 (5 0 -GCATAT CAA- TAAGCG GAG GAA AAG-3 0 ) and NL-4 (5 0 -GGT CCG TGT TTC AAG ACG G-3 0 ) (Elisabeth Pharmacon) were used for amplification. [28] "
    [Show abstract] [Hide abstract]
    ABSTRACT: Performance of a two-stage biofiltration system was investigated for removal of styrene-acetone mixtures. High steady-state acetone loadings (above Cin(Ac) = 0.5 g.m(-3) corresponding to the loadings > 34.5 g.m(-3).h(-1)) resulted in a significant inhibition of the system's performance in both acetone and styrene removal. This inhibition was shown to result from the acetone accumulation within the upstream trickle-bed bioreactor (TBR) circulating mineral medium, which was observed by direct chromatographic measurements. Placing a biofilter (BF) downstream to this TBR overcomes the inhibition as long as the biofilter has a sufficient bed height. A different kind of inhibition of styrene biodegradation was observed within the biofilter at very high acetone loadings (above Cin(Ac) = 1.1 g.m(-3) or 76 g.m(-3).h(-1) loading). In addition to steady-state measurements, dynamic tests confirmed that the reactor overloading can be readily overcome, once the accumulated acetone in the TBR fluids is degraded. No sizable metabolite accumulation in the medium was observed for either TBR or BF. Analyses of the biodegradation activities of microbial isolates from the biofilm corroborated the trends observed for the two-stage biofiltration system, particularly the occurrence of an inhibition threshold by excess acetone.
    Journal of Environmental Science and Health Part A Toxic/Hazardous Substances & Environmental Engineering 09/2015; 50(11):1148-1159. DOI:10.1080/10934529.2015.1047672 · 1.16 Impact Factor
    • "The extracted DNA was stored at −20 °C. Amplification of DNA primers NL-1 (5′-GCATAT CAATAAGCG GAG GAA AAG-3′) and NL-4 (5′-GGT CCG TGT TTC AAG ACG G-3′) (Elisabeth Pharmacon) were used for the amplification (Kurtzman and Robnett 1997). PCR was performed in 0.2-mL thin wall tubes in a total reaction volume of 50 μL, consisting of 5 μL Taq polymerase buffer A (1.5 mmol/L) (Kapa Biosystems), 1 μL of dNTPs (10 mM/L) (Kapa Biosystems), 0.2 μL of Taq DNA polymerase (Kapa Biosystems), 2 μL of primer NL-1 (10 μmol/L), 2 μL of primer NL-4 (10 μmol/L), 1 μL of template DNA and sterile distilled water up to 50 μL. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Four plants, Cirsium arvense (creeping thistle), Equisetum arvense (field horsetail), Oxalis acetosella (wood sorrel) and Phragmites australis (common reed), which grew in an abandoned Sb-mining area in Pernek (Malé Karpaty Mts., Slovakia), were investigated for the yeast species. Yeasts were isolated from both the leaves of the plants and the soil adjacent to the plants. In total, 65 yeast cultures, belonging to 11 ascomycetous and 5 basidiomycetous yeast species, were isolated. The species most frequently isolated from both the soil and leaf samples were Trichosporon porosum, Galactomyces candidus and Candida solani, whereas Aureobasidium pullulans, Candida tsuchiyae and Sporidiobolus metaroseus were isolated exclusively from the plant leaves. All the yeast species isolated were tested for their tolerance to two heavy metals (Cd, Zn) and three metalloids (As, Sb and Si). The yeasts isolated from both the leaves and soils exhibited a high tolerance level to both As and Sb, present in elevated concentrations at the locality. Among the yeast species tested, Cryptococcus musci, a close relative to Cryptococcus humicola, was the species most tolerant to all the chemical elements tested, with the exception of Si. It grew in the presence of 200 mmol/L Zn, 200 mmol/L Cd, 60 mmol/L As and 50 mmol/L Sb, and therefore, it can be considered as a multi-tolerant species. Some of the yeast species were tolerant to the individual chemical elements. The yeast-like species Trichosporon laibachii exhibited the highest tolerance to Si of all yeasts tested, and Cryptococcus flavescens and Lindnera saturnus showed the same tolerance as Cryptococcus musci to Zn and As, respectively. The majority of the yeasts showed a notably low tolerance to Cd (not exceeded 0.5 mmol/L), which was present in small amounts in the soil. However, Candida solani, isolated from the soil, exhibited a higher tolerance to Cd (20 mmol/L) than to As (2 mmol/L).
    Folia Microbiologica 09/2015; DOI:10.1007/s12223-015-0424-9 · 1.00 Impact Factor
  • Source
    • "Bacterial and yeast isolates from KMC - IMBG1 were identified by PCR amplification using standard primers 27F / 1494R ( AGAGTTTGATCCTGGCTCAG / TGACTG ACTGAGGYTACCTTGTTACGACTT ) for bacterial 16S rDNA and NL1 / NL4 ( GCATATCAATAAGCGGAGG AAAAG / GGTCCGTGTTTCAAGACGG ) for fungal 26S rDNA amplification as it was described previously ( Ogino et al . 2001 ; Kurtzman and Robnett 1997 ) . More specifically , the PCR reactions for both primers were run for 35 cycles with annealing temperature 54°C for 27F / 1494R and 52°C for NL1 / NL4 . "
    [Show abstract] [Hide abstract]
    ABSTRACT: Introducing of the DNA metabarcoding analysis of probiotic microbial communities allowed getting insight into their functioning and establishing a better control on safety and efficacy of the probiotic communities. In this work the kombucha poly ‑ microbial probiotic community was analysed to study its flexibility under different growth conditions. Environmental DNA sequencing revealed a complex and flexible composition of the kombucha microbial culture (KMC) constituting more bacterial and fungal organisms in addition to those found by cultural method. The commu‑ nity comprised bacterial and yeast components including cultured and uncultivable microorganisms. Culturing the KMC under different conditions revealed the core part of the community which included acetobacteria of two genera Komagataeibacter (former Gluconacetobacter ) and Gluconobacter , and representatives of several yeast genera among which Brettanomyces/Dekkera and Pichia (including former Issatchenkia ) were dominant. Herbaspirillum spp. and Halo - monas spp., which previously had not been described in KMC, were found to be minor but permanent members of the community. The community composition was dependent on the growth conditions. The bacterial component of KMC was relatively stable, but may include additional member—lactobacilli. The yeast species composition was sig‑ nificantly variable. High ‑ throughput sequencing showed complexity and variability of KMC that may affect the quality of the probiotic drink. It was hypothesized that the kombucha core community might recruit some environmental bacteria, particularly lactobacilli, which potentially may contribute to the fermentative capacity of the probiotic drink. As many KMC ‑ associated microorganisms cannot be cultured out of the community, a robust control for community composition should be provided by using DNA metabarcoding.
    AMB Express 06/2015; 5(1):35. DOI:10.1186/s13568-015-0124-5
Show more

Similar Publications


42 Reads
Available from