Male-specific transcription initiation of the C4-Slp gene in mouse liver follows activation of STAT5.

Abstract

The mouse genes encoding the constitutively expressed complement component C4 and its closely related isoform C4-Slp (sex-limited protein), which is expressed only in male animals of several strains, provide a unique model to study sequence elements and trans-acting factors responsible for androgen responsiveness. Our previous studies have shown that hormonal induction of C4-Slp is mediated by a sex-specific pattern of growth hormone secretion. Promoter analyses in vitro have led to contradictory conclusions concerning the significance of C4-Slp-specific sequences in the 5' flanking region. Mutant mice carrying the H-2(aw18) haplotype, which is characterized by a large deletion in the S region covering the C4 and 21-OHase A genes, permit the direct in vivo analysis of C4-Slp transcription, unhindered by the presence of C4. Run-on analysis of transcription in liver nuclei of males and females of this strain demonstrated a 100-fold higher transcriptional activity in males, essentially determined at the transcription initiation level. The androgen dependence of transcription initiation was confirmed by run-on analysis of testosterone-treated females, where transcriptional activity started after 6 days of androgen treatment and reached male levels after 20 days. Conversely, the growth hormone-regulated activity of transcription factor STAT5 was already detected in liver nuclei after 48 hr of androgen treatment. Furthermore, we demonstrate that activated STAT5 recognizes in vitro two upstream gamma interferon-activated sequence (GAS) elements of the C4-Slp gene, centered at positions -1969 and -1831. We postulate that binding of STAT5 to these C4-Slp-specific GAS elements plays a crucial role in the chromatin remodelings that lead to transcriptional competence of the C4-Slp gene in the liver.

Full text

Page 1

Proc. Natl. Acad. Sci. USA
Vol. 95, pp. 8750–8755, July 1998
Genetics
Male-specific transcription initiation of the C4-Slp gene in mouse
liver follows activation of STAT5
(liver gene expression?growth hormone secretion?complement component C4?sexual dimorphism)
N. VARIN-BLANK*†, E. DONDI*, M. TOSI*‡, C. HERNANDEZ*, L. BOUCONTET*, H. GOTOH§¶, T. SHIROISHI?,
K. MORIWAKI§**, AND T. MEO*††
*Unite ´ d’Immunoge ´ne ´tique et Institut National de la Sante ´ et de la Recherche Me ´dicale, U. 276, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15,
France; and§Department of Cell Genetics and?Mammalian Genetics Laboratory, National Institute of Genetics, Yata-1111, Mishima 411, Japan
Communicated by Susumu Ohno, Beckman Research Institute of the City of Hope, Duarte, CA, May 18, 1998 (received for review March 26, 1998)
ABSTRACT
expressed complement component C4 and its closely related
isoform C4-Slp (sex-limited protein), which is expressed only
in male animals of several strains, provide a unique model to
study sequence elements and trans-acting factors responsible
forandrogenresponsiveness.Ourpreviousstudieshaveshown
that hormonal induction of C4-Slp is mediated by a sex-
specific pattern of growth hormone secretion. Promoter anal-
yses in vitro have led to contradictory conclusions concerning
the significance of C4-Slp-specific sequences in the 5? flanking
region. Mutant mice carrying the H-2aw18haplotype, which is
characterized by a large deletion in the S region covering the
C4 and 21-OHase A genes, permit the direct in vivo analysis of
C4-Slp transcription, unhindered by the presence of C4.
Run-on analysis of transcription in liver nuclei of males and
females of this strain demonstrated a 100-fold higher tran-
scriptional activity in males, essentially determined at the
transcription initiation level. The androgen dependence of
transcription initiation was confirmed by run-on analysis of
testosterone-treated females, where transcriptional activity
started after 6 days of androgen treatment and reached male
levels after 20 days. Conversely, the growth hormone-
regulated activity of transcription factor STAT5 was already
detected in liver nuclei after 48 hr of androgen treatment.
Furthermore, we demonstrate that activated STAT5 recog-
nizes in vitro two upstream ? interferon-activated sequence
(GAS) elements of the C4-Slp gene, centered at positions
?1969 and ?1831. We postulate that binding of STAT5 to
these C4-Slp-specific GAS elements plays a crucial role in the
chromatin remodelings that lead to transcriptional compe-
tence of the C4-Slp gene in the liver.
The mouse genes encoding the constitutively
Sex-limited protein (Slp) is an isoform of the mouse comple-
ment component C4. Both serum proteins are synthesized
primarily in the liver and are encoded by two tandemly
duplicated genes in the H-2S region (C4 and C4-Slp), which
exhibit striking differences in their pattern of expression. C4 is
constitutively expressed whereas, depending on the H-2 hap-
lotype, Slp is either undetectable in the serum or present only
in sexually mature males (1). We have shown previously that
the hormonal induction of C4-Slp in the liver is regulated
indirectly by testosterone, which induces a sex-specific pattern
of growth hormone (GH) secretion via hypothalamus–
pituitary connections (2). C4-Slp can be induced by GH in
hypophysectomized mice or in Tfm mice lacking a functional
androgen receptor. In addition, male mice overexpressing GH,
because of the presence of a constitutively expressed trans-
gene, do not express C4-Slp (2). The rule of male-restricted
expression can be violated either by pseudoalleles consisting of
extra copies of C4?C4-Slp hybrid genes [haplotypes H-2w7,
H-2w16, and H-2w19(3–5)] or by trans-acting and recessive
regulatory genes designated as regulators of sex limitation
(rsl),suchasthosefoundintheFM,PL?J,andNZBstrains(6).
The rsl mutation allows not only expression in females but also
increased expression in males (7). The C4 and C4-Slp genes are
nearly 15 kb long and have identical exon?intron organization
with about 95% sequence identity in both the coding and
noncoding regions (8, 9). Their transcription is driven by an
initiator element (10, 11). This model allows one to study the
differences between duplicated genes that result in the turning
off of expression in a reversible manner by testosterone or by
mutations affecting trans-acting factors. Divergent sequence
elements in the 5? flanking region of the genes have been
identified, and in vitro studies have attempted to correlate
these elements with differential expression (12–17). However,
none of the slight differences in activities (2- to 5-fold)
observed between the two promoters could account for the
more than 100-fold difference in the steady-state levels of the
nuclear mRNA precursors of C4 and C4-Slp in female hepa-
tocytes (2, 10). An androgen-responsive C4-Slp-specific en-
hancer, located 2 kb upstream of the promoter and postulated
to direct androgen-specific transcription, is involved in chro-
matin remodeling both in the liver and the kidney (18).
Protection of this enhancer in male kidney correlates with
C4-Slp expression. However, in vivo protection of the same
androgen-responsive enhancer is also observed in the liver,
where it is not sufficient to determine transcription of C4-Slp
(18). The latter finding is consistent with our demonstration
that expression of this gene in the liver requires a pulsatile
rhythm of growth hormone secretion, not testosterone directly
(2).
To resolve the inconsistencies between results obtained
usingvariousinvitroassaysandinvivochromatinstudies,itwas
necessary to examine in vivo the transcription of both genes in
both sexes. High levels of nucleotide identity between the C4
and C4-Slp genes frustrated such in vivo analysis in strains
expressing both genes. Mutant H-2aw18mice result from the
recessive lethal deletion of ?80 kb of theSregion including the
active gene coding for steroid 21-hydroxylase and complement
The publication costs of this article were defrayed in part by page charge
payment. This article must therefore be hereby marked ‘‘advertisement’’ in
accordance with 18 U.S.C. §1734 solely to indicate this fact.
© 1998 by The National Academy of Sciences 0027-8424?98?958750-6$2.00?0
PNAS is available online at http:??www.pnas.org.
Abbreviations: C4-Slp, sex-limited protein and isoform of the fourth
component of mouse complement; GAS, ? interferon-activated se-
quence; GH, growth hormone.
†Present address: Institut National de la Sante ´ et de la Recherche
Me ´dicale, U.363, Institut Cochin de Genetique Moleculaire, Ho ˆpital
Cochin, 27 rue du Fg St. Jacques 75014 Paris, France.
‡To whom reprint requests should be addressed. e-mail: mtosi@
pasteur.fr.
¶Present address: Laboratory of Molecular Pathology, Department of
Immunology, National Institute of Animal Health, 3-1-1 Kannon-dai,
Tsukuba, Ibaraki 305-0856, Japan.
**Present address: The Graduate University for Advanced Studies,
Hayama, Kanagawa-ken, 240-0193, Japan.
††Deceased April 19, 1997.
8750

Page 2

C4, which leaves the C4-Slp gene intact (19). These mice have
been rescued through transgenesis with the murine 21-OHase
A gene (20) and provide the opportunity to study C4-Slp
transcription in vivo, unhindered by the presence of C4. We
therefore examined C4-Slp transcription initiation and elon-
gation in vivo by using nuclear run-on analysis.
It has been suggested recently that the sexually dimorphic
GH-dependentexpressionofseveralgenesintheliverdepends
on the activation of the transcription factor STAT5 (21, 22). In
this study, we followed the time course of appearance of
STAT5 activity in liver nuclei of androgen-treated females and
identified two upstream ? interferon-activated sequence
(GAS) elements of the C4-Slp gene, which specifically bind
activated STAT5.
MATERIALS AND METHODS
Animals. All animals studied were 8 weeks to 5 months old.
Prepuberal males were 3 weeks old. Testosterone propionate
(Sigma) was injected subcutaneously every day as a 0.1-ml
volume of a 7-mg?ml solution in sesame oil for the times
indicated. Control animals were injected with vehicle alone.
RNA Isolation and Analysis. Total RNA was prepared by
the guanidium isothiocyanate procedure (23). Nuclear RNA
was isolated by using the citric acid method, and RNase
protection assay was performed as described (2). C4 and
C4-Slp RNA probes used in RNase protection assays were
transcribed in vitro from inserts cloned downstream of the T3
or T7 RNA polymerase promoter in the pBS (???) phagemid
(Stratagene) in the presence of 50 ?Ci of [?-32P]CTP (3,000
Ci?mmol; 1 Ci ? 37 GBq) as recommended by the supplier
(Stratagene). The C4-Slp?C4 distal probe has been described
already (2). This probe discriminates C4 (100 nt) from C4-Slp
(191 nt). A C4-Slp initiation start-site probe extending from
?132 in the 5? flanking region to ?234 bp (exon 2) was
obtained by PCR of genomic DNA. This region is identical in
C4 and C4-Slp.
Nuclear Run-On Analysis. Selection of exon-specific oligo-
nucleotide probes for run-on analysis was based on the choice
of an average length of 100 noncoding-strand nucleotides with
theabilitytohybridize25uridinenucleotidesintheRNA:exon
1 probe, ?21 to ?119; exon 2, ?222 to ?320; exon 7, ?1996
to ?2082; exon 9, ?2789 to ?2886; exon 14, ?4909 to ?5011;
and exon 33, ?11934 to ?12049. Complementary oligonucle-
otides corresponding to the coding strand were used as con-
trols. Two additional control oligonucleotides were added:
promoter region, ?140 to ?45; ?-actin cDNA, ?347 to ?451.
Oligonucleotides (10 ?g?100 ?l) were denatured at 65°C for 30
min in 0.3 M NaOH, the reaction was blocked with an equal
volume of 2 M ammonium acetate, pH 7, and samples were
loaded onto a nylon membrane soaked in 10? standard saline
citrate (Hybond N?, Amersham) by using a slot blot apparatus
(Schleicher & Schuell). Oligonucleotides were fixed to the
membrane by UV exposure and baking for 1 hr at 80°C.
Nuclei were prepared from pools of three livers as described
(24, 25). The nuclei were resuspended in 50 mM Tris?HCl, pH
8.0?5 mM MgCl2?0.1 mM EDTA?0.5 mM DTT?40% glycerol
and stored at ?80°C. Nuclei were incubated as described (26)
with slight modifications. Briefly, 108isolated nuclei were
incubated in a 500-?l reaction mixture containing 25% glyc-
erol?20 mM Tris?HCl, pH 8.0?150 mM KCl?5 mM MgCl2?1
mM each of ATP, GTP, and CTP?2 mCi of [32P]UTP (3,000
Ci?mmol, Amersham)?100 units of ribonuclease inhibitor
(RNasin, Promega) at 26°C for either 10 min, 30 min, 1 hr, or,
in pulse-chase experiments, for 10-min labeling followed by 30
min elongation with unlabeled UTP. Labeled nuclei were
digested subsequently with DNase I (40 units, Amersham) for
30 min at 37°C. After addition of 100 ?l of a stop mixture (200
?g?ml proteinase K?2.5% SDS?100 mM EDTA, pH 7.5) the
samples were incubated for 45 min at 37°C. The RNA was
extracted by using the acid phenol procedure and precipitated
with isopropyl alcohol. Before hybridization, samples were
partially hydrolyzed with 0.1 ml of 0.2 M NaOH for 5 min at
4°C and reprecipitated. Prehybridization, hybridization (24 hr
at 65°C), and washes were carried out as described (24). For
quantitation filters were exposed for 72 hr and analyzed by
using PhosphorImager (Molecular Dynamics).
Nuclear Protein Extraction and Gel Mobility-Shift Assay.
Nuclear proteins were extracted as described by Gorski et al.
(27) from freshly excised individual mouse livers in the pres-
ence of classical protease inhibitors and phosphatase inhibi-
tors:10mMsodiumfluorideand1mMsodiumorthovanadate.
Nuclear extracts used in binding assays were finally stored in
20 mM Hepes, pH 7.9?10 mM KCl?1 mM EDTA?0.35 M
NaCl?20% glycerol?1 mM DTT?1 mM phenylmethylsulfonyl
fluoride?1 mM sodium orthovanadate. Double-stranded oli-
gonucleotide probes,32P-labeled with T4 polynucleotide ki-
nase, were incubated for 30 min at 4°C with 10 ?g of nuclear
extract diluted in 5 ?l of storage buffer and 14 ?l of gel
mobility-shift buffer (10 mM Hepes, pH 8.0?50 mM KCl?50
mM NaCl?0.1 mM EDTA?5 mM MgCl2?4 mM spermidine?
2.5% glycerol?2 mM DTT?0.1 mg?ml BSA?2 ?g of poly(dI-
dC)?4 ng of double-stranded probe. In supershift analysis
incubation was carried out for an additional 30 min with anti-
STAT5 antibody C-17 (Santa Cruz Biotechnology) before the
addition of the probe. Samples were electrophoresed at room
temperature through nondenaturing polyacrylamide gels (6%)
in 0.5? TBE buffer for 3 hr at 20 mA. DNA probes were the
STAT5 consensus oligonucleotide AGATTTCTAGGAAT-
TCAATC or the following oligonucleotides derived from
C4-Slp: GCCAGTTCTCAGAACAGGCT (GAS 1, ?1978 to
?1960), GCTCAATTCCCAGAACCCA (GAS 2, ?1841 to
?1821), and AGAGTTTGAGGTCAGCCTGG (GAS 1 con-
trol), or GCTTAATTCCTAGCACCCA (GAS 2 control)
from the corresponding positions of the C4 gene in regard to
the transcription start site. GTGAGGTTCCTGGAAGTGC
(GAS 3, ?835 to ?816 in C4-Slp) is present in both genes.
RESULTS
B10aw18C4?/?MiceExhibittheSameSexualDimorphismof
C4-Slp Expression as Observed in the BALB?c Strain. B10aw18
mutant mice, which lack the C4 gene, allow one to study in vivo
the transcription of C4-Slp. Because these mutants have a large
deletion within the MHC class III region, we compared the
C4-Slp expression and the androgen inducibility in animals of
this strain with those used in previous studies (BALB?c).
Steady-state nuclear or total RNA isolated from the liver of
both male and female B10aw18mice were analyzed in an RNase
protection assay. As shown in Fig. 1A, the same sexual
dimorphismofC4-Slpexpressionwasobservedin B10aw18mice
as demonstrated previously for the BALB?c strain. Although
both spliced and unspliced RNAs were detected in males
(nuclear RNA, lane 1; total RNA, lane 2), neither spliced nor
unprocessed RNA could be seen in female nuclear (lane 3) or
total RNA (lane 4). Spliced and unspliced RNA was, however,
detected in BALB?c female nuclei because of the expression
of the C4 gene (lane 6). Testosterone injection of B10aw18
females for 20 days (the time required for maximal response
through the induction of the sex-specific GH secretion pattern,
as shown in ref. 2) restored C4-Slp expression to levels
comparable to those found in males (compare lanes 2 and 3 in
Fig. 1B) or in androgen-induced BALB?c females (lane 4).
Taken together, these data indicate that B10aw18mice mimic
the BALB?c phenotype in the absence of the C4 gene and that
neither the deletion comprising the C4 gene and the 21OHase
A gene nor the 21OHase A construct introduced through
transgenesis (28) altered the hormonal regulation of C4-Slp.
Hormonal Control of C4-Slp Expression Takes Place at the
Transcription Initiation Level. We then examined whether
Genetics: Varin-Blank et al.Proc. Natl. Acad. Sci. USA 95 (1998)8751

Page 3

lack of C4-Slp expression in females was a result of rapid
degradation of incompletely synthesized transcripts or lack of
transcription initiation. To this end, we performed run-on
analyses of newly synthesized transcripts (10-min labeling)
from liver nuclei of male or female B10aw18mice, using sense
and antisense oligonucleotide probes representing different
regions of the C4-Slp gene (Fig. 2). To normalize different
experiments we included as an internal control of overall
transcription efficiency an antisense ?-actin probe. Typical
results shown in Fig. 2 reveal nascent C4-Slp transcripts in
males, with an intensity comparable to that of ?-actin, using a
probe covering the initiation start site (exon 1). In contrast, no
signal above background (e.g., antisense promoter and sense
probes) was detected in females, even when using longer
periods of labeling. In addition, we observed in males a strong
drop in the amount of nascent transcripts detected with exon
2 and other proximal probes (exons 7, 9, and 14). This
attenuation also was observed with the C4 gene in BALB?c
mice (see below). Quantitative analyses of exon 1 transcripts
normalized to ?-actin in several experiments are summarized
in the scatter plot of Fig. 2, where individual points represent
the exon1??-actin ratios obtained by using equal numbers of
nuclei from pools of three livers. Comparison of the exon
1?actin ratios indicates that a 30- to 40-fold difference between
sexes is established during the transcription initiation process.
(If estimated using shorter periods of labeling the difference
appears higher than 50-fold.) These data demonstrate that
most of the 100-fold difference seen in steady-state RNAs (2)
is accounted for by differences that are already established
between sexes at the transcription initiation level. We then
tested whether testosterone injection for various periods of
time could induce the initiation of C4-Slp transcription in
B10aw18females. As shown in Fig. 2, we detected similar levels
of transcripts as those found in males (10 days, 20 days), using
the exon 1 probe. Shorter testosterone treatment (6 days)
showed incomplete induction (Fig. 2). These data are consis-
tentwithourpreviousfindingsatthelevelofsteady-stateRNA
showing that the transcriptional response of females upon
testosterone induction reaches male levels within ?20 days (2).
FIG. 1.
Liver RNA (30 ?g) from B10aw18mice (males, lanes 1 and 2, or
females, lanes 3 and 4) or BALB?c female mice (lane 6) were
hybridized to the transcription start-site probe (spliced and unspliced
protected fragments of 121 nt and 234 nt, respectively, are shown
schematically). Lanes: 1, 3, and 6, nuclear RNAs; 2 and 4, total RNA;
5, tRNA, negative control. (B) C4-Slp expression in B10aw18or
BALB?c females injected for 20 days with 700 ?g of testosterone
propionate (?T, lanes 2 and 4). A positive control is in lane 3 (B10aw18
male).Lanes1and5areuntreatedcontrols.Thirtymicrogramsoftotal
RNA was hybridized to the distal C4?C4-Slp probe (244 nt; described
in ref. 2), which distinguishes C4 (100 nt) and C4-Slp (191 nt).
RNase protection analysis of liver steady-state RNAs. (A)
FIG. 2.
on a schematic C4-Slp gene. Numbers represent the exons from which oligonucleotides have been designed. Two control probes (promoter and
actin) are also shown schematically. The probes were immobilized on filters and hybridized with labeled nascent nuclear RNA from B10aw18males
or females, or females injected for 10 days with 700 ?g of testosterone propionate. Autoradiograms are shown after 72 hr of exposure. The scatter
plot summarizes different run-on experiments, each performed on a pool of nuclei from three B10aw18livers and analyzed quantitatively by using
the PhosphorImager. The ratio exon 1?act of each experiment is reported on a logarithmic scale. Long (30 min, G) or short (10 min, E) labeling
times were used, and 6d, 10d, and 20d represent the days of testosterone treatment.
Run-on analysis of newly synthesized transcripts. The sense or antisense oligonucleotides used as probes in the run-on assays are depicted
8752Genetics: Varin-Blank et al. Proc. Natl. Acad. Sci. USA 95 (1998)

Page 4

To confirm the dependence of C4-Slp expression on androgen
induction, we tested prepuberal males for their ability to
initiate transcription. It has already been shown that C4-Slp
can only be detected in 4- to 5-week-old sexually mature males,
an age at which androgen levels become significant. When
run-on analysis was carried out on 3-week-old males no exon
1 transcripts were detected, a situation similar to females (Fig.
2).ThesedatademonstratethathormonalregulationofC4-Slp
expression takes place at the transcription initiation level.
C4 and C4-Slp Exhibit Similar Postinitiation Attenuations.
Run-on experiments in B10aw18mice suggest a transcriptional
attenuation downstream of exon 1 (Fig. 2). Control experi-
ments demonstrated that all the different probes loaded on the
filters were equally able to hybridize an in vitro transcribed
RNA (not shown). When we verified the processivity of
transcription in the isolated nuclei performing elongation for
various times we found that the average size of the synthesized
transcriptsincreasedfrom150to300ntafter10minoflabeling
(shortest time used in run-on assays) to up to 900 nt after 30
min (data not shown). To test whether this apparent attenu-
ation was C4-Slp-specific, we performed run-on experiments
in BALB?c mice. In females, which do not express C4-Slp but
do express C4, and in males, which express both genes, nascent
RNAs were detected with the first exon probe but a similar
attenuation of the signal as exhibited by B10aw18mice was
observed with an exon 2 probe (Fig. 3). Quantitative analyses
in several experiments confirmed an equivalent initiation for
the two genes (ratios exon 1?actin in Figs. 2 and 3) and a strong
reduction of the hybridization signal with an exon 2 probe
(about 20-fold, see the exon 2?actin ratios in Fig. 3). Quanti-
tatively similar results were obtained by using different label-
ing times. Moreover, when chase experiments were performed
after short labeling (10 min) and further unlabeled transcrip-
tion for various times, we did not observe a decrease of the
exon 2?actin ratio as a function of the time of chase (data not
shown). We therefore favor the hypothesis of a true attenua-
tionoftranscription(29,30)occurringbothinC4andinC4-Slp
immediately downstream of exon 1, rather than that of a
degradation of the nascent transcripts. The weak signals
observed in Figs. 2 and 3 with antisense probes for exons 7, 9,
and 14 were not detected when nuclei were incubated with
?-amanitin (before and during elongation, 2 ?g?ml, data not
shown) and thus represent RNA polymerase II transcripts. In
contrast, we observed consistently an ?-amanitin-insensitive
signal with a distal probe (exon 33) and RNA of different
origins (males or females, B10aw18or BALB?c strain). We
therefore attribute this signal to an aberrant transcription
activity not related to RNA polymerase II and not induced by
testosterone.
Activation of Liver STAT5 by GH. Because the STAT5
transcription factor has been described previously to be acti-
vated by a male-specific GH secretion pattern (21, 31), we
analyzed the effect of testosterone induction on STAT5 DNA-
binding activity, measured in vitro. As shown in Fig. 4A, a
discrete gel mobility-shift complex was formed upon incuba-
tion of an oligonucleotide containing a consensus-binding site
FIG. 3.
Probes used are identical to those described in Fig. 2. Labeled nuclear
RNA was extracted from BALB?c males (30 min or 10 min) or females
(30-min labeling). Autoradiograms after 72 hr of exposure are shown.
The scatter plots represent exon 1?actin and exon 2?actin ratios,
respectively, as obtained from several experiments performed on
BALB?c males and females or on B10aw18and BALB?c males. Long
(30 min, G) or short (10 min, E) labeling times were used.
Elongation run-on analysis along C4 and C4-Slp genes.
FIG. 4.
treatment. (A) Mobility shifts using liver nuclear extracts from males
or from females treated with testosterone for various times. Arrows
mark the position of the shifted band in experiments with different
times of gel migration. The probe was an oligonucleotide carrying the
STAT5 consensus sequence (see Materials and Methods). Exposure
times were 15 hr and 48 hr for male and female extracts, respectively.
(B) Early detection of activated STAT5 in liver nuclear extracts of
androgen-treated females (2 or 4 days). The probe was the same as in
A. An arrow points to a weak but significant shifted band observed
after 2 days of androgen treatment. Exposure time was 4 days.
Time course of liver STAT5 activation upon testosterone
Genetics: Varin-Blank et al.Proc. Natl. Acad. Sci. USA 95 (1998) 8753

Page 5

for STAT5 with nuclear extracts prepared from male but not
from female livers. The same complex was present in females
after 6 and 10 days of androgen treatment. This complex
contains STAT5, as demonstrated by the full inhibition by an
unlabeled STAT5 consensus oligonucleotide and by the su-
pershift with anti-STAT5 antibody. The detection of activated
STAT5 factor already after 6 days of testosterone treatment
was in contrast with the very weak transcriptional activity
detected by run-on analysis (Fig. 3). Thus, we investigated
STAT5 activation after 1, 2, and 4 days of testosterone
injection. As shown in Fig. 4B a gel mobility-shift complex was
already present after 2 days of androgen induction (and traces
were present after 1 day, data not shown), indicating the
presence of activated STAT5 in liver nuclei in spite of lack of
transcription initiation.
We then investigated the binding activity of STAT5 to
potential GAS sites identified in the C4-Slp promoter and
upstream region (Fig. 5). Nuclear extracts from male and
female livers were incubated with oligonucleotides corre-
spondingtothesequences?1978??1960(GAS1)and?1841?
?1821 (GAS 2) in the C4-Slp 5? flanking region or to the
corresponding C4 sequence and to the sequence ?835??816
(GAS 3), which is identical in C4-Slp and in C4. We observed
the formation of a male-specific complex after incubation with
the probes containing the GAS 1 and the GAS 2 sequences of
the C4-Slp gene. Competition with an unlabeled STAT5
consensus oligonucleotide and supershift with anti-STAT5
antibody confirmed the presence of STAT5 in the observed
complex. On the contrary, the corresponding degenerated C4
sequences did not form any complex (Fig. 5). Similarly, no
complex was observed after incubation with the sequence
GAS3 at ?835??816 (data not shown). These findings indi-
cate that STAT5 recognizes and binds C4-Slp-specific targets
after its activation by a male-specific GH release pattern.
DISCUSSION
Sex differences in GH secretory patterns have been described
as the major determinants in the sexually dimorphic expression
of several liver genes. In mice, for example, the most important
parameter determining male-specific gene expression is
thought to be the period of low-plasma GH separating pulses,
which is longer than that in females (32). Recent studies on the
hamster CYP3A-10?6?-hydroxylase gene, which is expressed
only in males and depends on a GH secretory pattern, have
implicated the translocation into the nucleus of the STAT5
transcription factor upon GH-pulse-induced phosphorylation
(21). This finding has been confirmed in hypophysectomized
rats (31). Moreover, in STAT5b ??? mice the expression of
male-specific genes like MUP and CYP2D9 is abolished, sug-
gesting that STAT5b may be the major STAT protein that
mediates the sexually dimorphic effects of GH in the liver (22).
The striking differential expression of the closely related
genes C4 and C4-Slp (95% sequence identity) provides a
unique model to study crucial sequence elements responsible
for sex-specific hormonal regulation. A sex-specific pattern of
growthhormonesecretioninducedbyandrogensisresponsible
for the 100-fold-higher levels of C4-Slp expression in males
compared with females (2, 10). The influence of sex steroids
on the pulsatile GH-secretory pattern has been investigated in
rats, showing that testosterone is necessary for maintaining in
adult life the long period of low GH plasma levels typical of
males (33).
Here we provide in vivo analysis of the transcriptional
regulation of C4 and C4-Slp in run-on experiments performed
in a context where the C4-Slp gene can be studied separately.
We demonstrate that the sex-specific hormonal regulation of
C4-Slp takes place primarily at the level of transcription
initiation and leads to at least a 40-fold-higher transcription in
males compared with females. All previous in vitro studies
(including transfections of reporter constructs and cell-free
transcriptions) aimed at comparing the promoters of these two
genes failed to show more than a 2- to 5-fold difference (10).
On the other hand, all attempts to express the complete C4-Slp
gene in cell transfection have failed, in spite of the presence of
a functional promoter and up to 6 kb of 5? flanking sequences.
Run-on experiments with nuclei isolated from L cells stably
transfected with the entire genes moreover revealed transcrip-
tion initiation only for C4 but not for C4-Slp (N.V.-B., unpub-
lished data). Oocyte injections of C4-Slp cosmids generated
full-length transcripts of C4-Slp, which were aberrantly initi-
ated 100 bp upstream of the regular liver initiation start site
(our unpublished data). These results indicate that the ability
to express the C4-Slp gene in an androgen-dependent mode
dependsonthepresenceofthenaturalliver-specificchromatin
context, as suggested by others (18, 34, 35).
The 5? upstream region of C4-Slp has been investigated
hitherto under the hypothesis of androgen receptor binding to
C4-Slp-specific sequences (18, 35). Prompted by recent reports
on GH-dependent activation (21, 31) we demonstrated the
presence of active STAT5 in male liver nuclei and in the nuclei
of testosterone-treated females as early as 48 hr after the onset
FIG. 5.
along the top of the figure, and the most conserved nucleotides of the consensus sequence for STAT5 binding are underlined. Numbers indicate
the position of the first T in the C4-Slp sequence. Retardation gel shift assays were performed with probes encompassing GAS 1 and GAS 2
sequences (described in Materials and Methods) and liver nuclear extracts from male (m) or female (f) B10aw18mice. Competition was performed
with 50-fold excess of unlabeled probe in the binding reaction. An arrow indicates the position of the protein–probe complex. Signals of various
intensities at the top of each lane correspond to the origin of gel migration. Exposure was for 2 days.
Selective STAT5 binding to upstream GAS sites of C4-Slp. C4-Slp GAS sequences and the corresponding C4 control sequences are shown
8754Genetics: Varin-Blank et al. Proc. Natl. Acad. Sci. USA 95 (1998)