The genetic basis of tetrathionate respiration in Salmonella Typhimurium

Lehrstuhl für Bakteriologie, Max von Pettenkofer-Institut für Hygiene und Medizinische Mikrobiologie, Pettenkoferstr. 9a, D-80336 Munich, Germany.
Molecular Microbiology (Impact Factor: 4.42). 05/1999; 32(2):275-87. DOI: 10.1046/j.1365-2958.1999.01345.x
Source: PubMed

ABSTRACT A range of bacteria are able to use tetrathionate as a terminal respiratory electron acceptor. Here we report the identification and characterization of the ttrRSBCA locus required for tetrathionate respiration in Salmonella typhimurium LT2a. The ttr genes are located within Salmonella pathogenicity island 2 at centisome 30.5. ttrA, ttrB and ttrC are the tetrathionate reductase structural genes. Sequence analysis suggests that TtrA contains a molybdopterin guanine dinucleotide cofactor and a [4Fe-4S] cluster, that TtrB binds four [4Fe-4S] clusters, and that TtrC is an integral membrane protein containing a quinol oxidation site. TtrA and TtrB are predicted to be anchored by TtrC to the periplasmic face of the cytoplasmic membrane implying a periplasmic site for tetrathionate reduction. It is inferred that the tetrathionate reductase, together with thiosulphate and polysulphide reductases, make up a previously unrecognized class of molybdopterin-dependent enzymes that carry out the reductive cleavage of sulphur-sulphur bonds. Cys-256 in TtrA is proposed to be the amino acid ligand to the molybdopterin cofactor. TtrS and TtrR are the sensor and response regulator components of a two-component regulatory system that is absolutely required for transcription of the ttrBCA operon. Expression of an active tetrathionate reduction system also requires the anoxia-responsive global transcriptional regulator Fnr. The ttrRSBCA gene cluster confers on Escherichia coli the ability to respire with tetrathionate as electron acceptor.

1 Follower
105 Reads
  • Source
    • "In particular, reactive oxygen species generated by neutrophils (PMNs) during inflammation can react with endogenous thiosulfate to form tetrathionate, a respiratory electron acceptor (21). The ability to respire tetrathionate has been mapped to the ttrRSBCA locus, which is located in SPI-2 (22). Under anaerobic conditions in which thiosulphate was oxidized to tetrathionate, S. typhimurium displays a growth advantage in comparison to resident microbiota under the same conditions (21). "
    [Show abstract] [Hide abstract]
    ABSTRACT: The human intestinal epithelium consists of a single layer of epithelial cells that forms a barrier against food antigens and the resident microbiota within the lumen. This delicately balanced organ functions in a highly sophisticated manner to uphold the fidelity of the intestinal epithelium and to eliminate pathogenic microorganisms. On the luminal side, this barrier is fortified by a thick mucus layer, and on the serosal side exists the lamina propria containing a resident population of immune cells. Pathogens that are able to breach this barrier disrupt the healthy epithelial lining by interfering with the regulatory mechanisms that govern the normal balance of intestinal architecture and function. This disruption results in a coordinated innate immune response deployed to eliminate the intruder that includes the release of antimicrobial peptides, activation of pattern-recognition receptors, and recruitment of a variety of immune cells. In the case of Salmonella enterica serovar typhimurium (S. typhimurium) infection, induction of an inflammatory response has been linked to its virulence mechanism, the type III secretion system (T3SS). The T3SS secretes protein effectors that exploit the host's cell biology to facilitate bacterial entry and intracellular survival, and to modulate the host immune response. As the role of the intestinal epithelium in initiating an immune response has been increasingly realized, this review will highlight recent research that details progress made in understanding mechanisms underlying the mucosal inflammatory response to Salmonella infection, and how such inflammatory responses impact pathogenic fitness of this organism.
    Frontiers in Immunology 07/2014; 5:311. DOI:10.3389/fimmu.2014.00311
  • Source
    • "The ability to respire tetrathionate is likely to be significant within the life cycle of Salmonella spp. [23]. The sequences of the oligonucleotide primer sets used were (5′CTCACCAGGAGATTACAACATGG3′) as forward primer and (5′AGCTCAGACCAAAAGTGACCATC3′) as reverse primer and the expected size was 94 bp (Figure 2). "
    [Show abstract] [Hide abstract]
    ABSTRACT: A total of 200 samples of milk and dairy products as well as 120 samples of dairy handlers were randomly collected from different dairy farms and supermarkets in Dakahlia Governorate, Egypt. The conventional cultural and serotyping methods for detection of Salmonella in dairy products were applied and the results were compared with those obtained by molecular screening assay using (ttr sequence). The obtained results revealed that 21% of milk and dairy products (42/200) were positive for Salmonella species using enrichment culture-based PCR method, while 12% of different dairy samples (24/200) were found to be positive for Salmonella species by using the conventional culture methods. Two stool specimens out of 40 apparently healthy dairy handlers were positive by the PCR method. Serotyping of Salmonella isolates revealed that 58.3% (14/24) from different dairy products were contaminated with Salmonella Typhimurium. We conclude that the enrichment culture-based PCR assay has high sensitivity and specificity for detection of Salmonella species in dairy products and handlers. High incidence of Salmonella Typhimurium in the examined dairy samples highlights the important role played by milk and dairy products as a vehicle in disease prevalence. Great effort should be applied for reducing foodborne risk for consumers.
    Veterinary Medicine International 04/2014; 2014:502370. DOI:10.1155/2014/502370
  • Source
    • "In this context, the aim of this study was the development and in-house validation of an open-formula diagnostic realtime PCR for detection of Salmonella in different meat products chosen according with Commission Regulation (EC) No. 2073 of 15 November 2005 on microbiological criteria for foodstuffs. The assay employed specific primers and a probe target within the ttrRSBCA locus, in Salmonella (Malorny et al. 2004a; Hensel et al. 1999). The original protocol (Malorny et al. 2004a) was modified with the inclusion of a new, easy to prepare Internal Amplification Control (IAC) which was added to every reaction mixture, to avoid false negative results (Abdulmawjood et al. 2002; Hoorfar et al. 2004b; Hoorfar et al. 2003). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Foodborne disease caused by Salmonella represents a worldwide public health problem. In Europe, salmonellosis is still the second most commonly recorded zoonosis. Since the standard culture method for detecting Salmonella (ISO 6579:2002) requires up to 5 days to produce results, the need to develop rapid methods represents an important issue for the authorities and the producers. The aim of the present study was the in-house validation, according to ISO 16140, of an open-formula diagnostic real-time PCR for the detection of Salmonella in all the different meat categories reported in the EU Regulations relative to microbiological criteria for food safety. The assay employed specific primers and a probe target within the ttrRSBCA locus, which allows the tetrathionate respiration in Salmonella. Selectivity, relative accuracy, relative sensitivity and relative specificity were established by testing 110 bacterial strains and 175 various edible meat samples. Results showed 100 % selectivity, 100 % relative accuracy, 100 % relative sensitivity and 100 % relative specificity of the real-time PCR when compared to the standard culture method used as reference. In addition, in order to minimize the effect of the competitive micro-flora naturally present on meat samples, a highly nutritious and selective commercial medium (ONE Broth Salmonella, Oxoid) was evaluated in comparison with the classical non-selective pre-enrichment broth (buffered peptone water). Results demonstrated that the ONE Broth Salmonella medium increases the growth of Salmonella in the presence of competitive micro-flora.
    Food Analytical Methods 08/2013; 6(4). DOI:10.1007/s12161-013-9570-3 · 1.96 Impact Factor
Show more