PCR and blood culture of Escherichia coli bacteremia in rats

Klinik für Anästhesiologie, Hygiene Institute, University of Tübingen, Tübingen, Germany.
Journal of Clinical Microbiology (Impact Factor: 3.99). 08/1999; 37(8):2479-82.
Source: PubMed


Critically ill patients often develop symptoms of sepsis and therefore require microbiological tests for bacteremia that use conventional blood culture (BC) techniques. However, since these patients frequently receive early empirical antibiotic therapy before diagnostic procedures are completed, examination by BC can return false-negative results. We therefore hypothesized that PCR could improve the rate of detection of microbial pathogens over that of BC. To test this hypothesis, male Wistar rats were challenged intravenously with 10(6) CFU of Escherichia coli. Blood was then taken at several time points for detection of E. coli by BC and by PCR with E. coli-specific primers derived from the uidA gene, encoding beta-glucuronidase. In further experiments, cefotaxime (100 or 50 mg/kg of body weight) was administered intravenously to rats 10 min after E. coli challenge. Without this chemotherapy, the E. coli detection rate decreased at 15 min and at 210 min after challenge from 100% to 62% of the animals with PCR and from 100% to 54% of the animals with BC (P, >0.05). Chemotherapy decreased the E. coli detection rate at 25 min and at 55 min after challenge from 100% to 50% with PCR and from 100% to 0% with BC (P, <0.05). Thus, at clinically relevant serum antibiotic levels, PCR affords a significantly higher detection rate than BC in this rat model. The results suggest that PCR could be a useful adjunct tool supplementing conventional BC techniques in diagnosing bacteremia.

6 Reads
  • Source
    • "Once diluted, one loop was cultured on MacConkey agar (direct plating) at 37 8C for 18–20 h. One compatible colony per plate was selected and confirmed by PCR (Heininger et al., 1999). This confirmed colony of indicator E. coli (i.e. one clon per animal) was tested for antimicrobial susceptibility. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Wildlife is increasingly abundant in urban environments, but little is known about the zoonotic pathogens carried by these populations. Urban wild boars are of particular concern because this species is well-known as a pathogen reservoir, and thus, we studied selected zoonotic pathogens in urban wild boars in Barcelona, Spain (n=41). Salmonella enterica was found in 5.00% (95% CI 0.61-16.91) and Campylobacter coli in 4.88% (95% CI 0.6-16.53) of the animals. E. coli O157:H7 and C. jejuni were not found. Other thermophilic Campylobacter were moderately prevalent (19.51%, 95% CI 8.82-34.87). Additionally, we screened for antimicrobial resistance in indicator bacteria: resistance was most frequent in Enterococcus faecium (95% of the isolates were resistant to at least one antimicrobial agent), followed by Enterococcus faecalis (50%) and Escherichia coli (10%). For the first time resistance to linezolid in bacteria carried by wildlife is reported. These findings pose a concern for public health, and thus, further research is needed on wildlife in urban environments.
    Veterinary Microbiology 08/2013; 167(3-4). DOI:10.1016/j.vetmic.2013.07.037 · 2.51 Impact Factor
  • Source
    • "After overnight incubation at 37°C, DNA was extracted by conventional phenol chloroform method and quantified according to Sambrook et al.[17]. For confirmation of E. coli, PCR was performed by targeting uidA gene by following conditions described by Heninger et al.[18]. Primers are listed in Table 1. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Uropathogenic E.coli (UPEC) are among major pathogens causing urinary tract infections. Virulence factors are mainly responsible for the severity of these emerging infections. This study was planned to investigate the distribution of virulence genes and cytotoxic effects of UPEC isolates with reference to phylogenetic groups (B2, B1, D and A) to understand the presence and impact of virulence factors in the severity of infection in Faisalabad region of Pakistan. In this study phylogenetic analysis, virulence gene identification and cytotoxicity of 59 uropathogenic E.coli isolates obtained from non-hospitalized patients was studied. Among 59 isolates, phylogenetic group B2 (50%) was most dominant followed by groups A, B1 (19% each) and D (12%). Isolates present in group D showed highest presence of virulence genes. The prevalence hlyA (37%) was highest followed by sfaDE (27%), papC (24%), cnf1 (20%), eaeA (19%) and afaBC3 (14%). Highly hemolytic and highly verotoxic isolates mainly belonged to group D and B2. We also found two isolates with simultaneous presence of three fimbrial adhesin genes present on pap, afa, and sfa operons. This has not been reported before and underlines the dynamic nature of these UPEC isolates. It was concluded that in local UPEC isolates from non-hospitalized patients, group B2 was more prevalent. However, group D isolates were most versatile as all were equipped with virulence genes and showed highest level of cytotoxicity.
    Annals of Clinical Microbiology and Antimicrobials 08/2012; 11(1):23. DOI:10.1186/1476-0711-11-23 · 2.19 Impact Factor
  • Source
    • "The quantitative estimation of the isolated DNA was done spectrophotometrically (Lambda 5UV/Vis, Perkin Elmer, USA; Bio projects Gmbh, Germany) at 260nm. PCR for confirmation was performed by targeting conserved region of uid A gene (encoding ß-glucuronidase) of E. coli genome by using primers EC-F (5'ATCACCGTGGTGACGCATGTCGC3') and EC-R (5'CACCACGATGCCATGTTCATCTGC3') with an amplification product of 486 bp (7). Each 100 µL reaction mixture contained 1x PCR buffer (50 mM KCl, 10mM Tris HCl; pH 8.3); 2.5 mM MgCl2; dNTP’s (dATP, dCTP, dGTP, dTTP) 0.2 mM each; 50 pmol of each primer; 5 U of recombinant Taq polymerase (Fermentas) and 20ng of DNA template. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The objective of this work was the phylogenetic characterization of local clinical isolates of uropathogenic E. coli with respect to drug resistance. A total of 59 uropathogenic E. coli responsible for community acquired urinary tract infections were included in this study. A triplex PCR was employed to segregate each isolate into four different phylogenetic groups (A, B1, B2 and D). Drug resistance was evaluated by disc diffusion method. The drugs used were ampicillin, aztreonam, cefixime, cefoperazone, ceftriaxone, cephradine among β-lactam group; amikacin, gentamicin, and streptomycin among aminoglycosides; nalidixic acid and ciprofloxacin from quinolones; trimethoprim-sulfomethoxazole, and tetracycline. Among 59 uropathogenic E. coli isolates majority belonged to phylogenetic group B2 (50%) where as 19% each belonged to groups A and B1, and 12% to group D. All the isolates were multiple drug resistant (MDR). Most effective drugs against Group A, B1, and B2 were gentamicin, amikacin and cefixime; ceftriaxone and quinolones; and ceftriaxone and amikacin, respectively. Group D isolates were found to be highly resistant to all drugs. Our results have shown emergence of MDR isolates among uropathogenic E. coli with dominance of phylogenetic group B2. However, it was found that group D isolates were though less frequent, more drug resistant as compared with group B2. Groups A and B1 were relatively uncommon. Amikacin, ceftriaxone and gentamicin were the most effective drugs in general.
    Brazilian Journal of Microbiology 10/2011; 42(4):1278-83. DOI:10.1590/S1517-83822011000400005 · 0.59 Impact Factor
Show more


6 Reads
Available from