Mutations in the yeast LCB1 and LCB2 genes, including those corresponding to the hereditary sensory neuropathy type I mutations, dominantly inactivate serine palmitoyltransferase.

Abstract

It was recently demonstrated that mutations in the human SPTLC1 gene, encoding the Lcb1p subunit of serine palmitoyltransferase (SPT), cause hereditary sensory neuropathy type I . As a member of the subfamily of pyridoxal 5'-phosphate enzymes known as the alpha-oxoamine synthases, serine palmitoyltransferase catalyzes the committed step of sphingolipid synthesis. The residues that are mutated to cause hereditary sensory neuropathy type I reside in a highly conserved region of Lcb1p that is predicted to be a catalytic domain of Lcb1p on the basis of alignments with other members of the alpha-oxoamine synthase family. We found that the corresponding mutations in the LCB1 gene of Saccharomyces cerevisiae reduce serine palmitoyltransferase activity. These mutations are dominant and decrease serine palmitoyltransferase activity by 50% when the wild-type and mutant LCB1 alleles are coexpressed. We also show that serine palmitoyltransferase is an Lcb1p small middle dotLcb2p heterodimer and that the mutated Lcb1p proteins retain their ability to interact with Lcb2p. Modeling studies suggest that serine palmitoyltransferase is likely to have a single active site that lies at the Lcb1p small middle dotLcb2p interface and that the mutations in Lcb1p reside near the lysine in Lcb2p that is expected to form the Schiff's base with the pyridoxal 5'-phosphate cofactor. Furthermore, mutations in this lysine and in a histidine residue that is also predicted to be important for pyridoxal 5'-phosphate binding to Lcb2p also dominantly inactivate SPT similar to the hereditary sensory neuropathy type 1-like mutations in Lcb1p.

Full text

Page 1

University of Nebraska - Lincoln
DigitalCommons@University of Nebraska - Lincoln
Uniformed Services University of the Health
Sciences
US Department of Defense
1-1-2002
Mutations in the YeastLCB1andLCB2Genes,
Including Those Corresponding to the Hereditary
Sensory Neuropathy Type I Mutations,
Dominantly Inactivate Serine Palmitoyltransferase
Ken Gable
Uniformed Services University of the Health Sciences
Gongshe Han
Uniformed Services University of the Health Sciences
Erin Monaghan
Uniformed Services University of the Health Sciences
Dagmar Bacikova
Uniformed Services University of the Health Sciences
Mukil Natarajan
Uniformed Services University of the Health Sciences
See next page for additional authors
This Article is brought to you for free and open access by the US Department of Defense at DigitalCommons@University of Nebraska - Lincoln. It has
been accepted for inclusion in Uniformed Services University of the Health Sciences by an authorized administrator of DigitalCommons@University
of Nebraska - Lincoln.
Gable, Ken; Han, Gongshe; Monaghan, Erin; Bacikova, Dagmar; Natarajan, Mukil; Williams, Robert; and Dunn, Teresa M.,
"Mutations in the YeastLCB1andLCB2Genes, Including Those Corresponding to the Hereditary Sensory Neuropathy Type I
Mutations, Dominantly Inactivate Serine Palmitoyltransferase" (2002).Uniformed Services University of the Health Sciences.Paper 56.
http://digitalcommons.unl.edu/usuhs/56

Page 2

Authors
Ken Gable, Gongshe Han, Erin Monaghan, Dagmar Bacikova, Mukil Natarajan, Robert Williams, and Teresa
M. Dunn
This article is available at DigitalCommons@University of Nebraska - Lincoln:http://digitalcommons.unl.edu/usuhs/56

Page 3

Mutations in the Yeast LCB1 and LCB2 Genes, Including Those
Corresponding to the Hereditary Sensory Neuropathy Type I
Mutations, Dominantly Inactivate Serine Palmitoyltransferase*
Received for publication, August 16, 2001, and in revised form, December 19, 2001
Published, JBC Papers in Press, January 7, 2002, DOI 10.1074/jbc.M107873200
Ken Gable‡, Gongshe Han‡, Erin Monaghan‡, Dagmar Bacikova‡, Mukil Natarajan‡,
Robert Williams§, and Teresa M. Dunn‡¶
From the ‡Department of Biochemistry and Molecular Biology and the §Department of Biomedical Informatics,
Uniformed Services University of the Health Sciences, Bethesda, Maryland 20184
It was recently demonstrated that mutations in the
human SPTLC1 gene, encoding the Lcb1p subunit of
serine palmitoyltransferase (SPT), cause hereditary
sensory neuropathy type I (1, 2). As a member of the
subfamily of pyridoxal 5?-phosphate enzymes known as
the ?-oxoamine synthases, serine palmitoyltransferase
catalyzes the committed step of sphingolipid synthesis.
The residues that are mutated to cause hereditary sen-
sory neuropathy type I reside in a highly conserved
region of Lcb1p that is predicted to be a catalytic do-
main of Lcb1p on the basis of alignments with other
members of the ?-oxoamine synthase family. We found
that the corresponding mutations in the LCB1 gene of
Saccharomyces cerevisiae reduce serine palmitoyltrans-
ferase activity. These mutations are dominant and de-
crease serine palmitoyltransferase activity by 50% when
the wild-type and mutant LCB1 alleles are coexpressed.
We also show that serine palmitoyltransferase is an
Lcb1p?Lcb2p heterodimer and that the mutated Lcb1p
proteins retain their ability to interact with Lcb2p. Mod-
eling studies suggest that serine palmitoyltransferase is
likely to have a single active site that lies at the
Lcb1p?Lcb2p interface and that the mutations in Lcb1p
reside near the lysine in Lcb2p that is expected to form
the Schiff’s base with the pyridoxal 5?-phosphate cofac-
tor. Furthermore, mutations in this lysine and in a his-
tidine residue that is also predicted to be important for
pyridoxal 5?-phosphate binding to Lcb2p also domi-
nantly inactivate SPT similar to the hereditary sensory
neuropathy type 1-like mutations in Lcb1p.
The sphingolipids are essential components of all eukaryotic
cells. They confer important structural properties to mem-
branes and partition into microdomains that are believed to
organize proteins involved in signal transduction and mem-
brane-trafficking pathways (3). In addition, sphingolipid me-
tabolites are regulatory molecules for a variety of cellular pro-
cesses (4–6). These bioactive sphingolipid metabolites are
formed as intermediates during both the synthesis and the
breakdown of the complex sphingolipids. Many human diseases
that result from defects in sphingolipid catabolism have been
discovered (7), but examples of defects in sphingolipid biosyn-
thesis that cause diseases have been lacking. However, it was
recently reported that hereditary sensory neuropathy type 1
(HSN1),1the most common inherited peripheral neuropathy,
results from mutations in the Lcb1p subunit of serine palmi-
toyltransferase (SPT) (1, 2).
SPT catalyzes the committed step in the synthesis of sphingo-
lipids, the condensation of serine with palmitoyl CoA (see Fig. 1
below). It is a member of the subfamily of pyridoxal 5?-phosphate
(PLP) enzymes known as the ?-oxoamine synthases that all
catalyze the condensation of a carboxylic acid CoA thioester with
the ?-carbon of an amino acid. The other ?-oxoamine synthases
are 8-amino-7-oxononanoate synthase (AONS), which catalyzes
the first step of biotin synthesis in Escherichia coli (8), 5-amin-
olevulinate synthase (ALAS), which catalyzes the synthesis of
5-amino levulinic acid during heme biosynthesis (9), and 2-ami-
no-3-ketobutyrate CoA ligase, which is involved in threonine
degradation (10). The LCB1 and LCB2 genes, found to be re-
quired for SPT activity using genetic screens in Saccharomyces
cerevisiae (11–14), encode proteins homologous to the ?-oxoamine
synthases. Homologs of the LCB1 and LCB2 genes from higher
eukaryotes have been identified based on their similarity to the
S. cerevisiae LCB genes (15).
The crystal structure of the AONS enzyme reveals that sev-
eral functionally important residues, including those that are
involved in PLP binding, are highly conserved in the ?-oxoam-
ine synthases (16, 17). Although Lcb1p and Lcb2p are homol-
ogous to each other and to AONS (see Fig. 2A below), many of
these conserved residues are present in Lcb2p (for example,
Lys-366, which is predicted to form a Schiff’s base with PLP),
but not in Lcb1p. Interestingly, a soluble Lcb2p homodimeric
form of SPT was recently characterized from the glycosphingo-
lipid-producing bacterium Sphingomonas paucimobilis (18).
However, in eukaryotes both proteins are required for SPT
activity. Thus unlike the other ?-oxoamine synthases that are
soluble homodimers, the eukaryotic SPT enzyme is membrane-
associated, and enzyme activity requires both the Lcb1p and
the Lcb2p subunit. In comparison to the other members of the
family, Lcb1p and Lcb2p also have amino- and carboxyl-termi-
nal extensionsthat may be
association.
important formembrane
* This work was supported by Uniformed Services University of the
Health Sciences Grant C071FT, National Science Foundation Grant
G171FL and MCB0078100, and National Institutes of Health Grant
GM51891 (to T. M. D.). The costs of publication of this article were
defrayed in part by the payment of page charges. This article must
therefore be hereby marked “advertisement” in accordance with 18
U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence should be addressed: Dept. of Biochemis-
try and Molecular Biology, Uniformed Services University of the Health
Sciences, 4301 Jones Bridge Rd., Bethesda, MD 20184. Tel.: 301-295-
3592; Fax: 301-295-3512; E-mail: tdunn@usuhs.mil.
1The abbreviations used are: HSN1, hereditary sensory neuropathy
type 1; SPT, serine palmitoyltransferase; PLP, pyridoxal 5?-phosphate;
AONS, 8-amino-7-oxononanoate synthase; ALAS, 5-aminolevulinate
synthase; HA, the hemagglutinin epitope; PHS, phytosphingosine; IPC,
inositolphosphoceramide; 3-KS, 3-ketosphinganine; DHS, dihydro-
sphingosine; MIPC, mannoseinositolphosphorylceramide.
THE JOURNAL OF BIOLOGICAL CHEMISTRY
Vol. 277, No. 12, Issue of March 22, pp. 10194–10200, 2002
Printed in U.S.A.
This paper is available on line at http://www.jbc.org
10194

This article is a U.S. government work, and is not subject to copyright in the United States.

Page 4

The human homolog of the LCB1 gene, SPTLC1, is mutated
at cysteine 133 (C133W or C133Y) or at valine 144 (V144D) in
HSN1 patients (1, 2). Because the HSN1 mutations reside in a
region of Lcb1p that has been conserved throughout evolution
(Fig. 2) (13, 15), we characterized the corresponding mutations
in S. cerevisiae to gain insight into how the HSN1 mutations in
Lcb1p might affect SPT activity. In the studies reported here,
we show that the HSN1 mutations in yeast Lcb1p dominantly
inactivate SPT. We also demonstrate that SPT is an
Lcb1p?Lcb2p heterodimer. On the basis of modeling studies, we
predicted that the mutated cysteine in Lcb1p resides in close
proximity to residues in Lcb2p that are involved in PLP bind-
ing. We mutated two residues in Lcb2p that are predicted to be
important for PLP binding and found that these mutant pro-
teins also dominantly inactivate SPT.
EXPERIMENTAL PROCEDURES
Yeast Methods—Yeast cells were grown according to standard pro-
cedures (19). The wild-type yeast strain was TDY2037 (Mat? ura3–52
leu2 trp1 lys2), the csg2? mutant was TDY2302 (Mat? ura3–52 leu2
trp1 lys2 csg2::URA3), the lcb1? mutant was TDY2507 (Mat? ura3–52
leu2 trp1 lys2 lcb1::TRP1), and the lcb2? mutant was TDY2503 (Mata
ura3–52 leu2 trp1 lys2 lcb2::TRP1). Phytosphingosine (PHS, 15 ?M) and
0.1% tergitol was included in the medium for the lcb1? and lcb2?
mutant cells.
Construction of LCB1 and LCB2 Mutant Alleles—The lcb1 and lcb2
mutant alleles were constructed by QuikChange mutagenesis (Strat-
agene). For the LCB1 mutations a pRS315-based plasmid containing a
BamHI to KpnI LCB1 fragment, which extended from 250 bp upstream
of the start codon to 135 bp downstream of the stop codon, was used as
template. The mutagenic primer pairs used to create the mutations
were: For C180Y: 5?-TGTGGGCGCCTATGGTCCCGCCG and its
complement; for C180W: 5?-TGTGGGCGCCTGGGGTCCCGCCG and
its complement; for V191D: 5?-CGGTAACCAGGACGATCATTACACG-
TTGG and its complement. For the LCB2 mutations a pRS316-based
plasmid containing a AvrII to EcoRI LCB2 fragment, which extended
from 680 bp upstream of the start codon to 345 bp downstream of the
stop codon, was used as template. The mutagenic primer pairs used to
create the mutations were: For K366T: 5?-ATGGGTACTTTCACTACG-
TCGTTTGGTGCTGCT and its complement; for H334F: 5?-TTTATCG-
ATGAAGCCTTTTCTATAGGCGCTATG and its complement.
Construction of the HA-tagged LCB1 and LCB2 Alleles—Attempts to
construct functional Lcb1p or Lcb2p with HA tags on the amino- or
carboxyl-terminal ends were unsuccessful. Therefore, the tags were
placed internal to the coding sequence. The tagged alleles used in these
studies complemented their respective null mutants demonstrating
that they were functional. For the HA-tagged LCB1 allele, the HA tag
was inserted between codons 9 and 10 in the LCB1 gene. Codons 9 and
10 were first converted to an AvrII site in pRS315-LCB1 by Quik
Change mutagenesis using the primer 5?-ACATCCCAGAGGTTTTAC-
CTAGGTCAATACCGATTCCGGCA (the AvrII site is shown in bold)
and its complement. A SpeI-ended triple-HA cassette (previously desc-
ribed) (20) was inserted into the AvrII site. Using the same strategy,
codons 53 and 54 of LCB2 were converted to an AvrII site in pRS316-
LCB2 and the SpeI-ended triple-HA cassette was inserted into the AvrII
site. The primer pair used to introduce the AvrII site in LCB2 was 5?-
GGTCATGTTCACGACTTCTTACCTAGGACCTTCCAAAAAAACAAAC-
ATC and its complement.
SPT Assays—Microsomes were prepared as previously described ex-
cept that the cells were grown in minimal medium (to maintain selec-
tion for plasmids) to an A600of ?1 and were then diluted 20-fold into
YPD medium (1% yeast extract, 2% bactopeptone, and 2% glucose) and
allowed to double four or five times prior to harvesting. This eliminated
the high background of palmitoyl CoA-independent incorporation of
radioactivity from serine into the organic phase, which was consistently
observed when microsomes prepared from cells grown in minimal me-
dium were used for the SPT assay. TLC analysis of the extracted
radioactive products confirmed that this labeled species was not a
long-chain base (data not shown). SPT was assayed as previously de-
scribed (20) using 0.4 mg of microsomal protein and 0.1 mM palmitoyl
CoA. Each assay was conducted in quadruplicate, and the average SPT
activity is reported.
Immunoprecipitation and Western Blots—Microsomal protein was
prepared as previously described (20), and 100 ?g (at 1 mg/ml) was
solubilized with 0.1% sucrose monolaurate. Following centrifugation at
100,000 ? g for 30 min, the supernatant was transferred to a fresh tube.
Twenty ?l of protein A-Sepharose beads (125 mg/ml), which had been
prebound with 3 ?l of monoclonal anti-HA antibody (BAbCO), were
added to the solubilized microsomal protein. Following a 2-h incubation
at 4 °C, the beads were washed three times, and 10% of the immuno-
precipitated protein was subjected to 8% SDS-PAGE electrophoresis.
The methods used for immunoblotting and for detection of Lcb1p and
Lcb2p with the anti-Lcb1p and anti-Lcb2p antibodies were previously
described (20).
Molecular Exclusion Fast-protein Liquid Chromatography—Microso-
mal proteins were solubilized in 0.05 M Tris, pH 7.5, 1 mM EGTA, 1 mM
phenylmethylsulfonyl fluoride, 0.1% sucrose monolaurate, loaded onto
a Superose-12 fast-protein liquid chromatography column, and eluted
with the solubilization buffer at a flow rate of 0.4 ml/min. Molecular
weight standards were added to the sample prior to application to the
column. Fractions (0.5 ml) were concentrated and analyzed by SDS-
PAGE electrophoresis on a 4–20% gradient gel. Molecular markers
were visualized by Coomassie Blue staining, and Lcb1p and Lcb2p were
detected by Western blotting as described previously (20).
RESULTS
The HSN1 Mutations in Yeast Lcb1p Dominantly Inactivate
SPT—The LCB1 gene is essential for viability, but lcb1? yeast
cells will grow if phytosphingosine (PHS) is provided in the
medium (Fig. 1). To determine the effect of the HSN1 muta-
tions on SPT activity, we made the corresponding mutations
(C180W, C180Y, and V191D) in the yeast LCB1 gene (Fig. 2).
The HSN1-LCB1 alleles did not complement the PHS-requir-
ing phenotype of the lcb1? mutant. Transformants carrying
centromeric plasmids harboring the LCB1-C180W allele were
unable to grow without PHS under any conditions, whereas
those carrying the LCB1-C180Y or the LCB1-V191D alleles
grew poorly at 26 °C and failed to grow at 37 °C (data not
shown). Based on prior characterization of the growth pheno-
types of SPT mutants (20–22) these results indicated that the
HSN1 mutations reduced SPT activity. Assays of microsomal
SPT activity confirmed this conclusion (Fig. 3A), because there
was no detectable SPT activity in microsomes prepared from
the LCB1-C180W and LCB1-C180Y mutant cells and about
10% of wild-type SPT activity in microsomes prepared from
LCB1-V191D cells. These results demonstrated that the HSN1
mutations in Lcb1p severely compromise SPT activity in yeast.
The yeast HSN1-LCB1 alleles are loss-of-function muta-
tions. Assuming that the corresponding mutations also inacti-
vate human SPT, the dominant HSN1 disorder could result
from haploinsufficiency or the mutations could be dominant-
negative. We tested whether the HSN1-LCB1 alleles were dom-
inant by introducing them into haploid LCB1?yeast cells. An
LCB1?csg2? haploid strain was used, because it provided an
assay for reduced in vivo SPT activity. Cells lacking the CSG2
gene fail to mannosylate inositolphosphorylceramide (IPC) and
therefore accumulate high levels of IPC (Fig. 1), which leads to
Ca2?sensitivity (12). Mutations that reduce IPC, including
those that reduce SPT activity, suppress the Ca2?sensitivity of
the csg2? mutant (12, 20–22). Introduction of the plasmid-
borne LCB1-C180W, LCB1-C180Y, or LCB1-V191D allele into
the LCB1?csg2? haploid strain suppressed the Ca2?sensitiv-
ity indicating that the mutant alleles dominantly inactivated
SPT activity in vivo (Fig. 4A). Microsomal SPT activity meas-
urements confirmed this, revealing a 2-fold reduction in en-
zyme activity (Fig. 3B). These experiments demonstrated that
the HSN1-LCB1 alleles were dominant inactivating mutations
that reduced in vitro SPT activity about 50% when they were
coexpressed with a wild-type LCB1 allele, and that they also
reduced in vivo SPT activity.
SPT Is an Lcb1p?Lcb2p Heterodimer—We next investigated
the subunit structure of SPT. As mentioned above, the other
?-oxoamine synthases, including a bacterial SPT enzyme (18),
are soluble homodimers. However, eukaryotic SPT is a mem-
brane-associated enzyme comprised of two homologous sub-
Dominant Negative Mutations in the Lcb1p and Lcb2p Subunits of SPT
10195

Page 5

units, Lcb1p and Lcb2p (20, 23). Hanada and coworkers (23) have
shown that the mammalian SPT enzyme is comprised of Lcb1p
and Lcb2p in a 1:1 stoichiometry. We addressed the oligomeric
structure of yeast SPT to determine whether the enzyme is an
Lcb1p?Lcb2p heterodimer or some higher order structure, for
example, a tetramer of homodimers. For these experiments, we
generated HA-tagged Lcb1p and HA-tagged Lcb2p proteins. The
tagged proteins were found to be functional because they com-
plemented their respective knock-outs (see “Experimental Proce-
dures”); thus, they associate to form active SPT. Untagged and
HA-tagged Lcb1p or untagged and HA-tagged Lcb2p were coex-
pressed in cells, and the solubilized microsomal proteins were
subjected to Western blot analysis using anti-Lcb1p or anti-
Lcb2p polyclonal antibodies. The untagged and HA-tagged Lcb1p
and Lcb2p proteins could be distinguished by their electro-
phoretic mobilities (Fig. 5, lanes 4 and 6).
To address whether Lcb1p (and/or Lcb2p) could homodimer-
ize, we investigated whether immunoprecipitation with an-
ti-HA antibodies would pull down only the tagged protein or
both the tagged and untagged protein. Using the solubilized
microsomes from the strain coexpressing HA-tagged and un-
tagged Lcb1p, the anti-HA antibodies precipitated a complex
containing the HA-Lcb1p and Lcb2p, but no untagged Lcb1p
(Fig. 5, lane 1). This demonstrated that Lcb1p does not
homodimerize, because none of the anti-HA-precipitated
Lcb1p?Lcb2p complexes contained untagged Lcb1p. Using the
same strategy with solubilized microsomes prepared from the
strain coexpressing both untagged and HA-tagged Lcb2p (Fig.
5, lane 6), we also found that untagged Lcb2p does not coim-
munoprecipitate with HA-tagged Lcb2p (Fig. 5, lane 3). There-
fore, unlike the other ?-oxoamine synthases, yeast SPT is a
Lcb1p?Lcb2p heterodimer.
These immunoprecipitation data are consistent with the re-
sults of molecular exclusion sizing chromatography experi-
ments (see “Experimental Procedures”). Lcb1p and Lcb2p coe-
luted with an estimated molecular mass of 110 kDa (data not
shown), in reasonable agreement with the predicted het-
erodimeric molecular mass of 124 kDa.
The HSN1 Lcb1p Mutant Proteins Are Stable and Het-
erodimerize with Lcb2p—We found that the HSN1 mutant
Lcb1p proteins were stable (Fig. 6A, lanes 3–5). Furthermore,
although Lcb2p is unstable in the absence of Lcb1p (20) (Fig.
6A, lane 1), Lcb2p is present in each of the mutants indicating
that the mutant Lcb1p proteins form stable heterodimers with
Lcb2p. This was confirmed by showing that the mutant Lcb1p
proteins coimmunoprecipitate with Lcb2p (data not shown).
Mutations in the Predicted PLP-binding Residues of Lcb2p
Also Dominantly Inactivate SPT—On the basis of the crystal
structure of AONS and the alignment between AONS and
Lcb1p, the residue in AONS Gly-74 that is analogous to Cys-
180 of yeast (Cys-133 of human) Lcb1p resides at the interface
between the subunits of the AONS homodimer. It is in close
proximity to residues in the opposite subunit that are involved
in catalysis, including the lysine residue of AONS that forms
the Schiff’s base with PLP (Fig. 2B). This suggested that the
mutations in Lcb1p might be affecting PLP binding. Indeed,
Alexeev and coworkers (17) noted that mutations in this region
of AONS might alter the dimer structure and affect the geom-
etry of the PLP binding site at the interface between the mono-
mers to produce a loss of enzymatic activity. The AONS-V85
(Lcb1p-V191) residue is further from the interface, but muta-
tions at this site may also alter the geometry of the PLP
binding site by a long-range perturbation.
By analogy to AONS, two residues in Lcb2p (Lys-366 and
His-334) that are predicted to participate in PLP binding are
expected to lie across the subunit interface from Cys-180 of
Lcb1p. This is shown in a model of the central catalytic domain
of the Lcb1p?Lcb2p heterodimer that was generated using the
crystal coordinates of the highly homologous AONS enzyme
(Fig. 2C). The Lys-366 residue of Lcb2p (predicted to form the
Schiff’s base with PLP) was replaced with threonine and His-
FIG. 1. The sphingolipid synthesis pathway in yeast. Serine
palmitoyltransferase (SPT) catalyzes the decarboxylative condensation
of serine with palmitoyl CoA to form 3-KS in the first step of the
long-chain-base synthesis pathway. 3-KS is reduced to DHS by Tsc10p
(22) and DHS is hydroxylated to PHS by Sur2p (28,29). Addition of
3-KS, DHS, or PHS to the growth medium rescues the lethality of lcb1?
or lcb2? mutant cells. PHS (or DHS) is N-acylated to form ceramide.
Ceramide is inositol phosphorylated by Aur1p (30) to form IPC, and IPC
is mannosylated in a step requiring Csg1p and Csg2p to form MIPC
(12,31). The csg2? mutant cells do not convert IPC to MIPC and,
therefore, IPC levels increase, which leads to Ca2?sensitivity. Muta-
tions that reduce the accumulation of IPC in the csg2? mutant cells
suppress Ca2?sensitivity (21). A second inositol phosphorylation step
converts MIPC to M(IP)2C (32).
Dominant Negative Mutations in the Lcb1p and Lcb2p Subunits of SPT
10196