Ku86 is essential in human somatic cells.

Abstract

Ku86 plays a key role in nonhomologous end joining in mammals. Functional inactivation in rodents of either Ku86 or Ku70, which form the heterodimeric DNA end-binding subunit of the DNA-dependent protein kinase complex, is nevertheless compatible with viability. In contrast, no human patient has been described with mutations in either Ku86 or Ku70. This has led to the hypotheses that either these genes are performing an additional essential role(s) and/or redundant pathways exist that mask the phenotypic expression of these genes when they are mutated in humans. To address this issue, we describe here the construction of human somatic cell lines containing a targeted disruption of the Ku86 locus. Human HCT116 colon cancer cells heterozygous for Ku86 were haploinsufficient with an increase in polyploid cells, a reduction in cell proliferation, elevated p53 levels, and a slight hypersensitivity to ionizing radiation. Functional inactivation of the second Ku86 allele resulted in cells with a drastically reduced doubling time. These cells were capable of undergoing only a limited number of cell divisions, after which they underwent apoptosis. These experiments demonstrate that the Ku86 locus is essential in human somatic tissue culture cells.

Full text

Page 1

Ku86 is essential in human somatic cells
Gang Li*†, Caron Nelsen*‡, and Eric A. Hendrickson†§
*Department of Molecular Biology, Cellular Biology, and Biochemistry, Brown University, Providence, RI 02912; and†Department of Biochemistry,
Molecular Biology, and Biophysics, University of Minnesota Medical School, Minneapolis, MN 55455
Communicated by Arthur Landy, Brown University, Providence, RI, December 5, 2001 (received for review October 5, 2001)
Ku86 plays a key role in nonhomologous end joining in mammals.
Functional inactivation in rodents of either Ku86 or Ku70, which
form the heterodimeric DNA end-binding subunit of the DNA-
dependent protein kinase complex, is nevertheless compatible
with viability. In contrast, no human patient has been described
with mutations in either Ku86 or Ku70. This has led to the
hypotheses that either these genes are performing an additional
essential role(s) and?or redundant pathways exist that mask the
phenotypic expression of these genes when they are mutated in
humans.Toaddressthisissue,wedescribeheretheconstructionof
human somatic cell lines containing a targeted disruption of the
Ku86 locus. Human HCT116 colon cancer cells heterozygous for
Ku86 were haploinsufficient with an increase in polyploid cells, a
reduction in cell proliferation, elevated p53 levels, and a slight
hypersensitivity to ionizing radiation. Functional inactivation of
the second Ku86 allele resulted in cells with a drastically reduced
doubling time. These cells were capable of undergoing only a
limited number of cell divisions, after which they underwent
apoptosis. These experiments demonstrate that the Ku86 locus is
essential in human somatic tissue culture cells.
T
can cause chromosomal instability, DNA double-strand breaks
(DSBs) seem to be the most insidious. Improper repair of DSBs
results in chromosomal translocations, inversions, and fusions;
this, in turn, invariably results in cancer or cell death (1). DSBs
can arise through exposure to chemotherapeutic agents or
ionizing radiation (IR), occur spontaneously during DNA rep-
lication, and are formed transiently in meiosis and during V(D)J
recombination in the immune system (1). Cells have evolved at
least two independent pathways for repairing DSBs, homologous
recombination and nonhomologous DNA end joining (NHEJ;
refs. 1 and 2). Homologous recombination ensures accurate
repair by using an undamaged sister chromatid or homologous
chromosome as a template. NHEJ, on the other hand, uses no,
or limited, sequence homology to rejoin ends in a manner that
is often error prone. In mammalian cells, NHEJ is the preferred
mechanism of DSB repair (2). Some of the gene products
involved in this pathway include Ku70, Ku86, the DNA-
dependent protein kinase catalytic subunit (DNA–PKcs),
XRCC4, and DNA ligase IV (2).
KuisaheterodimericDNAend-bindingcomplexcomposedof
70- and 86-kDa subunits (Ku70 and Ku86, respectively; ref. 3).
Ku binds in a sequence nonspecific fashion to virtually all
double-stranded DNA ends including 5? and 3? overhangs, blunt
ends, and duplex DNA ending in stem-loop structures (3). One
unequivocal role for Ku is as a DNA-binding subunit of the
DNA-dependent protein kinase (DNA–PK) complex, which is
composed of the Ku heterodimer and DNA–PKcs(3). Extensive
genetic and molecular studies have identified the DNA–PK
complex as an integral component of mammalian DNA NHEJ
DSB repair (3). Ku is believed to bind to broken DNA ends to
prevent unnecessary DNA degradation (4) and juxtapose DNA
ends(5–7).ThebindingofKutofreeDNAendsalsorecruitsand
activates DNA–PKcs(8), DNA ligase IV (9, 10), and XRCC4, a
DNA ligase IV accessory factor (11, 12), which are required for
the rejoining of DNA DSBs (13–16).
he maintenance of chromosomal integrity is essential for
cellular survival (1). Among the many forms of damage that
Murine knockouts for each of the components of the
DNA–PK and XRCC4?ligase IV complexes have been gener-
ated. Mice deficient for XRCC4 (12) and DNA ligase IV (17, 18)
are not viable because of neuronal degeneration caused by
p53-induced apoptosis (19, 20). Mice deficient for Ku70 (21, 22),
Ku86 (23, 24), or DNA–PKcs(25–28) are viable and exhibit the
expected immune deficiency and IR hypersensitivity. In addi-
tion, inactivation of the Ku86 gene results in cells with growth
retardation (23), premature senescence (29), a marked increase
in chromosomal aberrations (30–32), and elevated telomeric
fusions (33–35).
WhereasDNAligaseIVisanessentialgeneinrodents,human
somatic cells lacking DNA ligase IV are viable (15), and
mutations in DNA ligase IV have been described in patients with
clinical radiosensitivity and abnormal V(D)J recombination (36,
37). Moreover, functional inactivation in rodents of all three
components of the DNA–PK complex has been achieved, yet no
human patient has been described with a mutation in any of the
subunits. These observations imply that there may be important
differences in NHEJ between rodents and humans, and they
further suggest that the genes making up the DNA–PK complex
may be essential in humans.
To clarify the role of Ku86 in human cells, we have used gene
targeting in human somatic tissue culture cells to functionally
inactivate the Ku86 locus. Human Ku86 heterozygous cell lines
displayed significant haploinsufficient phenotypes; they were
defective in cell proliferation and DNA–PK and DNA end-
binding activities, and they showed elevated levels of p53,
polyploidy, and IR sensitivity. A second round of gene targeting
generated homozygously null Ku86 cell lines. These cell lines
showed a severe growth defect and ultimately underwent apo-
ptosis after a limited number of cell doublings. These experi-
ments demonstrate that the Ku86 locus is essential in human
somatic cells.
Materials and Methods
Cell Culture. Ku86 knockout cell lines were obtained from
HCT116 cells after electroporation of the targeting vector
followed by selection in 500 ?g?ml G418. The modified het-
erozygous Ku86 knockout cell line 70–32, which was altered by
Cre recombination, was obtained following negative selection
with 10 ?M gancyclovir.
Targeting Vector Construction. The Ku86 gene-targeting vector
was constructed in pUC19 by using a 2-kb genomic fragment just
distal to exon 1 as the 5? arm and cloned after adding PacI and
NotI restriction sites to the 5? and 3? ends, respectively. An 8.5-kb
genomic fragment containing part of intron 1, exon 2, and part
of intron 2 was used as the 3? arm and cloned in two steps that
resulted in the addition of NotI and SalI restriction sites to the
Abbreviations: NHEJ, nonhomologous DNA end joining; PK, protein kinase; DSB, double-
strand break; IR, ionizing radiation; DT, diphtheria toxin; DEB, DNA end-binding.
‡Present address: Columbia University, School of Medicine, New York, NY 10027.
§To whom reprint requests should be addressed. E-mail: hendr064@tc.umn.edu.
The publication costs of this article were defrayed in part by page charge payment. This
article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C.
§1734 solely to indicate this fact.
832–837 ?
PNAS ?
January 22, 2002 ?
vol. 99 ?
no. 2www.pnas.org?cgi?doi?10.1073?pnas.022649699

Page 2

5?and3?ends,respectively,andwhichintroducedanovelEcoRV
site within intron I (see Fig. 1). The 3-kb neomycin selection
cassette was cloned as a NotI to NotI fragment. The cassette
contained a c-Myc splice acceptor, a LoxP site, a promoterless
neomycin-resistance gene, an internal ribosome entry site for
expression of the adjacent viral thymidine kinase gene, another
loxPsite,andthentheSV40polyadenylationsignal.Onthedistal
5? arm of the targeting vector, a diphtheria toxin (DT; pKOS-
electDT plasmid) gene driven by the RNA polymerase II pro-
moter was cloned into the PacI restriction site. Before transfec-
tion, the vector was linearized by SalI restriction enzyme
digestion.
Transfection. For each transfection, 25 ?g of SalI-linearized DNA
was mixed with 1 ? 107HCT116 cells in 500 ?l of PBS.
Transfection was carried out by electroporation at 240 V, 975 ?F
with 0.4-cm cuvettes.
Genomic Southern Hybridization. Chromosomal DNA was pre-
pared, digested, subjected to electrophoresis, and transferred to
nitrocellulose filters as described (38). The filters were then
hybridizedwiththeprobesshowninFig.1.Probeawasan802-bp
StuI–SspI restriction fragment, which resides 5? of the targeting
vector sequences. Probe b was a 436-bp EagI–PstI restriction
fragment, which is complementary to part of the 5? targeting
vector arm. Probe c was a 210-bp Bsu36I–SacI restriction
fragment corresponding to the promoter of the Ku86 gene.
Probe d was a 300-bp PCR fragment that resides 3? of the
targeting vector. This PCR fragment was amplified by using
primers CCTTTATTCTGGGAATCGTACAGC and TTC-
TATCCGCCTCCAAACATTTC.
Genomic PCR. Fifty nanograms of genomic DNA was amplified by
using 20 pmol of each relevant primer as follows: KO4, GC-
GAGTTGCGACACGGCAGGTTCC; KO2, CTCTTGC-
CCCATTCTTTGTCTTG; 86–5, CAGGTTCAGGGGAGGT-
GTGGGAG; KO3, TTTCTCATAGCGCATCCCTCGGTCC.
Preparation of Extracts.Cellsweretrypsinized,washedthreetimes
in PBS, and boiled in 10 mM Tris, pH 7.5?5 mM MgCl2with a
2? Complete protease inhibitor mixture for 10 min. The samples
were then digested with DNase I (0.1 unit??l) at 37°C for 10 min.
Samples obtained in this way were used as whole cell extract. For
cytoplasmic and nuclear extract preparation, cells were lysed by
vortexing in an equal volume of buffer A (39) supplemented with
0.1% Nonidet P-40 and 2? protease inhibitor mixture. After
incubation on ice for 10 min, the cell lysate was centrifuged at
14,000 rpm for 10 min at 4°C. The supernatant was used as
cytoplasmic extract. The pellet was further washed two times
with ice-cold buffer A, and nuclear extract was subsequently
prepared as described (39).
Immunoblotting. For immunoblot detection, proteins were sub-
jected to electrophoresis on a 7% SDS?PAGE, electroblotted
onto a nitrocellulose filter, and detected as described (39).
Assays. Ku DNA end-binding activity was measured by a gel
mobility shift assay as described (39). Cell proliferation, x-ray
survival assays, and DNA–PK kinase assays have also been
described (38, 39). For immunocytochemical assays, cells were
seeded in 96-well plates overnight. After rinsing with PBS, the
cells were fixed and permeabilized with 2% paraformaldehyde
and 0.2% Triton X-100 in PBS at 4°C for 10 min. The fixed cells
were rinsed three times with PBS and probed by using the
indicated primary antibody in PBS at 4°C for 30 min. After
rinsing and washing with PBS, the cells were stained with
secondary antibodies in PBS at 4°C for 30 min and visualized by
fluorescent microscopy.
Results
Generation of Heterozygous Ku86?/?HCT116 Cells. A targeting
vector was constructed that contained 2 kb of upstream flanking
genomic DNA corresponding to the promoter region of Ku86
(Fig. 1A). This was fused to the c-Myc splice acceptor, a loxP site
(loxP), a promoterless neomycin-resistance gene (Neo), an in-
ternal ribosome entry site, a viral thymidine kinase gene (TK),
another loxP site, the SV40 polyadenylation signal (pA), and
then another 8.5 kb of downstream flanking genomic DNA,
which included the first intron of Ku86 and terminated 3? of exon
2 (Fig. 1A). Correct targeting of the endogenous genomic locus
(Fig. 1B) should result in the deletion of exon 1 and the
generation of a G418-resistant cell line (Fig. 1C). A promoterless
neomycin-resistance targeting cassette was used because this
approach is the most efficacious in human cells (40, 41). There-
fore, this construct was introduced into HCT116 cells by elec-
troporation, and G418-resistant clones were selected. HCT116 is
an immortalized human colon cancer cell line that is diploid, has
a stable karyotype, contains wild-type p21 and p53 genes, and
responds normally to DNA-damaging agents with respect to the
induction of p53 and cell cycle arrest (40, 42, 43). As importantly,
the functional inactivation of p21, p53, 14–3-3?, Bax, DNMT1,
ORC2, and securin has demonstrated that gene targeting is
experimentally feasible in this cell line (40, 43–48). Cell lines
Fig. 1.
Cartoon of the targeting vector. Red rectangle designated DT, diphtheria
toxin gene; blue rectangle, c-Myc splice acceptor; green triangles, loxP sites;
open rectangle, neomycin resistance (Neo) and HSV thymidine kinase (TK)
genes; pink rectangle, polyadenylation signal (pA); yellow rectangle, Ku86
exon2;restrictionenzymesites:RI,EcoRI;Bs,Bsu36I;Hi,HindIII;Ba,BamHI;Ev,
EcoRV. (B) Ku86 genomic locus; a and d are external probes, and b and c are
internalprobesusedfortheheterozygousknockoutscreen.(C)Targetedlocus
and(D)targetedlocusfollowingCre-mediatedloxPrecombination.(E)South-
ern blot analysis of wild-type and Ku86 heterozygous (???) cells. Genomic
DNA samples were doubly digested with HindIII and EcoRV and hybridized
withtheindicatedprobes.(F)Cre-mediatedloxPrecombination.DNAsamples
were doubly digested with BamHI and Bsu36I and hybridized with probe c.
Scheme for functional inactivation of the human Ku86 locus. (A)
Li et al.
PNAS ?
January 22, 2002 ?
vol. 99 ?
no. 2 ?
833
GENETICS

Page 3

containing correctly targeted integration events were scored by
genomic Southern blot analysis by using HindIII and EcoRV and
probe a (Fig. 1B). Over 500 independent colonies were analyzed
in this fashion, and no correctly targeted colonies were obtained
(data not shown). Thus, the targeting vector was redesigned to
contain the DT gene driven by a strong promoter on the distal
5? arm of the targeting construct (Fig. 1A). Random integration
of this construct should result in the death of the cell, as
expression of DT in mammalian cells is lethal. The targeting
protocol was repeated, and the overall frequency of G418-
resistant clones was reduced ?20-fold, suggesting that the DT
selection was working. A total of 354 new G418-resistant colo-
nies were screened, and two independent Ku86?/?heterozygous
clones (nos. 44 and 70) were obtained. Correct targeting of the
Ku86 locus in one of the clones, no. 70, was confirmed by
Southern blot analysis by using 5? external (Fig. 1E, probe a),
internal (Fig. 1E, probe b), and 3? external (Fig. 1E, probe d)
probes. In each case, the appearance of a novel restriction
enzyme digestion fragment, caused by the HindIII and EcoRV
sites introduced on the targeting vector, permitted the unequiv-
ocal confirmation of a single, correctly targeted integration
event (Fig. 1E). Clone 70 cells were expanded and transiently
transfected with the expression vector, pGK-Cre. Cre mediates
site-specific recombination between the loxP sites (49) and
results in the excision of the bulk of the targeting construct,
leaving behind a single loxP site and the pA element in the locus
(Fig. 1D). Cells in which the excision event had occurred could
be selected with gangcyclovir because of the loss of the TK gene.
Gangcyclovir-resistant cell lines containing the correctly excised
locus were identified by Southern blot analysis by using BamHI
and Bsu36I digestions and hybridization with probe c (Fig. 1F).
Wild-type HCT116 cells displayed only the endogenous 0.39-kb
Bsu36I to Bsu36I fragment (Fig. 1F, lane 1). Clone 70 contained
theendogenous0.39-kbfragmentaswellasanovel3.2-kbBsu36I
to BamHI fragment, corresponding to the loss of the Bsu36I site
within exon 1 and the introduction of a BamHI site on the
targeting vector (Fig. 1F, lane 2). Four of 24 Cre-treated clones
analyzed, including clone 70–32, no longer contained the 3.2-kb
band but now contained a 0.62-kb Bsu36I to BamHI fragment,
which corresponded precisely to the loss of the Neo-TK coding
sequences (Fig. 1F, lane 3).
Haploinsufficiency of Ku86?/?HCT116 Cells. Morphologically,
Ku86?/?cells seemed indistinguishable from wild-type HCT116
cells with the exception that ?2% of the population contained
giant, multinucleated, and?or polyploid cells (Fig. 2). Immuno-
blot analysis of Ku86?/?cells demonstrated that they only
contained 20–50% as much Ku86 and Ku70 protein as the
parental cells (Fig. 3A). The reduction in Ku70 levels was
expectedbecauseitwasknownthatintheabsenceofonesubunit
the other Ku subunit is unstable (3). In contrast, all of the
heterozygous cell lines contained elevated (3-fold) levels of p53
(Fig. 3A). Consistent with the reduction in Ku subunits, the
Ku86?/?cellscontainedonly50%asmuchKuDNAend-binding
(DEB) activity as the parental cells (Fig. 3B). Nuclear extract
derived from wild-type cells was capable of binding and shifting
all of the added 55-bp dsDNA probe, and a significant fraction
of the probe had two Ku heterodimers bound to it (Fig. 3B, lane
2). In contrast, nuclear extract derived from the Ku86?/?cells
could only shift ?50% of the probe, and almost no multimer Ku
forms were detectable (Fig. 3B, lanes 3–5). Consistent with the
known dependence of DNA–PK activity on Ku DEB (5, 6), a
50% reduction in DNA–PK activity was also observed (Fig. 3C).
This reduction in Ku levels and DEB and DNA–PK activities
translated itself into a growth defect (Fig. 3D). The doubling
time for the parental HCT116 cells was 17.7 h (?0.3), whereas
Ku86?/?clones uniformly doubled once only every 20.5 h
(?0.4). FACS analysis of the cell lines did not reveal any salient
differences in the cell-cycle distribution of asynchronous cells
(data not shown). Ku86?/?HCT116 cells were also slightly IRs
with a surviving fraction at 5 Gy of only 0.25 compared with 0.42
for the wild-type cells (Fig. 3E). FACS analysis of X-irradiated
cells uncovered no salient differences in the G1and G2cell-cycle
arrests between wild-type and Ku86 heterozygous cells (data not
shown). Thus, unlike Ku86?/?rodent cell lines, which are
phenotypically indistinguishable from their parental cell lines
(23, 24), human Ku86?/?cells were haploinsufficient and
showed cell proliferation and DNA damage sensitivity defects.
Construction of Ku86-Null HCT116 Cells.TheCre-recombined70–32
clone was subjected to a second round of gene targeting by using
the same targeting vector and selection strategies used to
construct the heterozygous cell lines (Fig. 4A). A total of 487
colonies were screened, and 3 colonies, in which re-targeting of
the already targeted allele had occurred, were obtained, but no
homozygously targeted clones were recovered (data not shown).
A small number of very slow-growing (doubling time ?40 h)
colonies were, however, observed. Some of these slow-growing
clones grew to 200–1,000 cells (?8–10 population doublings
starting from a single cell) but then underwent massive apopto-
sis. To investigate whether any of these colonies corresponded to
Ku86?/?cells, 46 slow-growing colonies were scraped off the
dish at the ?150–200 cell stage, and genomic DNA was isolated
and then subjected to a diagnostic PCR analysis (Fig. 4A). As
controls, faster growing colonies from the same plate were also
isolated. Whereas all of the faster growing colonies produced the
endogenous 180-bp and targeted 330-bp PCR products (Fig. 4B,
??? colony DNA), two of the slowest growing colonies only
Fig. 2.
Ku86 heterozygous (Ku86?/?), or Ku86 null (Ku86?/?) cells were prepared for
phase contrast (PC) or fluorescent images following 4?,6-diamidino-2-
phenylindole (DAPI) staining. Ku86?/?cells were indistinguishable from wild-
type cells with the exception of the presence of polyploid cells (arrowheads).
Ku86?/?cells appeared apoptotic under phase contrast, and this was con-
firmed by the DNA condensation observed in the DAPI-stained samples.
Morphological alterations in Ku86-deficient cells. Wild-type (wt),
834 ?
www.pnas.org?cgi?doi?10.1073?pnas.022649699Li et al.

Page 4

generated the targeted 330-bp PCR product (Fig. 4B, ???
colony). Morphologically, these two colonies were more elon-
gated and apoptotic than the parental cells (Fig. 2). Staining of
these colonies with 4?,6-diamidino-2-phenylindole revealed that
the cells had highly condensed DNA and exhibited chromosomal
fragmentation, both characteristics of apoptotic cells (Fig. 2).
Indeed, the effect was actually more pronounced than that
shown as many apoptotic cells were washed off during the fixing
and staining processes. To confirm that these two colonies were
null for Ku86, they were immunohistochemically stained for
Ku86, DNA–PKcs, or ?-actin. Whereas wild-type and heterozy-
gous (???) cells stained with all three antibodies, the two
slow-growing colonies tested (???) were totally devoid of Ku86
staining and showed reduced (?10-fold), albeit detectable,
levels of DNA–PKcs (Fig. 5). In contrast, all of the other 44
slow-growing clones analyzed stained positive for Ku86 protein,
gave a positive endogenous 180-bp signal with PCR, and did not
haveapoptoticnuclei(datanotshown).Fromtheseexperiments,
Fig. 3.
diminished levels of Ku. Whole cell extract was prepared from wild-type
HCT116cells(???),fromthetwoindependentKu86?/?clones(nos.44and70;
???), and from the Cre-recombined Ku86?/?clone (no. 70–32; ??? Cre) and
analyzed by immunoblotting for Ku86, Ku70, p53, and ?-catenin protein
levels. A single blot is shown that was probed sequentially with four different
antibodies.(B)Ku86?/?cellshavediminishedlevelsofKuDEB.Nuclearextract
was prepared from the indicated cell lines and incubated with a radiolabeled
55-bp dsDNA probe. DEB activity was then assessed by an electrophoretic
mobility shift assay. The positions of the free probe and the probes with one
(Ku-1)ortwo(Ku-2)Kuheterodimersboundareshown.(C)Ku86?/?cellshave
diminished levels of DNA–PK activity. Nuclear extracts prepared from the
indicated cell lines were incubated with [?-32P]rATP and a DNA–PK-specific
substrateinthepresenceandabsenceofdsDNA.DNA–PKactivityinwild-type
cells was normalized to 100%. The average of two experiments, each per-
formedinduplicate,isshown.(D)Ku86?/?cellshaveproliferationdefects;2?
104cellsoftheindicatedcelllines(wt,wild-type;44and70,Ku86???;70–32,
???Cre)wereseededontissuecultureplates,andtheincreaseincellnumber
on subsequent days was determined by cell counting by using trypan blue
staining and a hematocytometer. The average of two experiments, each
performed in triplicate, is shown. The error bars are too small to be seen. (E)
Ku86?/?cells are IRs; 300 cells of the indicated cell lines were seeded on tissue
culture plates and X-irradiated at the indicated doses. Cells surviving to form
colonies (?50 cells?colony) 10 (wild type) or 14 (70, 44, and 70?32) days later
were scored. The average of two experiments each performed in triplicate is
shown on a semi-log scale.
Haploinsufficiency of Ku86 heterozygous cells. (A) Ku86?/?cells have Fig. 4.
cartoon of the primers used and the expected sizes of the PCR products. (B)
Ethidiumbromide-stainedagarosegeloftheresultantPCRproducts.Genomic
DNA was isolated from wild-type (???), heterozygous (???), Cre-treated
heterozygous (??? Cre), a random colony following the second round of
targeting (??? colony DNA), and a slow-growing colony on the same plate
(??? colony DNA). M, DNA marker.
Identification of Ku86 null cell lines by using genomic PCR. (A) A
Fig. 5.
type (wt), Ku86 heterozygous (???), and Ku86 null (???) cells were stained
with antibodies to Ku86, DNA–PKcs, or actin. The cells were then counter-
stained with Cy3 secondary antibodies. Cells stained only with the secondary
antibody exhibited no fluorescence (data not shown). The relevant phase
contrast (PC) images are shown to the left of the stained images.
Immunohistochemical analysis of Ku86 null cells. Colonies of wild-
Li et al.
PNAS ?
January 22, 2002 ?
vol. 99 ?
no. 2 ?
835
GENETICS

Page 5

we concluded that the human Ku86 locus was essential. Ku86-
null somatic HCT116 cells were capable of completing a limited
number of cell doublings before they succumbed to apoptosis.
Discussion
Inthemouse,inactivationofonealleleofKu86resultsinanimals
that are phenotypically indistinguishable from wild-type ani-
mals, whereas inactivation of the second allele results in viable
animals with cell proliferation defects and genomic instability
phenotypes (23, 24, 29–33, 35). Here, we have demonstrated that
inactivation of one Ku86 allele in human somatic HCT116 cells
results in polyploidy (Fig. 2) and cell proliferation (Fig. 3D) and
IR hypersensitivity (Fig. 3E) defects, whereas inactivation of the
second allele results in cells that are extremely compromised in
cell proliferation and that are ultimately nonviable because they
undergo apoptosis (Figs. 4 and 5). These experiments are
consistent with the demonstration that the expression of Ku86
antisense RNA in human cells leads to cellular defects in DNA
DSB repair and cell proliferation (50, 51). Thus, our data suggest
that species differences exist in the requirement for Ku86 and
that Ku86 performs an essential function in human cells.
Human Ku86-deficient cells presumably die because they have
accumulated an excess of DNA damage. First, levels of p53 are
elevated 3-fold in heterozygous cells (Fig. 3A). p53 is the key
downstream transcription factor in the signal transduction path-
way for DNA damage in mammalian cells (52). Its elevation in
Ku86?/?cells is consistent with these cells experiencing a higher
level of spontaneous endogenous damage. Second, giant,
polyploid, and multinucleated cells comprise 2–3% of the het-
erozygous cell population, whereas these cells are seen only
rarely in the wild-type cell line (Fig. 2). The appearance of giant
cells is often seen following X-irradiation of cells that incom-
pletely repair the DNA damage. Polyploid and multinucleated
cells are also associated with genomic instability as a result of
defects in DNA repair (1). Third, Ku86?/?cells are slightly IRs
(Fig. 3E), consistent with them containing reduced levels of
DNA DSB repair activity. Together, these observations suggest
that Ku86?/?cells have elevated levels of spontaneous endog-
enous damage. Thus, it is likely that Ku86?/?cells accumulate
even more DNA damage, which is ultimately incompatible with
survival. Importantly, however, Ku86?/?cells do not die imme-
diately but succumb only after going 8–10 cell doublings. There
are at least two explanations for this observation. First, other
DNA DSB repair pathways, notably homologous recombination
(1, 2), are operational in mammalian cells, and these may
temporarily compensate for the loss of Ku86-dependent NHEJ.
Because NHEJ is, however, the predominate pathway of DNA
DSB in mammals, the homologous recombinational machinery
is likely incapable of sustaining cellular viability when it is the
primary defense against DNA damage. Alternatively, Ku86 is an
abundantproteinpresentatabout4?105copiespercell(3),and
when complexed to Ku70, it is very stable with a half-life of more
than 16 h (53). Thus, even starting from a heterozygous cell
where the levels of Ku86 are reduced by at least half that
observed in wild-type cells (Fig. 3A), it may take multiple rounds
of cell division following the second allele targeting before the
levels of Ku in a Ku86?/?cell are reduced below some minimum
threshold.
Alternatively, Ku may play a role in telomere homeostasis (3).
In yeast, deletion of Ku results in telomere shortening, loss of
telomere clustering, and deregulation of the single-strand over-
hang (54). In human cells, Ku is found physically associated with
telomeres (55, 56), and Ku86-deficient mice have shorter telo-
meres (32) and show elevated telomeric fusions (33, 35). More-
over, with a strikingly similar phenotype to human Ku86?/?cells,
the expression of a dominant defective telomerase in human
cancer cells resulted in limited rounds of cell division followed
by massive apoptosis (57). Thus, the dysregulation of telomere
maintenance or function may be part, or all, of the explanation
for the essential role of Ku86 in human cells.
A third possibility is that it is not the loss of Ku86 per se that
is essential, but the loss of DNA–PK activity. Thus, heterozygous
cells show a ?50% reduction in DNA–PK activity (Fig. 3C), and
the Ku86-null cells showed a strong reduction in the amount of
DNA–PKcsprotein detectable by immunohistochemical staining
(Fig. 5). The reduction in DNA–PKcs protein was surprising,
because although Ku mutations in rodents have been reported
to reduce the level of DNA–PKcs activity, there has been no
report that DNA–PKcs protein levels were also adversely af-
fected (21–24). It should be noted, however, that DNA–PKcs,
unlike Ku86, is a substrate for caspases in cells undergoing
apoptosis (58), and thus it is likely that the low levels of
DNA–PKcsmay simply have resulted from the advanced apo-
ptotic state of these cells (Figs. 2 and 5). Lastly, a viable human
malignant glioma cell line, M059J, has been described (59) that
is null or greatly reduced for DNA–PK activity, also suggesting
that DNA–PK activity is not essential.
MurinecellsdeficientinKu86areviable(23,24),whereashuman
cells are not (Fig. 5). One explanation for these results is the
existence of a redundant pathway in mice that does not exist in
humans. While the specifics of DNA DSB repair still need to be
elucidated, there is evidence that in addition to the DNA–PK-
dependent pathway for NHEJ, there exists a non-DNA–PK-
dependent NHEJ pathway(s) (1). In mice, this alternative path-
way(s) may facilitate cell survival in the absence of Ku86. In
humans, if this other pathway(s) is reduced or absent, cells may
totally depend on Ku86 for this type of repair. Second, as men-
tioned above, Ku86 plays a role in telomere function and mainte-
nance. Because telomeres are significantly longer in mice as com-
pared with humans (60), this physical attribute could explain why
the absence of Ku86 is tolerated better in murine cells. Third, it is
possible that Ku86 has evolved a novel function in human cells. It
is important to note that we have described a transcript, termed
KARP-1, which (through the use of an upstream promoter and
exons) encodes a 9-kDa longer isoform of Ku86 that is only
observedinprimatecellsandnotinmurinecells(61).Ourtargeting
strategy (Fig. 1) removed the first exon of Ku86, which is an exon
that is common to both Ku86 and KARP-1 (61). Thus, Ku86?/?
cells are actually deficient in both Ku86 and KARP-1, and it is
possible that it is KARP-1 which is essential.
We thank Dr. J. Sedivy (Brown University) for the gene-targeting
construct and for advice on gene targeting early in the conception of this
project. We thank Dr. K. Myung (University of California, San Diego)
forhiseffortsinhelpingtoassembletheKu86targetingvector.Wethank
Dr. A. Bielinsky (University of Minnesota) for her helpful comments on
the manuscript. This work was supported in part by National Institutes
of Health Grant AI35763.
1. Hoeijmakers, J. H. (2001) Nature (London) 411, 366–374.
2. Barnes, D. E. (2001) Curr. Biol. 11, R455–R457.
3. Tuteja, R. & Tuteja, N. (2000) Crit. Rev. Biochem. Mol. Biol. 35, 1–33.
4. Liang, F. & Jasin, M. (1996) J. Biol. Chem. 271, 14405–14411.
5. Bliss, T. M. & Lane, D. P. (1997) J. Biol. Chem. 272, 5765–5773.
6. Pang, D., Yoo, S., Dynan, W. S., Jung, M. & Dritschilo, A. (1997) Cancer Res.
57, 1412–1415.
7. Walker, J. R., Corpina, R. A. & Goldberg, J. (2001) Nature (London) 412,
607–614.
8. Gottlieb, T. M. & Jackson, S. P. (1993) Cell 72, 131–142.
9. McElhinny, S. A. N., Snowden, C. M., McCarville, J. & Ramsden, D. A. (2000)
Mol. Cell. Biol. 20, 2996–3003.
10. Teo, S. H. & Jackson, S. P. (2000) Curr. Biol. 10, 165–168.
11. Li, Z., Otevrei, T., Gao, Y., Cheng, H.-L., Seed, B., Stamato, T. D., Taccioli,
G. E. & Alt, F. W. (1995) Cell 83, 1079–1089.
12. Gao, Y., Frank, K. M., Dikkes, P., Fujiwara, Y., Seidl, K. J., Sekiguchi, J. M.,
Rathbun, G. A., Swat, W., Wang, J., Bronson, R., et al. (1998) Cell 95, 891–902.
13. Critchlow, S. E., Bowater, R. P. & Jackson, S. P. (1997) Curr. Biol. 7, 588–598.
836 ?
www.pnas.org?cgi?doi?10.1073?pnas.022649699Li et al.