Association between functional polymorphism in EGF 61 G/A gene and malignant melanoma

Immunology Research Group, School of Biological Sciences, Stopford Building, University of Manchester, Manchester M13 9PT, UK.
The Lancet (Impact Factor: 45.22). 03/2002; 359(9304):397-401. DOI: 10.1016/S0140-6736(02)07600-6
Source: PubMed


Malignant melanoma, the most serious cutaneous malignancy, has attracted substantial attention because of its rapidly increasing incidence and the poor prognosis of some tumours. Little is known of the genetic factors that mediate susceptibility to, and outcome of, sporadic malignant melanoma. Because of its role in mitogenesis, which is especially relevant to wound healing, tumorigenesis, and proliferation of epidermal tissues, epidermal growth factor (EGF) is an attractive candidate in which to look for genetic polymorphisms.
We enrolled 135 white European patients with malignant melanoma and 99 healthy white European controls, and screened a selection of DNA samples for polymorphisms in the promoter and 5' untranslated region of the EGF gene by analysis. We then screened DNA samples from all participants for the identified polymorphism by restriction-fragment-length polymorphism (RFLP) analysis. In-vitro EGF production was measured in peripheral-blood mononuclear cells from 34 controls, and the results were compared with the individuals' EGF genotypes.
We identified a single nucleotide substitution (G to A) at position 61 of the EGF gene. Allele frequencies in the controls were 56% EGF 61*A and 44% EGF 61*G. Cells from individuals homozygous for the 61*A allele produced significantly less EGF than cells from 61*G homozygotes (p=0.0004) or heterozygous A/G individuals (p=0.001). Compared with the A/A genotype, G/G was significantly associated with Breslow thickness (p=0.045) and with risk of malignant melanoma (odds ratio 4.9 [95% CI 2.3-10.2], p<0.0001).
This study suggests that high EGF production might be important in the development of malignant melanoma.

1 Follower
16 Reads
  • Source
    • "A previous analysis from northern England has shown that a marked rise in incidence was confined to females (Magnanti et al., 2008). It is well known that both genetic susceptibility and exposure to UVR are key factors in etiology (Cockburn et al., 2001; Wachsmuth et al., 2001; Shahbazi et al., 2002; El Ghissassi et al., 2009). The finding of a seasonal association between time of birth and risk of subsequently developing melanoma suggests that early life exposures may be implicated (Basta et al., 2011). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Previous studies have found marked increases in melanoma incidence. The increase amongst young people in northern England was especially apparent amongst females. However, overall five-year survival has greatly improved. The present study aimed to determine if socio-economic factors may be involved in both etiology and survival. All 224 cases of malignant melanoma diagnosed in patients aged 10-24 years during 1968-2003 were extracted from a specialist population-based regional registry. Negative binomial regression was used to examine the relationship between incidence and area-based measures of socio-economic deprivation and small-area population density. Cox regression was used to analyse the relationship between survival and deprivation and population density. There was significantly decreased risk associated with living in areas of higher unemployment (relative risk per 1% increase in unemployment=0.93; 95% confidence interval [CI] 0.90-0.96, P<0.001). Survival was better in less deprived areas (hazard ratio [HR] per tertile of household overcrowding=1.52; 95% CI 1.05 to 2.20; P=0.026) but this effect was reduced in the period 1986-2003 (HR=0.61; 95% CI 0.40 to 0.92; P=0.018). This study found that increased risk of melanoma was linked with some aspect of greater affluence. In contrast, worse survival was associated with living in a more deprived area.Journal of Investigative Dermatology accepted article preview online, 13 June 2014; doi:10.1038/jid.2014.246.
    Journal of Investigative Dermatology 06/2014; 134(11). DOI:10.1038/jid.2014.246 · 7.22 Impact Factor
  • Source
    • "Single nucleotide polymorphisms (SNPs) are the most common cause of human genetic alternation and may contribute in susceptibility and intensity of disease(13). Relation between EGF rs4444903 polymorphism located in 5′UTR and several cancer was investigated including, colorectal cancer (14), prostate cancer (15), melanoma (16), ovarian cancer (17) and breast cancer (18). According to our knowledge several single nucleotide polymorphisms have been identified in EGF gene region but a few study reported of EGF gene exonic polymorphisms and coloration between type of cancer (19, 20). "
    [Show abstract] [Hide abstract]
    ABSTRACT: This study aimed to determinant association between rs76189946 polymorphism of EGF gene and risk of colorectal cancer in an Iranian population. Colorectal cancer (CRC) is the third most prevalent cancer in both genders worldwide. The determination of genetic variation becomes a new way to etiology of colorectal cancer. Epidermal growth factor (EGF) is a mitogen that plays an important role in cell growth and tumourigenesis, this protein acts by binding its receptor, EGFR. DNA samples taken from totally 125 CRC patients and healthy controls were amplified by polymerase chain reaction (PCR) for the rs76189946 polymorphism. Genotypes were analyzed using restriction fragment length polymorphism (RFLP). Finally to confirm the RFLP procedure, 20 of the PCR products were sequenced using the ABI PRISM 3130xl Genetic Analyzer and chain termination method (Applied Biosystems, Carlsbad, CA). Genotype distribution and allele frequency was similar in CRC patients and controls individuals. We expect observe C and G allele in both groups but only was found C allele. In this study for first time we identified genetic distribution of exonic rs76189946 polymorphism in EGF gene both CRC patients and healthy controls. These results suggest there wasn't association between EGF polymorphism rs76189946 and risk of colorectal cancer in an Iranian population.
    Gastroenterology and hepatology from bed to bench 03/2013; 6(Suppl 1):S32-8.
  • Source
    • "In order to evaluate DNA quality for polymorphism genotyping by PCR-RFLP DNA samples of each incubation time were assayed as previously described by Shahbazi18 (2002), for the polymorphism in the EGF (+61 A/G) gene. The PCR reaction was carried out in a 30 µL mixture containing 160 ng of genomic DNA, 1x Dream Taq Buffer (Fermentas, Maryland, NY, USA), 0.2 mM of dNTPs (Fermentas), 0.3 µM of each primer (Forward: 5' TGTCACTAAAGGAAAGGAGG3'; Reverse: 5' TTCACAGAGTTTAACAGCCC 3' - Invitrogen, Grand Island, NY, USA) and 1 U Dream Taq DNA Polymerase (Fermentas, Maryland, NY, USA). "
    [Show abstract] [Hide abstract]
    ABSTRACT: The aim of this study was to evaluate, by PCR-RFLP and real-time PCR, the yield and quality of genomic DNA collected from buccal cells by mouthwash after different storage times at room temperature. A group of volunteers was recruited to collect buccal cells using a mouthwash solution. The collected solution was divided into 3 tubes, one tube were used for immediate extraction and the remaining received ethanol and were kept at room temperature for 4 and 8 days followed by dna extraction. The concentration, purity and integrity of the dna were determined using spectrophotometry and electrophoresis. DNA quality differences among the three incubation times were also evaluated for genotyping EGF +61 a/g (rs 4444903) polymorphism by PCR-RFLP and for IRF6 polymorphism (rs 17015215) using real-time PCR. There was no significant difference of dna yield (p=0.75) and purity (p=0.86) among the three different incubation times. DNA obtained from different incubation times presented high-molecular weight. The PCR-RFLP and real time pcr reactions were successfully performed for all DNA samples, even those extracted after 8 days of incubation. All samples genotyped by real-time pcr presented c allele for irf6 gene polymorphism (homozygous: cc; heterozygous: Ct) and the C allele was used as a reference for Ct values. The samples presented the same genotype for the different times in both techniques. We demonstrated that the method described herein is simple and low cost, and that DNA can be extracted and pcr amplified after storage in mouthwash solution at room temperature.
    Journal of applied oral science: revista FOB 08/2012; 20(4):467-71. DOI:10.1590/S1678-77572012000400013 · 0.92 Impact Factor
Show more