Article

Sierra JM, Marco F, Ruiz J, Jimenez de Anta MT, Vila J. Correlation between the activity of different fluoroquinolones and the presence of mechanisms of quinolone resistance in epidemiologically related and unrelated strains of methicillin-susceptible and -resistant Staphylococcus aureus

Institut Clínic d'Infeccions i Immunologia, IDIBAPS, Departament de Microbiologia, Facultat de Medicina, Hospital Clínic, Barcelona, Spain.
Clinical Microbiology and Infection (Impact Factor: 5.2). 12/2002; 8(12):781-90. DOI: 10.1046/j.1469-0691.2002.00400.x
Source: PubMed

ABSTRACT To study the activity of five different fluoroquinolones against 22 epidemiologically related and unrelated strains of Staphylococcus aureus (13 methicillin-resistant (MRSA) strains and nine methicillin-susceptible (MSSA) strains) in which the mechanisms of quinolone resistance are also investigated.
The MICs of the different fluoroquinolones were determined by the microdilution method, in the presence and absence of reserpine. The quinolone resistance-determining regions of the gyrA, gyrB, grlA and grlB genes were amplified and sequenced to establish the presence of mutations. The molecular epidemiology of the 22 strains was performed by low-frequency restriction analysis of chromosomal DNA with SmaI.
MSSA strains showed lower homology than MRSA strains, in which only two clones were seen. Trovafloxacin showed the best activity against these clinical isolates of S. aureus, since strains carrying one amino acid change in both GyrA and GrlA subunits remained susceptible to this antimicrobial agent. Furthermore, trovafloxacin did not seem to be a substrate for NorA.
Trovafloxacin was the most active quinolone tested against S. aureus strains, followed by levofloxacin and sparfloxacin, whereas ciprofloxacin and norfloxacin were the least active quinolones, in both the presence and absence of reserpine. Epidemiologically related S. aureus strains presented different mechanisms of quinolone resistance, suggesting a divergent evolution of the same clone. Finally, 16 S. aureus strains with a ciprofloxacin plus reserpine MIC > or = 1 mg/L already showed a mutation in the grlA gene. This MIC may be useful as a marker of mutation in this gene, contraindicating the use of this quinolone, since a second mutation may develop during treatment.

Download full-text

Full-text

Available from: Joaquim Ruiz, Sep 01, 2014
0 Followers
 · 
186 Views
  • Source
    • "Table 4) (Sierra et al., 2002). However, in Streptococcus pneumoniae the primary target can be both DNA gyrase and Topo IV, depending on the fluoroquinolone (Pan and "
    [Show abstract] [Hide abstract]
    ABSTRACT: Fluoroquinolones are an important class of wide-spectrum antibacterial agents. The first quinolone described was nalidixic acid, which showed a narrow spectrum of activity. The evolution of quinolones to more potent molecules was based on changes at positions 1, 6, 7 and 8 of the chemical structure of nalidixic acid. Quinolones inhibit DNA gyrase and topoisomerase IV activities, two enzymes essential for bacteria viability. The acquisition of quinolone resistance is frequently related to (i) chromosomal mutations such as those in the genes encoding the A and B subunits of the protein targets (gyrA, gyrB, parC and parE), or mutations causing reduced drug accumulation, either by a decreased uptake or by an increased efflux, and (ii) quinolone resistance genes associated with plasmids have been also described, i.e. the qnr gene that encodes a pentapeptide, which blocks the action of quinolones on the DNA gyrase and topoisomerase IV; the aac(6')-Ib-cr gene that encodes an acetylase that modifies the amino group of the piperazin ring of the fluoroquinolones and efflux pump encoded by the qepA gene that decreases intracellular drug levels. These plasmid-mediated mechanisms of resistance confer low levels of resistance but provide a favourable background in which selection of additional chromosomally encoded quinolone resistance mechanisms can occur.
    Microbial Biotechnology 01/2009; 2(1):40-61. DOI:10.1111/j.1751-7915.2008.00063.x · 3.21 Impact Factor
  • Source
    • "and, 5'CAGTCGG TGATGTTATTGGT3', 5'CCTTGAATAATACCACC AGT3' for grlA and 5'ATGGCTGAATTACCTCAA TC3', 5'GTGTGATTTTAGTCATACGC3' for gyrA, (Sierra et al. 2002 "
    [Show abstract] [Hide abstract]
    ABSTRACT: To determine grlA and gyrA mutations in ciprofloxacin- methicillin-resistant Staphylococcus aureus isolates and their susceptibility to current antimicrobials, including a newer fluoroquinolone gatifloxacin, glycopeptides vancomycin, teicoplanin and oxazolidinone linezolid. A total of 56 methicillin-resistant S. aureus (MRSA) isolates were collected during 2003-2006 from inpatients of Süleyman Demirel University Hospital. The isolates were confirmed to be MRSA by the production of coagulase, showing resistance against cefoxitin and having the mecA gene and tested by disk diffusion for susceptibility to vancomycin, teicoplanin and linezolid. The minimum inhibitory concentrations (MICs) of ciprofloxacin and gatifloxacin were measured using the E-test. The quinolone resistance determining regions (QRDRs) of isolates were amplified by PCR and mutations in grlA and gyrA genes were identified by direct sequencing. Sequencing data revealed that 96% of our isolates had mutations in both grlA and gyrA genes. Among these, the grlA mutation of Ser-80-Phe or Tyr and the gyrA mutation of Ser-84-Leu were the most dominant ones being detected in 50 (89%) and 40 (71%) isolates, respectively. Although 96% of isolates were highly resistant to ciprofloxacin (MIC, >or=32 mg/l), only 54% of ciprofloxacin-resistant MRSA isolates were resistant to gatifloxacin and exhibited lower-level resistance (MIC, <or=6 mg/l). Of the isolates tested, 46% were found to be susceptible to gatifloxacin (MIC, <or=0.5 mg/l). Full susceptibility was observed for vancomycin, teicoplanin and linezolid. This study provided information on grlA and gyrA mutations and current antimicrobial susceptibility in clinical MRSA isolates. The results indicated that gatifloxacin is still effective against MRSA isolates and might be useful for treatment of less serious MRSA infections but careful monitoring of susceptibility is required.
    European journal of medical research 08/2008; 13(8):366-70. · 1.40 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: A topoisomerase was identified as the bacterial target site for quinolone action in the late 1970s. Since that time, further study identified two bacterial topoisomerases, DNA gyrase and topoisomerase IV, as sites of antibacterial activity DNA gyrase appears to be the primary quinolone target for gram-negative bacteria. Topoisomerase IV appears to be the preferential target in gram-positive organisms, but this varies with the drug. Three mechanisms of resistance against quinolones are mutations of topoisomerases, decreased membrane permeability, and active drug efflux. Although these mechanisms occur singly, several resistance factors are often required to produce clinically applicable increases in minimum inhibitory concentrations. Appropriate drug selection and dosage and prudent human and veterinary interventions are important factors in controlling the emergence of resistance.
    Pharmacotherapy 11/2001; 21(10 Pt 2):224S-232S. DOI:10.1592/phco.21.16.224S.33997 · 2.20 Impact Factor
Show more