VEGF: A modifier of the del22q11 (DiGeorge) syndrome?

The Center for Transgene Technology and Gene Therapy, Flanders Interuniversity Institute for Biotechnology, Katholieke Universiteit Leuven, Leuven, Belgium.
Nature Medicine (Impact Factor: 27.36). 03/2003; 9(2):173-82. DOI: 10.1038/nm819
Source: PubMed


Hemizygous deletion of chromosome 22q11 (del22q11) causes thymic, parathyroid, craniofacial and life-threatening cardiovascular birth defects in 1 in 4,000 infants. The del22q11 syndrome is likely caused by haploinsufficiency of TBX1, but its variable expressivity indicates the involvement of additional modifiers. Here, we report that absence of the Vegf164 isoform caused birth defects in mice, reminiscent of those found in del22q11 patients. The close correlation of birth and vascular defects indicated that vascular dysgenesis may pathogenetically contribute to the birth defects. Vegf interacted with Tbx1, as Tbx1 expression was reduced in Vegf164-deficient embryos and knocked-down vegf levels enhanced the pharyngeal arch artery defects induced by tbx1 knockdown in zebrafish. Moreover, initial evidence suggested that a VEGF promoter haplotype was associated with an increased risk for cardiovascular birth defects in del22q11 individuals. These genetic data in mouse, fish and human indicate that VEGF is a modifier of cardiovascular birth defects in the del22q11 syndrome.

Download full-text


Available from: Stephane Plaisance, Sep 30, 2015
49 Reads
  • Source
    • "Its clinical features broadly include cardiac defects, craniofacial and aortic arch anomalies. Previous studies addressing DGS etiology implicate a series signaling pathways such as FGF (Guo et al., 2011), VEGF (Stalmans et al., 2003), retinoic acid (Roberts et al., 2006; Ryckebüsch et al., 2010) and TGFbeta (Wurdak et al., 2005; Choudhary et al., 2006). These studies highlight the linkage in signaling circuits in different cell types during cardiac and craniofacial development processes, whose nature are largely unknown. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Cardiac and craniofacial developmental programs are intricately linked during early embryogenesis, which is also reflected by a high frequency of birth defects affecting both regions. The molecular nature of the crosstalk between mesoderm and neural crest progenitors and the involvement of endothelial cells within the cardio-craniofacial field are largely unclear. Here we show in the mouse that genetic ablation of vascular endothelial growth factor receptor 2 (Flk1) in the mesoderm results in early embryonic lethality, severe deformation of the cardio-craniofacial field, lack of endothelial cells and a poorly formed vascular system. We provide evidence that endothelial cells are required for migration and survival of cranial neural crest cells and consequently for the deployment of second heart field progenitors into the cardiac outflow tract. Insights into the molecular mechanisms reveal marked reduction in Transforming growth factor beta 1 (Tgfb1) along with changes in the extracellular matrix (ECM) composition. Our collective findings in both mouse and avian models suggest that endothelial cells coordinate cardio-craniofacial morphogenesis, in part via a conserved signaling circuit regulating ECM remodeling by Tgfb1.
    Biology Open 07/2014; 3(8). DOI:10.1242/bio.20148078 · 2.42 Impact Factor
  • Source
    • "MOs from Gene Tools LLC (Philomath, OR) were used as follows: (1) MO1 [5’-AGACCTTACCTTCCTGATTTAGTGA-3’], 0.4 pmole/embryo (targeting donor site at intron 1 of tbx2a); (2) MO2 [GGAAACATTCTCCTATGGACGAAAG], 0.1-0.2 pmole/embryo (targeting the acceptor site at intron 1 of tbx2a); (3) Mismatched morpholino-Mis-MO2 [5’-cGAAACAcTCgCCTAcGGACcAAAG-3’] (lower case denotes replaced nucleotides), 0.4 pmole/embryo (negative control for MO2); (4) MO3 [5’-TTGTCTTCTGGAAAAACAAATGTTA-3’], 0.1 pmole/embryo; (5) tbx1-MO [5′-GAT GTCTCCAATAGATAATGTGTCG-3′], 0.1 pmole/embryo (targeting 5’UTR of tbx1) [69]; (6) p53-MO [5’- GCGCCATTGCTTTGCAAGAATTG-3’] [70], 0.3 pmole/embryo (targeting ATG of tp53). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Tbx2 is a member of the T-box family of transcription factors essential for embryo- and organogenesis. A deficiency in the zebrafish paralogue tbx2a causes abnormalities of the pharyngeal arches in a p53-independent manner. The pharyngeal arches are formed by derivatives of all three embryonic germ layers: endodermal pouches, mesenchymal condensations and neural crest cells. While tbx2a expression is restricted to the endodermal pouches, its function is required for the normal morphogenesis of the entire pharyngeal arches. Given the similar function of Tbx1 in craniofacial development, we explored the possibility of an interaction between Tbx1 and Tbx2a. The use of bimolecular fluorescence complementation revealed the interaction between Tbx2a and Tbx1, thus providing support for the idea that functional interaction between different, co-expressed Tbx proteins could be a common theme across developmental processes in cell lineages and tissues. Together, this work provides mechanistic insight into the role of TBX2 in human disorders affecting the face and neck.
    PLoS ONE 10/2013; 8(10):e77171. DOI:10.1371/journal.pone.0077171 · 3.23 Impact Factor
  • Source
    • "Abnormal venous endothelial differentiation might explain these different flow velocities seen in fetuses with increased NT [49]. Altered (lymphatic) endothelial differentiation is suggested as a common pathway in both the origin of increased NT and the development of cardiac defects [50] [51]. Future studies using different (mouse) models with cardiac defects, disturbed lymphatic development and increased NT could provide insights into this process. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Doppler flow velocities of the ductus venosus are increasingly used to assess fetal increased nuchal translucency, growth-restriction and monochorionic twins, and might contribute to screening for cardiac defects. It is disputed whether a sphincter at the ductus venosus inlet actively regulates blood flow. This study aims to define the morphogenesis of the developing mouse and human ductus venosus and to address the existence of a sphincter. The presence of endothelium, smooth muscle, elastic fibers and nerves in the ductus venosus of E10.5-15.5 mouse embryos and in three corresponding human embryos (CS16, CS19 and CS23) was examined using immunohistochemistry. Three-dimensional reconstructions of the ductus venosus of E11.5-15.5 mouse and CS14-23 human embryos were generated and examined. The ductus venosus lumen was narrowed from ventral-caudal to dorsal-cranial in E13.5-15.5 mouse and CS16-23 human embryos. Mouse embryos showed positive endothelial Pecam1 expression from E11.5-15.5 and smooth muscle actin staining in the ventral-caudal part of the ductus venosus from E12.5-15.5. At all developmental stages, elastic fiber and nerve marker expression was not detected in the ductus venosus (Fig. 2). In human embryos endothelial Pecam1 and smooth muscle actin expression was found in the ductus venosus from CS16 and CS19 onwards. Elastic fiber and nerve marker expression was not detected in all stages (Fig. 4). Morphogenesis and staining results of the ductus venosus were similar in both species. The ductus venosus lacks a sphincter at its inlet as no accumulation of smooth muscle cells, elastic fibers or nerve innervation was found in mouse embryos from E11.5-15.5 and in human embryos from CS14-23.
    Early human development 08/2013; 89(12). DOI:10.1016/j.earlhumdev.2013.07.029 · 1.79 Impact Factor
Show more