Recurrent infectious crystalline keratopathy caused by different organisms in two successive corneal grafts in the same patient.

Full text

Page 1

PostScript..............................................................................................
LETTERS
Laser induced chorioretinal
venous anastomosis in ischaemic
central retinal vein occlusion
Laser induced chorioretinal venous anas-
tomosis (CRVA) has been advocated by
McAllister and Constable as a treatment for
non-ischaemic central retinal vein occlusion
(CRVO).1This technique potentially offers a
means of permanently bypassing the site of
obstruction to venous outflow, which is
thought to occur in the region of the lamina
cribrosa. In ischaemic CRVO, the visual
prognosis is usually much poorer, with devas-
tating complications like neovascular glau-
coma and progressive macular ischaemia.2In
this prospective study, we investigated the
feasibility of laser induced CRVA in eyes with
ischaemic CRVO, in view of the possibility of
avoiding or lessening these severe complica-
tions.
Materials and methods
The classification of ischaemic CRVO was
based on the presence of 10 disc diameter or
more of capillary non-perfusion in the fundus
fluorescence angiography (FFA), according to
the criteria in the CRVO study.2Approval from
the ethics committee and informed consent
from patients were obtained. Inclusion and
exclusion criteria are shown in Table 1.All the
laser treatment was performed by one of the
authors (AK) who had successfully treated
patients with non-ischaemic CRVO with a
similar procedure. The site for attempts at the
creation of anastomosis was in the inferotem-
poral and superonasal retina over a venous
tributary of the retinal vein where it crosses
over an underlying choroidal vein, at least 3
disc diameters away from the optic disc.
Argon or diode laser with 50 µm spot size of
0.1–0.2 second’s duration and with a power
levelof1.5–2.5Wwasfocusedovertheedgeof
the chosen retinal vein. Increasing power was
used until there was haemorrhaging from the
vein (Fig 1A). The bleeding was stopped by
pressure on the eye with a contact lens.
Results
Six eyes of six patients were included (Table
2). All of them had posterior vitreous detach-
ment. Median follow up was 21 months
(range 5–31 months). The median preopera-
tive best corrected visual acuity (BCVA) was
3/200 (range, hand movement to 8/200). The
median postoperative best corrected visual
acuity (BCVA) was 2/200 (range, hand move-
ment to 20/200). The median number of
attempted anastomosis sites per eye was four
(range, two to four). Through repeated oph-
thalmoscopic examination,FFA,and indocya-
nine green angiography,no functional anasto-
mosis was found.A small nodular fibrotic scar
was noted in each site (Fig 1B). No other sig-
nificant laser related complication was found.
One eye eventually developed rubeotic glau-
coma.
Comment
In non-ischaemic CRVO, a successful CRVA
was created in 33–54% of eyes.1 3Laser
photocoagulation
differed, because the superiority of one
combination of parameters compared with
another had not been demonstrated.3In our
study, it appears that argon or diode laser
induced CRVA was not feasible in ischaemic
CRVO. We attribute this to the severe
endothelial cell damage secondary to ischae-
mia and venous thrombosis across the retinal
circulation. In a dog model without retinal
vein occlusion, a successful laser induced
CRVA was shown to be lined by endothelial
cells.4Despite the failure to create functional
CRVA, we did not encounter any adverse
complication related to the laser treatment.
The presence of posterior vitreous detach-
ment in our patients might have lessened the
chance of development of chorioretinovitreal
neovascularisation.Successful
ischaemic CRVO has been reported to be
established through pars plana vitrectomy
with direct surgical puncture or erbium:YAG
laser.5–7This surgical approach may be a
better option to create CRVA in ischaemic
eyes, especially when the posterior hyaloid is
still attached preoperatively.
treatment parameters
CRVAin
Table 1
Inclusion and exclusion criteria of patients
Inclusion criteria:
1 Confirmed presence of central retinal vein occlusion
2 Central retinal vein occlusion <3 months’ duration
3 Visual acuity </=20/200
4 Intraocular pressure <30 mm Hg
5 Ability to obtain good quality fundus photographs and angiograms
6 Age >21 years old
Exclusion criteria:
1 Intercurrent eye disease of study eye that is likely to affect visual acuity over study period
2 Presence of any diabetic retinopathy in either eye
3 New or old branch artery/vein occlusion in study eye
4 Other retinal vascular disease in study eye
5 Vitreous haemorrhage other than breakthrough in study eye
6 Presence of neovascularisation of the study eye (iris, angle, retina, disc)
7 Heparin/warfarin sodium cannot be discontinued for duration of study
8 Impossible to differentiate between ischaemic and non-ischaemic central retinal vein occlusion
Table 2
Baseline and outcome characteristics of patients receiving laser treatment
Patient
No Sex/age
Interval of CRVO
and laser (weeks)
Laser
used
No of laser
sessions
Total No of laser
sites attempted
Initial
BCVA
Final
BCVA
Duration of follow
up (months)Complication
1
2
3
4
5
6
M/79
F/80
F/54
M/53
F/80
F/78
5
2
3
12
6
10
Argon
Diode
Argon
Diode
Argon
Argon
2
1
2
2
2
1
4
2
4
4
4
2
8/200
2/200
4/200
8/200
HM
HM
HM
2/200
20/200
5/200
HM
2/200
31
31
19
23
7
5
Neovascular glaucoma
CRVO = central retinal vein occlusion; BCVA = best corrected visual acuity.
Figure 1
subretinal haemorrhage around the
attempted anastomotic site along the
inferotemporal retinal vein shortly after the
laser treatment. (B) Seven months later, a
small fibrotic nodule was present with
minimal amount of altered blood.
Patient 3. (A) Retinal and
Br J Ophthalmol 2003;87:1043–10551043
www.bjophthalmol.com
group.bmj.com on July 16, 2011 - Published by bjo.bmj.comDownloaded from

Page 2

Financial and proprietary interest: nil.
Financial support: nil.
A K H Kwok
Department of Ophthalmology, Hong Kong
Sanatorium and Hospital, Hong Kong,
People’s Republic of China
A K H Kwok, V Y W Lee, T Y Y Lai
Department of Ophthalmology and Visual Sciences,
The Chinese University of Hong Kong,
Hong Kong Eye Hospital, Hong Kong,
People’s Republic of China
C Hon
Department of Ophthalmology, Queen Mary
Hospital, Hong Kong, People’s Republic of China
Correspondence to: Dr Alvin K H Kwok,
Department of Ophthalmology, Hong Kong
Sanatorium and Hospital, 2 Village Road, Happy
Valley, Hong Kong; alvinkwok@hksh.com
Accepted for publication 1 December 2002
References
1 McAllister IL, Constable IJ. Laser-induced
chorioretinal venous anastomosis for
non-ischemic central retinal vein occlusion:
evaluation of the complications and their risk
factors. Am J Ophthalmol 1998;126:219–29.
2 Central Vein Occlusion Study Group.
Baseline and early natural history report: the
central vein occlusion study. Arch Ophthalmol
1993;111:1087–95.
3 Fekrat S, Goldberg MF, Finkelstein D.
Laser-induced chorioretinal venous
anastomosis for nonischemic central or branch
retinal vein occlusion. Arch Ophthalmol
1998;116:43–52.
4 Vijayasekaran S, Yu DY, McAllister IL, et al.
Optimal conditions required for the creation of
an iatrogenic chorioretinal venous
anastomosis in the dog using argon green
laser photocoagulation. Curr Eye Res
1995;14:63–70.
5 Fekrat S, de Juan E. Chorioretinal venous
anastomosis for central retinal vein occlusion:
transvitreal venipuncture. Ophthalmic Surg
Lasers 1999;30:53–5.
6 Peyman GA, Kishore K, Conway MD.
Surgical chorioretinal venous anastomosis for
ischemic central retinal vein occlusion.
Ophthalmic Surg Lasers 1999;30:605–14.
7 Quiroz-Mercado H, Sanchez-Buenfil E,
Guerrero-Naranjo JL, et al. Successful erbium:
YAG laser-induced chorioretinal venous
anastomosis for the management of ischemic
central retinal vein occlusion. A report of two
cases. Graefes Arch Clin Exp Ophthalmol
2001;239:872–5.
Actinic granuloma of the
conjunctiva
Actinic granuloma is a condition character-
ised, histologically, by a preponderance of
giant cells in close relation with damaged
elastic fibres and the absence of necrobiosis,
lipid,mucin,and
granuloma.1The term was coined in 1975 by
palisadingof the
O’Brien who described similar histological
features in cutaneous lesions of patients with
sun damaged skin.2Actinic elastosis is the
hallmark of pingueculae and has been noted
in association with a granulomatous reaction
in only one previous report.3
Over the past three decades, three cases of
actinic granuloma of the conjunctiva have
been documented in the literature (Table
1).4–6
The paucity of reports ensures that the con-
dition is under-recognised both clinically and
pathologically.We describe a further case with
the novel association of scleral thinning, and
further review the literature with reference to
pathogenesis, disease associations, treatment,
and significance for both ophthalmologists
and pathologists.
Case history
A 67 year old white woman presented to the
ophthalmology department with a 3 week
history of a painless,red right eye.She had no
previous ophthalmic problems. Significant
past medical history included treated pulmo-
nary tuberculosis and a lumpectomy for
breast carcinoma 10 years previously. She had
no significant family history and otherwise
was generally well.
Ocular examination demonstrated a 3 × 3
mm,raised,flesh coloured,vascularised lesion
on the right nasal bulbar conjunctiva with an
associated corneal dellen (Fig 1). Further
scleral changes were observed circumferen-
tially around the limbus under an apparently
healthy conjunctiva (Fig 1, arrowhead).
Initial differential diagnosis was carcinoma
in situ of the conjunctiva or metastasis from
breast carcinoma,although the lesion was not
clinically typical of either.
An excision biopsy was performed. During
surgery the underlying sclera was noted to be
degenerate with significant thinning.
Histology of the lesion demonstrated dys-
plasia within the squamous epithelium and
prominent solar elastosis with a granuloma-
tous response to degenerative elastic fibres.
There was a lymphoplasmacytic infiltrate
characteristic of an inflamed pinguecula with
granulomatous features suggestive of actinic
granuloma (Fig 2).
Investigations into the cause of the under-
lying focal scleral atrophy included full blood
count, erythrocyte sedimentation rate, serum
VDRL,serum complement,anti-ro and anti-la
antibodies,and rheumatoid factor which were
all within normal limits. A screening serum
ANCA was weakly positive (1:20) but anti-
myeloperoxidase assays were negative.
Anterior segment ultrasonography was
normal. Fluorescein angiography of the ante-
rior segment demonstrated an evenly per-
fused iris, but a filling defect clearly deline-
ated the atrophy and thinning at the lesion
site. Our patient was subsequently treated
with topical antibiotics and eye padding and
responded favourably over several weeks with
progressive epithelialisation over the excision
defect (Fig 3). The scleral changes persisted
after resolution of the epithelial defect (Fig 3,
arrowhead).
Comment
O’ Brien, in his original description of actinic
granuloma, described the pathogenesis as a
phenomenon of repair occurring in damaged
connective tissue.2This concept was disputed
by Ragaz and Ackerman7who believed that
the granulomatous inflammation was not a
response to degenerative elastotic fibres but
Table 1
Review of previously published cases of actinic granuloma
Patient age
(years)Sex Location
Size of
lesionClinical presentation Differential diagnosis
Case 1, Proia et al4
38 Female Temporal bulbar conjunctiva 2 mm3/52 History of painless
red eye
6/52 History of red eye
Vascularised pinguecula
Case 2, Ferry et al5
30FemaleTemporal bulbar conjunctiva 2 × 3 mmPingueculitis, contact lens reaction,
conjunctival naevus
Pingueculitis, Bowen’s disease
Bowen’s disease, breast
metastasis
Case 3, Steffen et al6
Case 4, Gallagher et al
39
67
Female
Female
Conjunctiva, site unknown
Nasal bulbar conjunctiva
Not known
3 × 3 mm
Not known
3/52 History of painless
red eye
Figure 1
scleral thinning shown by arrowhead.
Presenting appearance of lesion
Figure 2
Histology of excised lesion.
Figure 3
Persisting scleral thinning shown by
arrowhead.
Appearance post-incision.
1044 PostScript
www.bjophthalmol.com
group.bmj.com on July 16, 2011 - Published by bjo.bmj.comDownloaded from

Page 3

that the lesions described by O’Brien repre-
sented variants of granuloma annulare, a dis-
order of skin and ocular adnexae.8 9The exist-
ence of conjunctival actinic granulomas in
isolation distinguishes this condition from
granuloma annulare and implies that granu-
loma formation can occur in response to elas-
totic material. Furthermore, actinic granulo-
mas are histologically distinct with prominent
elastotic degeneration of connective tissue
fibres, giant cells, and inconspicuous palisad-
ing of epithelioid histiocytes.
McGrae postulated that actinic granuloma
represented a cell mediated immune response
to weakly antigenic determinants on actinic-
ally altered elastotic fibres with a predomi-
nance of helper T cells in the lymphocytic
infiltrate.1
More recently the association of temporal
arteritis and actinic granulomas of the skin
has been documented.10It is hypothesised
that actinic radiation selectively injures elastic
tissue in the skin and its superficial arteries
and this tissue may then become antigenic,
with local, humoral, and systemic overtones.
It is reported that the serum of patients
with untreated giant cell arteritis contains a
significantly elevated level of an elastase in
the form of matrix metalloproteinase 9
(MMP-9) and that this enzyme was found to
be abundant in the vicinity of damaged
temporal internal elastic laminae.11Gillot et
al12observed that sera from 12 of 13 patients
with untreated giant cell arteritis contained
high levels of elastase derived elastin peptides
and that the peptides were targeted by T lym-
phocytes such as appear in the actual lesions
ofactinicgranuloma1
arteritis.13This mode of autoimmune reaction
complies with the “danger” model of autoim-
munity described by Matzinger and appraised
by Larkin.14
Our case presented with the novel associ-
ation of an underlying focal scleral atrophy.
Negative investigations for scleritis would
suggest that this feature may be an extension
of the autoimmune process representative of
actinic granuloma rather than an independ-
ent idiopathic scleritis.
It is interesting to note that all documented
cases of actinic granuloma of the conjunctiva
have occurred in females which would be
supportive of an autoimmune pathogenesis.
Clinically,the differential
conjunctivalactinic
pingueculitis, Bowen’s disease, conjunctival
naevus, granuloma annulare (pseudorheu-
matoid nodule), and episcleral rheumatoid
nodule.
Pathologically, the differential diagnosis
includes pingueculae,
infection—particularly fungal, parasitic, or
mycobacterial—and foreign body reactions.
However, there is no granulomatous reaction
to the actinic elastosis in pingueculae. In fun-
gal and parasitic lesions there is often a
prominent eosinophilic infiltrate associated
with the granulomas.Caseous necrosis is seen
in mycobacterial infections. In difficult cases
special stains may help. Polarised light micro-
scopy rules out the presence of any birefrin-
gent material.
Actinic granuloma of the conjunctiva
represents a distinct clinical, histopathologi-
cal, and immunological entity. Its classic
presentation over a short period of a few
weeks and poor response to topical steroid
treatment should aid the ophthalmologist in
recognising this lesion. Of practical import-
ance to the ophthalmic pathologist is recog-
nition that the granulomatous inflammation
may be associated with elastotic degenera-
andgiant cell
diagnosisof
granulomaincludes
pingueculitis,
tion and does not necessarily imply the pres-
ence of a foreign body, fungal, or mycobacte-
rial infection.
M J Gallagher, F Roberts, S Osborne,
C M Kirkness
Tennent Institute of Ophthalmology, Gartnavel
General Hospital, Great Western Road, Glasgow
G12 0YN, UK
Correspondence to: Stuart A Osborne, Tennent
Institute of Ophthalmology, Gartnavel General
Hospital, Great Western Road, Glasgow
G12 0YN, UK; stozzie@hotmail.com
Accepted for publication 9 December 2002
References
1 McGrae JD Jr. Actinic granuloma: a clinical,
histopathologic, and immunocytochemical
study. Arch Dermatol 1986;122:43–7.
2 O’Brien JP. Actinic granuloma: an annular
connective tissue disorder affecting sun- and
heat-damaged (elastotic) skin. Arch Dermatol
1975;111:460–6.
3 Bernardino V, Olivar E, Mangubat L, et al.
Solitary nodular conjunctivitis-the inflamed
pinguecula, granulomatous reaction to
elastotic fibres. Philippine J Ophthalmol
1972;4:1.
4 Proia AD, Browning DJ, Klintworth GK.
Actinic granuloma of the conjunctiva. Am J
Ophthalmol 1983;96:116–18.
5 Ferry AP, Kaltreider SA, Wyatt DB. Actinic
granuloma of the conjunctiva. Arch
Ophthalmol 1984;102:1200–2.
6 Steffen C. Actinic granuloma of the
conjunctiva. Am J Dermatopathol
1992;14:253–4
7 Ragaz A, Ackerman AB. Is actinic granuloma
a specific condition? Am J Dermatopathol
1979;1:43–50
8 Rao NA, Font RL. Pseudorheumatoid nodules
of the ocular adnexae. Am J Ophthalmol
1975;79:471–8.
9 Ferry AP. Subcutaneous granuloma annulare
(“pseudorheumatoid nodule”) of the eyebrow.
J Pediatr Ophthalmol 1997;14:154–7.
10 O’Brien JP, Regan W. Actinically degenerate
elastic tissue is the likely antigenic basis of
actinic granuloma of the skin and of temporal
arteritis. J Am Acad Dermatol
1999;40:214–22.
11 Sorbi D, French DL, Nuovo GJ. Elevated
levels of 92-kd type IV collagenase (matrix
metalloproteinase 9) in giant cell arteritis.
Arthritis Rheum 1996;39:1747–53.
12 Gillot J-M,Masy E, Davril M. Elastase derived
elastin peptides: putative autoimmune targets
in giant cell arteritis. J Rheumatol
1997;24:677–82.
13 Andersson R. Immunological studies in giant
cell arteritis. Ballieres Clin Rheumatol
1991;5:405–12.
14 Larkin M. Polly Matzinger: immunology’s
dangerous thinker. Lancet 1197;350:38.
Unilateral nasal hemianopsia
secondary to posterior
subcapsular cataract
Visual field defects respecting the vertical
midline are a common occurrence associated
with focal neurological lesions. However, uni-
lateral nasal hemianopsias are rare defects,
documented to be associated with pituitary
adenomas, temporal optic nerve lesions, and
suprasellar aneurysms.1Cataracts are known
to depress the overall sensitivity of the visual
field,2 3but localised visual field defects due to
cataract are extremely rare and, to our knowl-
edge, only three other cases have been
reportedintheliterature.4–6Wereportacaseof
a right unilateral nasal hemianopsia resulting
from central posterior subcapsular lens opac-
ity.
Case report
A 51 year old woman treated for normal ten-
sion glaucoma in her right eye for 2 years
attended for a review of her glaucoma follow-
ing a change of medication with the addition
of bimonidine eye drops to dorzolamide eye
drops. At this 3 monthly review the patient
Figure 1
cataract and visual field defect, (C) visual field after cataract removal.
Humphrey 24-2 visual field showing (A) precataract visual field, (B) field with
PostScript1045
www.bjophthalmol.com
group.bmj.com on July 16, 2011 - Published by bjo.bmj.com Downloaded from

Page 4

gave a 1 month history of a sudden onset of
misty vision affecting her right nasal visual
field noticed while driving her car. There were
no other associated neurological symptoms.
Just before this she had been diagnosed with
“borderline” systemic hypertension. There
were no other risk factors for a vascular event,
although there is a positive family history—
her father had had a cerebrovascular accident.
On examination, her visual acuity had
deteriorated from 6/6 to 6/24 in the right eye,
remaining unchanged at 6/6 in the left since
the previous visit. It had also been docu-
mented that letters on the nasal side of the
Snellen chart were not seen with the right
eye.Confrontation visual field demonstrated a
nasal hemianopsia of the right eye.Her pupils
were equal with normal reactions to light and
accommodation. Dilated slit lamp biomicros-
copy revealed marked central posterior sub-
capsular lens opacity with very mild subcap-
sular changes in the other eye, previously
documented as normal. Retinal examination
was normal and the optic discs pathologically
cupped with inferior rim thinning; changes
consistent with glaucoma, although there
were no documented changes from the previ-
ous visit 6 months earlier.
Further neurological and cardiovascular
examination, other than a blood pressure of
170/70 mm Hg, were also unremarkable.
The right nasal hemianopsia respecting the
vertical midline was confirmed on a clinically
reliable Humphrey 24-2 plot with a change in
mean deviation from −5.94 to −17.43 from the
previously documented visual field (see Fig
1). The visual field of the left eye was normal.
Routine blood tests and chest x ray were nor-
mal. A computed tomograph (CT) scan of the
brain, orbits and visual pathways was also
unremarkable. In the absence of a focal
neurological lesion this woman subsequently
underwent an uncomplicated right phacoe-
mulsification and intraocular lens replace-
ment. A repeat red spot visual field revealed
complete reversal of the previously docu-
mented right nasal hemianopsia, and a resto-
ration of the visual acuity to 6/6.
Comment
Media opacities are known to cause visual
field defects,7the degree of which varies from
generalised depression of the visual field8to
apparent scotomatous areas. Localised parax-
ial lens opacities causing defects mimicking
neurologicalabnormalities
rare. These opacities necessitate a posterior
position in the lens to produce a relative
scotoma. An opacity in the media anteriorly
placed produce generalised reduction in the
visual field. In the previous three reported
cases all the cataracts were posterior subcap-
sular in nature.
Our case is unusual in that the cataract was
placed centrally, not temporally as may be
expected with a nasal defect. Further, the his-
tory suggested a sudden onset which necessi-
tated neurological examination and investiga-
tion.
We feel it would have been inappropriate to
proceed to surgical intervention without
previous investigation, which should always
include a CT scan (more preferably, if readily
available, an magnetic resonance imaging
(MRI) scan), of the optic nerves and visual
pathways. This unusual visual field defect
may have been present for some time before
the appearance of the cataract but, if subtle,
may not have been evident. However, the
presence of the cataract may have decreased
the sensitivity of the eye and made the visual
defect more prominent.Our concern with this
are extremely
woman was that removing the cataract may
have disguised a more sinister underlying
pathology—that is, a neurological defect, so
we decided on a red spot visual field to
confirm that such a defect was indeed not
present.
Whereas in this case the right nasal
hemianopsia was due to a posterior subcapsu-
lar cataract, we believe that a neurological
cause for the field defect should always be
sought, particularly with a history of sudden
onset. Cataract extraction should be consid-
ered only establishing the absence of the
same. Further, consider performing a postop-
erative red spot visual field test to confirm the
absence of focal neurology in such eyes.
I Rahman, A Nambiar, A F Spencer
Manchester Royal Eye Hospital, Lister Centre,
Nelson Street, Manchester, UK
Correspondence to: Mr Imran Rahman, Manchester
Royal Eye Hospital, Lister Centre, Nelson Street,
Manchester, UK; imran1973@tiscali.co.uk
Accepted for publication 9 December 2002
References
1 Miller NR, Newman NJ. Topical diagnosis of
lesions in the visual sensory pathway. In:
Miller NR, Newman NJ, eds. Walsh and
Hoyt’s clinical neuro-ophthalmolgy. 5th ed.
Baltimore: Williams and Wilkins,
1998;1:302–3.
2 Fine EM, Rubin GS. Effects of cataract and
scotoma on visual acuity: a simulation study.
Optom Vis Sci 1999;76:468–73.
3 Fine EM, Rubin GS. The effects of simulated
cataract on reading with normal vision and
simulated central scotoma. Vis Res
1999;39:4274–85.
4 Karp CL, Fazio JR. Traumatic cataract
presenting with unilateral nasal hemianopsia.
J Cataract Refract Surg 1999;25:1302–3.
5 Phillips CI, Vaid RL, Adams AD. Field defect
due to posterior cortical paraxial lens opacity.
A Case Report. Trans Ophthalmol Soc UK
1978;98:486–9.
6 Lyne AJ, Phillips CI. Visual field defects due
to opacities in the optical media. Br J
Ophthalmol 1969;53:119–22
7 Hayashi K, Hayashi H, Nakao F, et al.
Influence of cataract surgery on automated
perimetry in patients with glaucoma. Am J
Ophthalmol 2001;132:41–6
8 Lam BL, Alward WLM, Kolder HE. Effect of
cataract on automated perimetry.
Ophthalmology 1991;98:1066–70.
Lack of human papillomavirus in
pterygium of Chinese patients
from Taiwan
We read with interest that Gallagher et al had
demonstrated the association of human pap-
illomavirus(HPV)andpterygiumbypolymer-
ase chain reaction (PCR).1Several hypotheses
concerning the pathogenesis of pterygia have
been proposed, including exposure to ultra-
violet irradiation2and other environmental
factors, genetic predisposition, and viral
infections.3The various theories regarding
pterygium formation imply that much about
the pathogenesis of pterygia remains to be
investigated.
The involvement of HPV in the genesis of
pterygia is controversial. Some authors have
demonstrated that HPV is present in 24–50%
of specimens, whereas others have failed to
detect HPV in pterygia.4–7To help resolve this
dilemma, we evaluated 65 pterygia, 23
pinguecula, and 88 normal conjunctiva de-
rived from Chinese patients in Taiwan for the
presence of HPV DNA. We used PCR with
three different consensus primer sets—MY09/
MY11 (MY), L1C1/L1C2-1 (LC), and GP5/GP
(GP).
Material and methods
Samples were obtained from consecutive
patients treated at the ophthalmological clinic
of the Taipei Veterans General Hospital. Medi-
cal and ophthalmologic histories were re-
corded for each patient,a slit lamp microscope
examination was performed, and pterygia
were photographed before surgery. In each
case, a specimen of adjacent clinically normal
conjunctival tissue (from the 12 o’clock
position of the corneoconjunctival limbus)
was obtained. Immediately after surgery,
tissue specimens (pterygia, pingueculas, or
conjunctival tissues) were stored at −70°C.
DNA preparation
The DNA from specimens was isolated as
described previously.8Briefly, the lysis buffer
(10 mM TRIS-HCl; pH 7.5, 1 mM EDTA, pH
7.9; 0.5% SDS) and the proteinase K (100
µg/ml) were added to the specimens and
incubated overnight at 37°C. The standard
phenol-chloroform extraction and the etha-
nol precipitation were used for DNA purifica-
tion and the pelleted DNA was resuspended in
50–100 µl of tridistillated sterile water. To
determine the quality and quantity of the iso-
lated DNA, each pelleted DNA sample was
analysed by electrophoresis on 1% agarose
gels stained with ethidium bromide and
viewed spectrophotometrically.
PCR analysis for HPV
Each amplification reaction was carried out in
a total volume of 20 µl overlaid with one drop
of mineral oil and contained 10 mM TRIS-HCl
(pH 8.3), 50 mM KCl, 0.25 U Taq DNA-
polymerase (Perkin-Elmer), and 100–200 ng
DNA. The concentration of dNTPs and MgCl2
varied with each set of primers. Each PCR
was carried out in DNA thermal cycler
(Perkin-Elmer CETUS DNA Thermal Cycler
480) with the first denaturation step at 92°C
for 4 minutes and the final extension step
at 72°C for 15 minutes. The conditions
and the number of denaturation-annealing-
extraction cycles were different with each set
of primers.
Table 1
detection
Consensus primer sequences for human papillomavirus DNA
PrimerSequence* (5′-3′)
MY11
MY09
L1C1
L1C2-1
GP5
GP6
GCMCAGGGWCATAAYAATGG
CGTCCMARRGGAWACTGATC
CGTAAACGTTTTCCCTATTTTTTT
TACCCTAAATACTCTGTATTG
TTTGTTACTGTGGTAGATAC
GAAAAATAAACTGTAAATCA
*M=A+C, R=A+G, W=A+T, Y=C+T.
1046PostScript
www.bjophthalmol.com
group.bmj.com on July 16, 2011 - Published by bjo.bmj.comDownloaded from

Page 5

To control the quality of the isolated DNA
internally, the 268 bp sequence of β globulin
gene wasamplified
(5’CAACTTCATCCACGTTCACC3’)
andGH20(5‘GAAGAGCCAAGGACAGG-
TAC3‘) primers9in the multiplex PCR with the
MY,LC,orGPprimers.DNAsamplesextracted
from cell cultures infected with HPV were
used as a positive control. Each PCR product
was analysed by electrophoresis on 2% agar-
ose gels stained with ethidium bromide.
using PC04
primers
PCR with MY09 and MY11 consensus
primers
The PCR with MY09/MY11 was performed as
described previously.10The PCR methods with
the three different sets of primers were
described previously.11The PCR mixture was
complementedwith2.5mMMgCl2,0.1mMof
each dNTP, 0.5 µM MY09 and MY11 primers
(Table 1) and 0.3µM PC04 and GH 20 primers.
The DNA amplication was carried out during
30 cycles that included denaturation at 92°C
for 30 seconds, annealing at 53°C for 30
seconds, and primer extension at 72°C for 30
seconds.
PCR with L1C1, L1C2-1 consensus primers
The PCR with L1C1/L1C2-1 was performed as
described previously.10The PCR mixture was
complemented with 4 mM MgCl2, 0.2 mM of
each dNTP,0.5 µM L1C1,and 0.25 µM L1C1–1
primers (Table 1). The DNA amplication was
carried out during 30 cycles that included
denaturation at 92°C for 30 seconds, anneal-
ing at 53°C for 30 seconds, and primer exten-
sion at 72°C for 30 seconds.
PCR with GP5, GP6 consensus primers
The PCR with GP5/GP6 was performed as
described previously.10The PCR mixture was
complemented with 2.5 mM MgCl2, 0.05 mM
of each dNTP, 0.5 µM GP5 and GP6 primers
(Table 1) and 0.3µM PC04 and GH 20 primers.
The DNA amplication was carried out during
40 cycles that included denaturation at 94°C
for 30 seconds, annealing at 45°C for 30
seconds, and primer extension at 72°C for 30
seconds.
Results
The specimens included 65 conjunctival
pterygia, 23 pingueculas, and 88 normal con-
junctivas. Characteristics of patients are
shown in Table 2. We were unable to detect
any HPV DNA fragments in the 23 specimens
of pingueculae, 65 specimens of pterygia, and
88 specimens of normal conjunctiva tested.
Comment
It has been proved that HPV possesses
oncogenic potential and contributes to the
development of various preneoplastic and
neoplastic conditions.12DNA of many types of
HPV, particularly types 16 and 18, has been
detected in papillomas,dysplasia,and cancers
observed on the eyelids, lacrimal outflow
tract, conjunctiva, and cornea.13 14In this
study,threesetsofconsensusprimers,MY,LC,
and GP, were used; we were unable to detect
HPV in any pterygium, pinguecula, or normal
conjunctival specimen from Chinese patients
in Taiwan, where the prevalence of pterygia is
high.
Three studies have addressed the presence
of HPV DNA in pterygia and all used PCR
amplification with a single primer (Table 3).
These reports demonstrated big differences in
frequencies, from 0% to 100%, and variety of
HPV types (type 6, 11, 16, 18) that could be
possibly explained by the different primers
used, the absence of adequate controls, small
sample size (10–50 specimens), and the
possible different frequencies of HPV infec-
tion in geographically distinct populations.
Confirmatory larger studies in different geo-
graphic populations using more efficient
primer(s) are needed to clarify the relation
between HPV infection and pterygium forma-
tion.
The similar controversy occurred in the
detection HPV DNA of malignant epithelial
neoplasms of conjunctiva but not squamous
cell papilloma of conjunctiva.15By reviewing
the published data of previous reports, HPV
positive rates in conjunctival papilloma speci-
mens were quite consistent,from 44–75% and
most of the HPV types were type 6 and 11 that
were classified as low risk HPV genotypes.15
But in the case of malignant epithelial
neoplasms of conjunctiva, the frequencies of
HPV detection varies from 0–100% and both
low risk, HPV-6 and HPV-11, and high risk,
HPV-16 and HPV-18, groups were found by
various molecular techniques.15
Owing to different populations studied and
the absence of a gold standard HPV detection
technique and adequate controls in most
studies published to date,1 6 7 16there are
marked variations in the obtained HPV preva-
lence rates in pterygium. Therefore, HPV
probably does not act alone in the develop-
ment of pterygium and the exact role of HPV
in the pathogenesis of pterygium remains
unclear.The lack of HPV DNA in pterygium in
this study may indicate either the HPV is not
associated with pterygium formation or that
the technique was not adequate for demon-
stration of such an association. Based on our
data, we suggest that HPV is not a required
cofactor in the development of pterygia.
Grant support: none.
Commercial relationship: none.
K-H Chen, W-M Hsu, C-C Cheng, Y-S Li
Department of Ophthalmology, Taipei Veterans
General Hospital, Taipei, Taiwan
K-H Chen, W-M Hsu
National Yang-Ming University, Taiwan
K-H Chen, C-C Cheng, Y-S Li
Division of Medical Engineering, National Health
Research Institutes, Taipei, Taiwan
Correspondence to: Dr Wen-Ming Hsu, Department
of Ophthalmology, Taipei Veterans General
Hospital, #201, Shih-Pai Road, Section II, Taipei,
11217 Taiwan; khchen@vghtpe.gov.tw
Accepted for publication 12 December 2002
References
1 Gallagher MJ, Giannoudis A, Herrington CS,
et al. Human papillomavirus in pterygium. Br J
Ophthalmol 2001;85:782–4.
2 Cilova-Atanasova B. On the pathogenesis of
pterygium. Folia Med (Plovdiv)
1971;13:67–74.
3 Dushku N, Hatcher SL, Albert DM, et al. p53
expression and relation to human
papillomavirus infection in pingueculae,
pterygia, and limbal tumors. Arch Ophthalmol
1999;117:1593–9.
4 Varinli S, Varinli I, Koksal Erkisi M, et al.
Human papillomavirus in pterygium. Cent Afr
J Med 1994;40:24–6.
5 Detorakis ET, Sourvinos G, Spandidos DA.
Detection of herpes simplex virus and human
papilloma virus in ophthalmic pterygium.
Cornea 2001;20:164–7.
6 Detorakis ET, Drakonaki EE, Spandidos DA.
Molecular genetic alterations and viral
presence in ophthalmic pterygium. Int J Mol
Med 2000;6:35–41.
7 Dushku N, Hatcher SL, Albert DM, et al. p53
expression and relation to human
papillomavirus infection in pingueculae,
pterygia, and limbal tumors. Arch Ophthalmol
1999;117:1593–9.
Table 2
Characteristics of patients with pterygia and pinguecula
Pterygium Pinguecula
Patients (M/F)
Age (years, mean (SE))
65 (40/25)
63.3 (5.9) (range 55.5–82.3) 58.3 (7.4) (range
23 (15/8)
44.4–71.2)
3 (13.0)
18.1 (7.9) (range
10.0–28.5)
2 (8.7)
Medication for conjunctivitis (%)
Duration of lesion (years, mean (SE))
20 (30.8)
9.8 (3.7) (range 5.5–21.5)
Conjunctivitis history (%)24 (36.9)
Table 3
Literature reports of human papillomavirus detection in pterygia
Authors (year published)
No of
specimens
Pterygium
(type)Method/primer Positive rates
HPV types
(negative)
Dolmetsch et al (1996)16
Dushuku et al (1999)7
Detorakis et al (2000)6
Gallagher et al (2001)1
Chen et al (current study) (2002)
16
13
50
10
65
?
P + R
P + R
?
P
Immunohistochemical stain
My09/My11
GP5/GP6
GP5/GP6
MY09/MY11
L1C1/L1C2-1, GP5/GP6
100%
0
24%
50%
0
16 (6, 11, 18)
–
18
6, 11, 16
–
P = primary; R = recurrent.
PostScript1047
www.bjophthalmol.com
group.bmj.com on July 16, 2011 - Published by bjo.bmj.comDownloaded from