Over-expression of wild-type and mutant HFE in a human melanocytic cell line reveals an intracellular bridge between MHC class I pathway and transferrin iron uptake.

Abstract

Hereditary hemochromatosis (HH) is a frequent recessive disorder of iron metabolism characterised by systemic iron overload. In Northern Europe, more than 90% of HH patients are homozygous for a mis-sense mutation (C282Y) in the HFE1 gene product. The HFE protein is the heavy chain of a MHC class I-related molecule and associates with beta2 microglobulin and the transferrin receptor. Its precise roles in iron metabolism and in the pathophysiology of HH are still unclear. In order to identify the cellular processing of HFE, an important step towards the understanding of the function of the protein, we stably over-expressed the wild type and mutated forms fused to the Green Fluorescent Protein in a melanocytic MHC class I expressing cell line, the Mel Juso cell line. In wild type and mutant clones, the fusion proteins were not detected at the cell surface but only in the cytoplasm. Their sub-cellular localisation was determined by co-labelling of cells with organite-specific antibodies and confocal microscopy. HFE-GFP followed initially HLA class I intracellular processing but co-localised with transferrin in early endosomes without recycling at the cell surface. The C282Y-GFP fusion protein followed a different folding pathway to exit endoplasmic reticulum. Over-expression of the wild-type protein lead to a decrease in diferric transferrin uptake. Our model will be of use in the elucidation of the functional interaction between intracellular HFE and iron transporters transferrin/transferrin receptor complexes and Slc11A2 (also named N-Ramp2 or DMT1) in different endosomal compartments.

Full text

Page 1

Over-expression of wild-type and mutant HFE in a human melanocytic
cell line reveals an intracellular bridge between MHC class I pathway
and transferrin iron uptake
Patricia Fergelota,*, Magali Orhanta,Agnès Théniéa, Pascal Loyerb, Martine Ropert-Boucheta,
Stéphanie Lohyera, Jean-Yves Le Galla, Jean Mossera
aUMR 6061 CNRS “Génétique et développement”, Faculté de Médecine, 2, avenue du Pr Léon-Bernard CS 34317, 35043 Rennes cedex, France
bU 522 INSERM “Régulations des équilibres fonctionnels du foie normal et pathologique” Hôpital Pontchaillou,
CHU de Rennes, rue Henri-Le-Guilloux, 35033 Rennes cedex, France
Received 4 June 2002; accepted 7 May 2003
Abstract
Hereditaryhemochromatosis(HH)isafrequentrecessivedisorderofironmetabolismcharacterisedbysystemicironoverload.InNorthern
Europe, more than 90% of HH patients are homozygous for a mis-sense mutation (C282Y) in the HFE1 gene product.The HFE protein is the
heavy chain of a MHC class I-related molecule and associates with b2 microglobulin and the transferrin receptor. Its precise roles in iron
metabolism and in the pathophysiology of HH are still unclear. In order to identify the cellular processing of HFE, an important step towards
the understanding of the function of the protein, we stably over-expressed the wild type and mutated forms fused to the Green Fluorescent
Protein in a melanocytic MHC class I expressing cell line, the Mel Juso cell line. In wild type and mutant clones, the fusion proteins were not
detected at the cell surface but only in the cytoplasm. Their sub-cellular localisation was determined by co-labelling of cells with
organite-specific antibodies and confocal microscopy. HFE-GFP followed initially HLA class I intracellular processing but co-localised with
transferrin in early endosomes without recycling at the cell surface. The C282Y-GFP fusion protein followed a different folding pathway to
exitendoplasmicreticulum.Over-expressionofthewild-typeproteinleadtoadecreaseindiferrictransferrinuptake.Ourmodelwillbeofuse
in the elucidation of the functional interaction between intracellular HFE and iron transporters transferrin/transferrin receptor complexes and
Slc11A2 (also named N-Ramp2 or DMT1) in different endosomal compartments.
© 2003 Éditions scientifiques et médicales Elsevier SAS.All rights reserved.
Keywords: Hemochromatosis; GFP; Endosomes; Calreticulin
1. Introduction
Iron is essential for fundamental biological processes, but
is potentially toxic when in excess since it promotes cellular
damages. The genetic basis of the most common inherited
diseaseinNorthernEurope,knownashereditaryhaemochro-
matosis (HH), has been recently described following cloning
of new genes involved in iron homeostasis (Roy and An-
drews, 2001). The HFE1 gene, identified on the short arm of
chromosome 6 (6p22) by positional cloning (Feder et al.,
1996),isresponsiblefortype1hereditaryhaemochromatosis
and, in populations of Celtic origin, more than 90% of HH
patients are homozygous for the C282Y mutation (Jouanolle
et al., 1997; UK Haemochromatosis Consortium, 1997). The
main feature of this recessive disorder of iron metabolism is
an increase in intestinal iron uptake leading to progressive
iron overload with skin pigmentation, arthritis, cirrhosis and
hepatic carcinoma, endocrine system dysfunction and heart
failure. The HFE1 gene encodes the heavy chain of a major
histocompatibilitycomplex(MHC)classI-likemoleculethat
associates with b2 microglobulin (b2m).The main mutation,
C282Y, disrupts a disulphide bond in the a3 domain of the
protein involved in the formation of HFE-b2 m dimer (Feder
et al., 1997). b2 m -/- (de Sousa et al., 1994; Rothenberg and
Voland, 1996) and HFE -/- (knockout) mice (Zhou et al.,
Abbreviations: b2m, b2 microglobulin; bp, base pair; ER, endoplasmic
reticulum; GFP, green fuorescent protein; HLA, human leucocyte antigen;
MHC, major histocompatibility complex.
* Corresponding author.
E-mail address: patricia.fergelot@univ-rennes1.fr (P. Fergelot).
Biology of the Cell 95 (2003) 243–255
www.elsevier.com/locate/bicell
© 2003 Éditions scientifiques et médicales Elsevier SAS.All rights reserved.
doi:10.1016/S0248-4900(03)00057-1

Page 2

1998; Levy et al., 1999; Bahram et al., 1999) display exces-
sive iron absorption and develop an iron overload which
mimics HH.
Despite the wide pattern of expression of the transcripts,
the localisation of HFE protein seems to be restricted to only
a few normal tissues. The molecule is mainly detected in the
duodenal crypt cells with a perinuclear distribution (Parkkila
et al., 1997a; Bastin et al., 1998). This localisation is also
found in undifferentiated Caco2 (intestinal adenocarcinoma
derived cell line) and in the erythroleukaemic K562 cell line
(Griffith et al., 2000), whereas a surface expression has been
described in monocytes and macrophages (Bastin et al.,
1998; Parkkila et al., 2000). In transfected cell lines, the fate
oftherecombinantproteinseemstovaryaccordingtothecell
types and the antibodies used against HFE. In most of the
models, the HFE-b2microglobulin dimer is detected at the
cellsurface(Federetal.,1997;Waheedetal.,1997;Bastinet
al., 1998; Corsi et al., 1999; Riedel et al., 1999; Ikuta et al.,
2000; Ramalingam et al., 2000;Waheed et al., 2002). Unlike
the classical MHC class I molecules, HFE does not bind
peptides, as shown by crystallographic studies (Lebròn et al.,
1998), but an association has been described between HFE
and the transferrin receptor (TfR) in human syncytiotropho-
blast(Parkkilaetal.,1997b),intestinalcryptcells(Waheedet
al., 1999) and HFE over-expressing cell lines (Feder et al.,
1998; Gross et al., 1998; Ramalingam et al., 2000). Compel-
ling data demonstrated that HFE down-regulates iron cell
content in vitro, but the molecular mechanism is poorly
understood.
Knowledge of the intracellular distribution and intracellu-
larpathwayofHFEisessentialinordertounderstanditsrole
in the regulation of cellular iron uptake. The conflicting
results obtained in different cellular systems underline the
difficulties of HFE detection and localisation by means of
immunochemistry. Alternatively, the cellular transport of
HFE could be deciphered by the generation of HFE-GFP
fusion protein. The Green Fluorescent Protein (GFP) ap-
proach allows direct detection of the protein, and dynamic
studies that may help to determine the relationship between
HFE, TfR and other proteins involved in iron metabolism. In
order to characterise the intracellular transport of HFE, we
chose the melanocytic Mel Juso cell line and established
stable transfectants over-expressing the wild-type HFE-GFP
fusion protein or the C282Y-GFP mutated form. Extensive
studies have previously described MHC class I and class II
molecules processing in this cell line, and have shown that
GFP-tagged MHC proteins are correctly folded (Wubbolts et
al., 1996, Gromme et al., 1999). Furthermore, in haemochro-
matosis,melanocytesareinvolvedinthepathogenesisofiron
overload. Skin pigmentation is due to iron accumulation
leading to dysfunction of melanogenesis (Witte et al., 1996).
Thus the Mel Juso melanocytic cell line is an appropriate
model to study the potential role of HFE in cellular iron
uptake. In this report, we show that both wild-type and
mutated forms of HFE are found inside melanoma cells, but
interact differently with the chaperone calreticulin and TfR.
2. Results
2.1. HFE expression in the Mel Juso parental cell line
SincetheMelJusocelllinewasnotcharacterisedforHFE
expression, we looked initially for the presence of the main
mutation C282Y in the parental cell line by PCR-restriction.
No C282Y allele was detected. HFE and b2 microglobulin
gene expression were then tested by northern blot, compar-
ingtheirtranscriptpatterninMelJusoandHeLacells.A4kb
HFE mRNA was detected at a low level in both cell lines,
whereas the level of b2 microglobulin expression was higher
in HeLa cells (Fig. 1A). Protein expression was verified by
western blot with a polyclonal antiserum directed against
three peptides located in a2 and a3 domains and in the
C-terminal end of HFE. No band was seen with the pre-
immuneserum(Fig.1C,lane3and4)whereasauniqueband
was detected at 46 x103(Mr) compatible with endogenous
HFE (Fig. 1C, lane 1 and 2). The distribution of endogenous
HFE was assessed in the parental Mel Juso cells, with or
without saponin treatment, by labelling the endogenous HFE
protein with different mixtures of antibodies purified against
peptide 1, 2 or 3. The most sensitive and specific labelling
was obtained with a mixture of antisera purified against
peptide 1 and 2 (data not shown) and with a mixture of the
three purified antisera (Fig. 1B) coupled to a secondary
biotinylated antibody revealed by FITC-coupled avidin. A
weak background appeared after incubation with the pre-
immune serum and this amplification system (Fig 1B,
panel 1).Without saponin treatment, some vesicular struc-
tures were seen inside the cells (Fig. 1B, panel 2) but no
signal appeared at the cell surface, as shown by phase con-
trastimaging(Fig.1B,panels3),indicatingthattheimmuno-
purified antibody could permeate the surface membrane of
Mel Juso cells. In most cells, a stronger signal was detected
in the perinuclear zone after saponin permeabilisation
(Fig. 1B, panels 5, 6). Thus under our immunostaining con-
ditions, HFE was not detectable at the surface of Mel Juso
cells but was found predominantly in perinuclear vesicles.
Identification of this compartment required staining with
specific markers for different organites. In order to simplify
the co-labelling experiments and to compare wild-type to
C282Y processing, we established stable clones expressing
recombinant HFE-GFP or C282Y-GFP.
2.2. Analysis of HFEwt-GFP and C282Y stable
transfectants
Stable clones were established with the green fluorescent
protein fused to the COOH-terminal end of wild type and
C282Y proteins. In the parental Mel Juso cells, the low
expression of b2 microglobulin might lead to inefficient
processing of over-expressed HFE.To prevent potential mis-
folding of recombinant HFE fusion proteins, we co-
transfected wild type HFE and b2m cDNAs, whereas the
C282Y mutant plasmid was either co-transfected with the b2
expression vector or transfected alone. Several fluorescent
244
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255

Page 3

clones were selected from the different transfection condi-
tions. The level of b2 microglobulin expression and the size
of the GFP fusion proteins were verified by western blotting.
We present here the fluorescence data obtained with three
representative clones exhibiting a fluorescence intensity
compatible with sensitive co-labelling experiments and in
Fig. 1. Characterisation of the Mel Juso parental cell line and fusion protein clones. (A): HFE and b2 microglobulin expression in Mel Juso (MJ) and in HeLa
(H) cells by northern blot. Upper panel: ribosomal RNAs visualised with ethidium bromide, lower panel: membrane autoradiography (exposure time 15 days).
(B): Immuno-fluorescence detection of endogenous HFE protein in Mel Juso cells, fixed in paraformaldehyde. Background labelling with pre-immune serum
revealed by biotinylated secondary antibody and avidin FITC without saponin treatment (1). Intracellular staining in Mel Juso cells incubated with a mixture of
three affinity-purified antisera directed against 3 peptides from a2, a3 and C-terminal domains of HFE, without saponin treatment (2, 3) and after saponin
permeabilisation (5, 6). Mel Juso cells limits visualised in phase contrast (4, 3, 6). (C): Specificity of anti HFE antiserum tested by western blot of Mel Juso
parental cell line (lanes 1 and 3) and HFE-GFP + b2 microglobulin clone (lanes 2 and 4).Anti HFE antibody in lanes 1 and 2, pre-immune serum in lanes 3 and
4. (D): Confocal analysis of Mel Juso clones. Projection view of four sections of HFE-GFP + b2 microglobulin clone (1-3), fixed in formaldehyde and
permeabilised with saponin; native HFE-GFP fluorescent signal in (1), staining with a mixture of antibodies purified against peptide 1 and peptide 2 in (2), and
merge in (3).A diffuse cytoplamic pattern co-exists with vesicular pattern (arrow) in type 1 cells. Bottom: respective higher magnifications showing vesicular
structures.Inpanel4:stainingpatternrestrictedtolargevesiclesinatype3cell(arrowsinupperleftcorner,seealsoFigs2Dand4D),andstrongsignalofnative
HFE-GFP with a reticular distribution in type 2 cells (on the right side). Similar strong diffuse pattern in C282Y-GFP + b2microglobulin clone (panel 5) and in
C282Y-GFP clone (panel 6). In Panels 4-6, cells were fixed with paraformaldedyde. Bar 10 µm.
245
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255

Page 4

which HFE-GFP and C282Y-GFP were detected as expected
at 71 x103(Mr) (Fig. 1C, lane 2 and Fig. 5 lanes 4, 5, 6).
AnalysisofthenativeHFE-GFPshoweddifferentfluores-
cent structures. In 30% of fluorescent cells, a diffuse cyto-
plasmic signal was detected together with vesicles in the
perinuclearzone(Fig.1D,panel1),andthesamepatternwas
seen with anti-HFE antibody (Fig. 1D, panels 2 and 3). This
pattern represented type 1 cells. In 50% of cells, the fluores-
cent signal was stronger and restricted to the nuclear envel-
oppeandareticularnetwork(Fig.1D,panel4)suggestingan
endoplasmic reticulum (ER) localisation, and were desig-
nated as type 2 cells. In the remaining 20%, designated as
type 3 cells, the signal was limited to one or two large
vesicles (Fig 1D, panel 4, see arrows). These three patterns
were observed with paraformaldehyde, and with methanol
fixation. Thus, in type 1 cells representing a reproducible
percentage (30%) of the fluorescent population, HFE-GFP
exhibited the same intracellular fluorescence distribution as
the endogenous protein, validating the use of GFP fusion
proteins for co-labelling experiments. In all C282Y-GFP
fluorescent cells, the signal was strong and covered the cyto-
plasm uniformly (Fig. 1D, panel 5 and 6 respectively), irre-
spective of the co-transfection of b2m and regardless of the
extent of over-expression of the C282Y proteins (see also
Fig. 5, lanes 5 and 6). These mutated forms seemed to
accumulate in a tubulo-reticular network. In addition, some
vesicleswereseenintheC282Yclonewithoutb2m(Fig.1D,
panel 6, see arrows). This clone was used for the following
localisation studies.
2.3. Subcellular localisation of HFE
To analyse the processing of HFE-GFP in type 1 cells,
from the endoplasmic reticulum (ER) to the perinuclear
vesicles, we first tested by confocal microscopy the co-
localisation of the native fusion protein with a-tubulin and
classical class I MHC molecules. Alpha–tubulin labelling
revealed the microtubule skeleton of Mel cells and under-
lined the vesicular distribution of HFE-GFP from the peri-
centriolarzonealongaredtubularnetwork(Fig.2A,panel1,
higher magnification a and b). Yellow labelling showed the
co-localisation of HFE-GFP and a-tubulin in a tubulo-
vesicular structure, condensed near the nucleus, which may
correspond to the association of ER membranes and micro-
tubules (Fig. 2A, panel 1, higher magnification b). Classical
class I HLA co-localised partially with the fusion protein in
the perinuclear region (Fig. 2A, panel 2a). Only the classical
class I molecules were expressed at the cytoplasmic mem-
brane, confirming that HFE-GFP was strictly intracellular
(Fig. 2A, panel 2b). The fluorescence distribution of native
HFE-GFP in type 2 cells (Fig. 2B, panel 1) and in the
C282Y-GFP clones (panel 4) were suggestive of an ER
staining pattern. To confirm ER localisation we used calreti-
culin , a luminal ER protein. No signal was seen with the
secondary antibody alone (Fig. 2B, panel 4). Extensive yel-
low staining covering the entire cytoplasm confirmed the
co-localisation of wild-type recombinant protein and calreti-
culin (Fig. 2B, panel 2). In contrast, the overlap of the
mutated protein with calreticulin labelling seemed to be
restricted to a small portion of the nuclear membrane and a
tubulo vesicular compartment (Fig. 2B, panel 3), whereas
distinct red or green vesicles were visible around the nucleus
(see higher magnification). Since over-expression or muta-
tion may lead to retention of misfolded protein in ER, the
HFE-GFP pattern in type 2 cells may correspond to the
accumulation of misfolded forms, whilst in type1 cells, co-
localisation with a-tubulin would indicate a transition to
perinuclear compartments. According to the cell-type, these
perinuclearcompartmentsmaycontainGolgiand/orendoso-
mal vesicles.
In order to identify the GFP-positive vesicles found in
type 1 cells, potentially relevant to HFE function in Mel Juso
cells, we tested the involvement of Golgi membranes. Cells
were treated with brefeldin A (BFA). By preventing GTP
binding to ARF (ADP ribosylation factor), BFA blocks the
budding of coated vesicles, and then vesicular transport
throughandfromtheGolgiapparatus(Peyrocheetal.,1999).
The HFE-GFP + b2m clone was incubated with BFA for 1 to
5 hours and an anti-GFP antibody was used to ensure the
detection of HFE-GFP containing structures in all the clonal
cells(Figure2C,panel1).RedistributionoftheGFP-positive
compartment was observed after 3.5 hours, affecting espe-
cially large vesicles (Fig. 2C, panel 2); after 5 hours, only
small vesicles near the nucleus and a fine reticular network
were still visible, suggesting that the ARF/bCOP complex
may contribute to the generation of these large GFP-positive
vesicles. To verify this hypothesis, we co-labelled HFE-GFP
and b-COP, a well characterised coatamer subunit. A strong
yellow signal was only found in the type 3 cells (Fig. 2D,
panels 1-3) whilst a rare punctuate yellow signal was seen in
type 1 cells (Fig. 2D, panels 4-6). Taken together, these data
indicatethatHFE-GFPisprocessedthroughERandaccumu-
lates in perinuclear vesicles different from Golgi structures,
without reaching the cell surface. The fluorescence patterns
in type 2 and 3 cells would represent retention of putative
misfolded forms in ER and accumulation of HFE-GFP
within the Golgi complex, respectively.
HFE regulates transferrin-mediated iron uptake, and a
physical association has been demonstrated between HFE
and TfR. To test whether such an interaction occurs when
HFE is found in the cytoplasm only, we compared the wild-
type and mutated fusion proteins and TfR distribution by
confocal microscopy. The cell surface visualised by TfR
labelling was once again clearly distinguishable from the
GFP-positive compartment (Fig. 3A, panels 1-4). Stacking
analysisofmergedimagesshowedthatonlytheTfR-positive
organites near the nucleus displayed a yellow to orange
fluorescence, indicating an overlap of HFE and TfR staining
inside the type 1 cells (Fig. 3A panel 2). In HFE-GFP type 3
cells no obvious co-localisation was seen (Fig. 3B, panels 1,
2), and in C282Y-GFP cells (Fig. 3B, panels 3, 4), the yellow
signal was limited to a few disseminated vesicles around the
nucleus (see arrow). In order to investigate the differences
246
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255

Page 5

between HFE-GFP and TfR pathways, recycling endosomes
were first visualised in Mel Juso parental cells with Texas-
Red labelled transferrin. After 10 min, the transferrin had
reached a vesicular compartment near the nucleus (data not
shown). In HFE-GFP type 3 cells, the transferrin accumu-
lated in the recycling compartment without fluorescence
variation (Fig. 3C panels 1, 2), whereas in type 1 cells the
co-localisation of HFE-GFP and Texas-Red labelled trans-
Fig. 2. Transport of GFP fusion proteins in Mel Juso clones. In (A), panel 1: comparison of HFE-GFP and microtubules distribution revealed with an
anti-a-tubulin antibody and methanol fixation. In (1a) co-localisation of microtubules and HFE-GFP positive structures close to the nuclear envelope (see
arrow),(1b)panel2showsintracellularco-localisationofHFE-GFPwithclassicalHLAmoleculesrevealedwithantiHLAmonoclonalantibody(cloneW6/32)
after fixation in methanol. In B: cells were fixed in paraformaldehyde, permeabilised with saponin and labelled with a polyclonal anti calreticulin antibody.
HFE-GFP (FITC filter, panel 1) co-localises with calreticulin in type 2 cells (merge, panel 2) through-out the cytoplasm; overlapping of C282Y-GFP with
calreticulin labelled in red, around the nucleus (merge, panel 3). No signal was seen withTexas Red-conjugated secondary antibody alone (panel 4). Nuclei are
visualised by DAPI staining. In C: Endoplasmic reticulum to Golgi transport of HFE-GFP. HFE-GFP +b2microglobulin clone was treated with brefeldinA and
fixed in methanol.The fusion protein was detected by the monoclonal anti-GFP antibody, revealed with aTRITC-labelled secondary antibody, before treatment
(1), after 3.5 hours (2) and 5 hours (3). D: The perinuclear region was underlined by DAPI staining of the nucleus. Budding of coated vesicles was modified as
soon as 3.5 hours (arrows). HFE-GFP and b-COP distribution in type 3 (1-3) and type 1 cells (4-6). Monoclonal anti b-COP was revealed with Texas
Red-conjugated secondary antibody after paraformaldehyde fixation and permeabilisation withTriton X100.A co-localisation is seen in type 3 cells whereas in
type 1 cells only few yellow vesicles are visible in the perinuclear region (see arrow). Scale bar: 10 µm.
247
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255

Page 6

ferrin was detectable in perinuclear vesicles but only after
45 min (Fig. 3C, panels 3, 4). These data showed that HFE-
GFP trafficking was partly routed to the sorting/recycling
endosomes and that the observed co-localisation was not
restricted to the biosynthetic pathway.
The partial co-localisation of HFE-GFP with TfR and
transferrin raises the possibility that HFE could accumulate
inanothersubsetofendosomes,thelateendosomes.Staining
with an irrelevant monoclonal antibody raised against a xe-
nopus protein confirmed the specificity of the labelling pat-
terns (Fig. 4, J-L). In HFE-GFP type 1 cells, the perinuclear
staining pattern of CD63, a marker of late endosomes and
lysosomes (also known as melanoma associated antigen
ME491 or Lamp-3), was almost identical to that of native
HFE-GFP (Fig. 4, A-C) whilst the large vesicles in type 3
cells were negative (Fig. 4, D-F). Thus the HFE-GFP forms
visualised in b-COP positive vesicles are not processed
through this late endosomal compartment. In addition, in
only 20% of C282Y-GFP positive cells, native GFP fluores-
cence overlapped with CD63 staining in a subset of peri-
nuclear vesicles (Fig. 4, G-I). In order to determine if the
lysosomal compartment contains HFE, cells were incubated
with 5 mM chloroquine for 1h. No modification of the fluo-
rescence was observed, suggesting that the disruption of
lysosomesandrelatedMHCclassIIlysosome-likestructures
didnotaffectHFElocalisation(datanotshown).ThusinMel
Juso cell line, wild-type HFE follows the early steps of the
classical HLA molecules pathway, but it could be driven to
late endosomes and to sorting/recycling TfR positive endo-
somes without recycling at the cell surface.
2.4. Effect of intracellular expression of HFE on diferric
transferrin uptake
In view of the partial co-localisation of the fusion protein
with TfR and transferrin (Tf), we tested the influence of
Fig. 3. Confocal analysis of GFP fusion proteins and transferrin/transferrin receptor distribution. HFE-GFP cells and C282Y-GFP expressing cells were fixed
in formaldehyde, permeabilised with Triton X100. TfR was stained by a monoclonal antibody revealed by a Texas Red-conjugated secondary antibody.
Projection of merged images of HFE-GFP and TfR labelling in type 1 cells (A, 1-4).Yellow staining is detected in deep vesicles in the HFE-GFP clone type 1
cells (panel 2) but neither at, nor beneath the cell surface (panel 1, 4) nor in ER compartment (panel 3). No yellow structure is distinguishable in type 2 cells (B,
1-2).InC282Y-GFPcellstheyellowstainingisscatteredaroundthenucleus(B,3-4).TexasRed-labelleddiferric-transferrin(100nM)wasusedtovisualisethe
recyclingofthetransferrin-transferrinreceptorcomplexesintheHFE-GFP+b2mclone(C).Cellswerefixedinmethanolafterincubationtimeswithtransferrin
of 30 minutes (1, 2) and 45 minutes (3, 4). HFE-GFP staining pattern type 2 is shown in panel 2, without any overlap with endocytosed transferrin. Panel 4:
yellow labelling is seen after 45 minutes indicating accumulation of transferrin in some perinuclear, HFE-GFP positive type 1 vesicles. Bar 10 µm.
248
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255

Page 7

HFE-GFP intracellular over-expression on TfR/Tf recycling
complexes and consequently on transferrin uptake. For this
purpose TfR expression was tested in parental cells and
clones by western blotting. Endogenous HFE was used as an
internal control. The GFP fusion proteins were expressed at
similar levels in HFE-GFP + b2m and C282Y-GFP + b2m
clones and in greater amounts in the C282Y-GFP clone
(Fig.5lanes4-6),containingmorecopiesoftheC282Y-GFP
construct as verified on Southern blot (data not shown). An
additional band was detected at 50 x103(Mr) in C282Y-GFP
and C282Y-GFP + b2m clones that might reflect partially
degraded, free C282Y-GFP heavy chain.TfR expression was
clearly reduced in the HFE-GFP + b2 microglobulin (Fig. 5
lane 4) and to a lesser extent in the C282Y-GFP (lane 5) and
the C282Y + b2m clone (lane 6), compared to the parental
cells(lane1),thetransientlytransfectedcells(lane2)andthe
b2m clone (lane 3). We then analysed the labelling of HFE-
GFP and C282Y-GFP clones after incubation with diferric
Texas-Red-labelled transferrin. Since native GFP fluores-
cence was not uniform, we numbered all the Texas-Red-
labelled cells and quantified fluorescence intensity by flow
cytometryintheclonesandintheparentalMelJusocellline.
Over-expression of the HFE-GFP protein led to a decreased
number ofTexas-Red transferrin positive cells after one hour
(15 +/- 0.4% vs 35.4 +/- 3.9% in parental cell line, P < 0.05)
whereas C282Y-GFP over-expression led to variable counts
with no statistical significance. After overnight incubation
(Fig.6Apanel1),HFE-GFPcellsshowedaslightdecreasein
red fluorescence intensity, compared with the parental cell
line and with the C282Y clone. Fluorescence intensity was
identicalintheC282Y-GFPcloneandintheparentalcells.In
all of the experiments, transferrin co-localised with both
fusion proteins near the nucleus but no yellow vesicles were
detected at or near the cell membrane (Fig. 6B).
Fig. 4. Identification of perinuclear compartment by triple labelling. CD 63, a marker of late endosomes and lysosomes is revealed with Texas Red-conjugated
secondary antibody after methanol fixation. Native HFE-GFP (green) and CD 63 (red) staining patterns are almost identical in HFE-GFP + b2 microglobulin
clone, type 1 cells (A-C) but very different in type 3 cells (D-F). Overlapping of CD 63 staining with C282Y-GFP clone in a subset of perinuclear vesicles (G-I).
No signal appears in antibody controls: Texas-Red-conjugated goat anti-mouse antibody alone in (J), monoclonal antibody against xenopus Eg2 revealed by
Texas Red-conjugated secondary antibody on HFE-GFP cells (K) and on C282Y cells (L). Nuclei are stained with DAPI. Scale bar: 10 µm.
249
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255

Page 8

3. Discussion
HFE is a non-classical MHC class I molecule, whose
function in iron metabolism remains unclear. The localisa-
tion of the protein has not been definitely established, and it
could vary according to cell type. Its expression at the cell
surface is poorly documented in physiological systems
whereas in the published over-expressing models, the locali-
sation of the recombinant protein cannot be compared with
the endogenous one due to the inability to detect HFE in
parental cell lines like COS-7 (Waheed et al., 1997), HEK
293 (Feder et al., 1997, Feeney and Worwood 2001) HeLa
(Feder et al., 1997) and Hutu 80 (Ramalingam et al., 2000).
This absence or very low level of HFE protein expression
may be due to a defect in HLA class I processing or to a
regulatory mechanism that has not yet been elucidated.
In the Mel Juso parental cell line, the localisation of the
proteindifferssignificantlyfrommostpreviousdatasincewe
did not detect it at the cell surface but in the perinuclear
region, resembling the localisation of HFE in the intestinal
crypt cells. Taking into account the potential inability to
detect HFE at the cell surface with our antibodies, this find-
ing must be confirmed by biotinylation of membrane pro-
teins. However, similar to the endogenous HFE, HFE-GFP
was not detected in the cytoplasmic membrane, as shown by
the absence of co-localisation with classical HLA molecules
and TfR at the cell surface. It is unlikely that the GFP tag
modifies the processing of HFE in this cell line. In fact, in
two other cellular models expressing a MHC class I heavy
chain fused also to the N-terminal end of GFP, no major
difference was observed between the pathway of classical
molecules and the transport of fusion proteins (Wubbolts et
al., 1996, Chiu et al., 1999). In addition, the GFP tag did not
prevent the surface expression of HFE-GFP in Hutu 80 cells
(Ramalingam et al., 2000).
SinceHFEdoesnotbindimmunogenicpeptides,thecom-
parison between HFE transport and the processing of HLA
class I molecules is limited to the association with the chap-
erones in the endoplasmic reticulum (ER) and related quality
control compartments. it is a vital step to investigate for a b2
microglobulin associated protein. In the ER, calnexin-bound
class I heavy chains normally acquire the correct conforma-
tiontoassociatewithb2microglobulin.Duringthefollowing
step, the dimer associates with calreticulin (Sadavisan et al.,
1996). We report here that in the subset of HFE-GFP cells
displaying an ER staining pattern, the fusion protein had the
same distribution as calreticulin. Given that this chaperone is
involvedinthequalitycontrolofclassicalclassIMHCheavy
chain synthesis, leading to degradation of misfolded chains
by the proteasome (Kamhi-Nesher et al., 2001), this HFE-
GFPstainingpatternisconsistentwithretentionandprocess-
ing with calreticulin in ER derived quality control compart-
ment. The mutated form, C282Y-GFP, like misfolded
classical class I MHC heavy chain could be driven by calreti-
culintothesamequalitycontrolcompartment.IntheC282Y-
GFPclone,however,thestainingpatternofmutatedHFEand
calreticulin were not identical. Thus C282Y-GFP did not
seem to follow the pathway of misfolded class I heavy
chains. Further investigations are needed to determine the
origin of C282Y-positive compartment and how misfolded
C282Y proteins are delivered to the proteasome. Neverthe-
less the C282Y mutation leads to a partial loss of function of
HFE (Levy et al., 1999), thus the remaining co-localisation
seen between C282Y-GFP and calreticulin may correspond
to a wild-type processing of the mutated protein.
In our model, the co-labelling data are consistent with a
strict anterograde pathway and transport of HFE-GFP in
bCOP positive endosomes to sorting endosomes (Whitney et
al, 1995,Aniento et al, 1996) bridging the biosynthetic path-
way and the recycling TfR positive vesicles. The co-
localisation of HFE-GFP and TfR/Tf complexes, visualised
with endocytose-labelled transferrin and TfR staining, in a
similar perinuclear zone, favours an interaction limited to
endosomes. Thus, the Mel Juso cell line appears adequate to
appreciate the functional relevance of HFE interaction with
TfR in intracellular compartments. In this study, we showed
that TfR expression was clearly reduced in the HFE-GFP
clone and to a lesser extent in the C282Y-GFP expressing
clones. This reduced expression of TfR in HFE over-
expressing cells has already been observed in stably trans-
fected 293 cells (Feeney and Worwood, 2001), but remained
unexplained. In fact, HFE over-expression at the cell surface
usually correlates with decreased ferritin and increased TfR
Fig.5. ExpressionoftransferrinreceptorinGFPfusionproteinclones.Fifty
micrograms of membrane-enriched cell lysates from the parental cell line,
HFE-GFP clone B5, a C282Y-GFP + b2 microglobulin clone, C282Y-GFP
clone G7, a b2 microglobulin clone and from pEGFP-N1 transiently trans-
fected Mel Juso cells were separated on a 10% SDS-acrylamide gel and
blotted onto a PVDF membrane. Using HFE antiserum, endogenous HFE
was revealed at 46 kDa in the parental Mel cells (lane 1), after transient
transfection with pEGFP-N1 (lane2) and in the clones (lanes 3-6) and thus
was considered as an internal control of protein amount. After b-ME treat-
ment, blots were re-probed with anti-TfR monoclonal antibody.TfR expres-
sion is reduced in the HFE-GFP clone (lanes 4).
250
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255

Page 9

Fig. 6. Flow cytometry analysis and epifluorescence imaging of diferric-transferrin uptake.A : incubation of Mel Juso parental cell line and clones with 100nM
TexasRed-labelleddiferric-transferrin.TRITCfluorescenceintensitywasmeasuredon10000cellsafterovernightincubation(1),andashorterperiodof1h(2).
In (3): control without Texas Red-labelled transferrin. Grey line : C282Y clone; black line : HFE-GFP + b2 m clone; dotted line : Mel Juso parental cell line.A
decrease in fluorescence intensity appeared after overnight incubation of the HFE-GFP cells, see arrow in (1); a similar difference was measured in three
independent experiments. B : corresponding cell preparations after different incubation times. A yellow co-labelling of the perinuclear region is seen with
wild-type (Panels 2, 5) and mutant HFE (Panels 3, 6).
251
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255

Page 10

levels(Royetal.,1999,Riedeletal.,1999,Corsietal.,1999,
Ramalingam et al., 2000, Wang et al., 2002), reflecting iron
deficiency. In our model, HFE-GFP over-expression had the
opposite effect, illustrated by reduced expression of TfR.
Thus our data suggest that a strictly intracellular, perinuclear
localisation of HFE would correlate with an elevated iron
content. Furthermore it is consistent with endocytosed fluo-
rescent transferrin data. Considering that 100nM diferric-Tf
is sufficient to saturate the TfR (Roy et al., 1999), the slight
decrease in fluorescence intensity in the HFE-GFP clone
alone would indicate that intracellular over-expression of
HFE-GFP exerts an inhibitory effect on diferric-transferrin
uptake in dividing Mel Juso cells. This effect has been re-
ported in other fast growing cells (Salter-Cid et al., 1999,
Drakesmith et al., 2002).
We describe here for the first time the co-localisation of a
native HFE-GFP with a late endosomal and lysosomal
marker. Together with the chloroquine treatment data, this
result suggest that HFE-GFP processing is limited to late
endosomes. These intriguing results would signify that in
Mel Juso cells, HFE-GFP might regulate iron egress out of a
subset of late endosomal vesicles. In accordance with this
hypothesis, Davies and co-workers demonstrated very re-
cently that expression of a chimeric HFE-Lamp1 protein in
HeLa cells modulates cellular iron content (Davies et al.,
2003).
To reconcile the contradictory data obtained with surface
or intracellular over-expression of HFE in different cell
types, we propose that a decrease in iron concentration could
lead to the recruitment of HFE to an intracellular compart-
ment, like late endosomes, which in turn contributes to an
increase in cytoplasmic iron delivery from an acidified com-
partment, as a compensatory mechanism to maintain iron
homeostasis. Our findings on HFE-GFP distribution and its
restricted co-labelling with TfR in Mel Juso cell line suggest
thatanotherpartnercouldbeinvolvedinHFEfunction.Ithas
been recently demonstrated that IRE (Iron Responsive Ele-
ment) and non IRE isoforms of the transmembrane cation
transporter Slc11A2 (N-Ramp2, DMT1) are located in late
endosomes and recycling endosomes respectively (Tabuchi
et al., 2002).
In conclusion, the intracellular HFE protein initially fol-
lows the HLA class I molecules pathway in our melanocytic
model but the RE/endosomes connection seems specific to
HFE,involvingatubularnetworkinwhichtheroleofcalreti-
culin needs to be further clarified. The C282Y mutation
could decrease the transport of HFE from the ER to the
subset of endosomes where HFE is believed to regulate iron
uptake. Our HFE-GFP model will be useful to gain further
insight into the generation of HFE-transporting structures.
4. Materials and Methods
Cell lines and culture: The human melanoma cell line
Mel Juso was kindly provided by Dr R. Wubbolts (The
Netherlands Cancer Institute,Amsterdam,The Netherlands).
This cell line was grown in Dulbecco’s Modified Eagle
Medium (DMEM) supplemented with 7.5 % FCS and
glutamine 2 mM (LifeTechnologies Gibco BRL) in 5% CO2
at 37 °C. Clones were cultured in Iscove’s medium with
geneticin (500 µg/ml), 100 U/ml penicillin and 100 µg/ml
streptomycin (Life Technologies). HeLa cells (ATCC
CCL-2)weregrowninDMEMsupplementedwith10%FCS
and glutamine 2 mM.
Transfection: Cells (2 × 105) were plated on 100mm
platesandgrownto40%confluency.Transfectionofplasmid
DNA (7 µg) was performed using Tfx 20 (Promega) as
described in manfacturer’s protocol. The following lin-
earised constructs were used for transfection: b2m expres-
sion vector with HFE-GFP or b2m with C282Y-GFP vectors
orC282Y-GFPalone.Stabletransfectantswereselectedwith
geneticin (1 mg/ml) and transfected cells were isolated by
limiting dilutions.
HFE genotyping of the Mel Juso parental cell line.
Cells were trypsinised, rinsed 3 times in PBS (Phosphate
Buffered Saline tablets, Sigma) and re-suspended in lysis
buffer (50 mM Tris-HCl pH 7.5, 5 mM EDTA, 0.5% SDS,
0.1M NaCl).Genomic
phenol/chloroform procedure, precipitated in ethanol and
re-suspended in TE (10 mM Tris-HCl pH 8, 1 mM EDTA).
After amplification, the PCR product was digested by Rsa 1
as previously described (Jouanolle et al., 1997).
Expression vectors: HFE mRNA (179-1209) was ob-
tained by RT-PCR from human placenta polyA+RNA (Clon-
tech)andsubclonedinPGEM-T(Promega).A1kbfragment
(200-1180) corresponding to the coding sequence of HFE
wasamplifiedwith
5’GAAGCGGAGATCTAACGGGGACG3’
BglII restriction site and 5’CGTGGATCCTCACGTTCAG
CTAA3’. In the latter, the stop codon of HFE was abolished
by the introduction of a BamH1 site. This fragment was
subclonedinpEGFP-N1(Clontech)toobtainthepHFE-GFP
expression vector, EGFP being fused in frame to the
C-terminal end of HFE. The missence mutation 845G-A
(C282Y) was introduced in the pHFE-GFP vector by PCR-
mediated site-directed mutagenesis (Cormack et al., 1995).
Briefly, two fragments of 900 bp and 250 bp were amplified
from the pHFE-GFP vector.The 900 bp fragment was ampli-
fiedwith thefollowing
ATATAAGCAG3’ and 5’CACCTGGTACGTATATCTCT3’,
the latter containing the mutation (underlined) and a Nhe1
restriction site. A BamH1 site was introduced in the 250 bp
fragment during amplification with the following primers:
5’CCGGACACGCTGAACTTGTG3’and5’CCGGACACG
CTGAACTTGTG3’.ThePCRproductswerebluntendedby
addition of the Klenow fragment of DNA polymerase I (5U),
for 15 minutes at 30 °C, purified on silicate gel and then
digested with Nhe1 or BamH1 for co-ligation into the appro-
priately cut pHFE-GFP vector. The presence of the mutation
was verified by sequencing. b2 microglobulin cDNA was
amplified from a human cDNA library (Clontech) and in-
serted at the BglII/Not1 sites of pEGFP vector after removal
DNA was extracted by
the following primers:
containinga
primers:5’TGGGAGGTCT
252
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255

Page 11

of the GFP cDNA. Plasmids were purified by cesium chlo-
ride procedure and linearised with ApaL1 before transfec-
tions to establish stable clones.
DNA sequencing: All the constructs were sequenced
using dRhodamine terminator cycle sequencing kit (Perkin
Elmer) and anABI 377 DNA sequencer (ABI).
Northern blot analysis: After total RNA extraction with
RNAplusTM(Q.BIOgene), polyA+RNA was partially puri-
fied on oligodT cellulose (Amersham Pharmacia Biotech)
following manufacturer’s recommendations. Poly A+ (4 µg)
were separated on a 1.2% formaldehyde denaturing gel,
blotted onto a nylon membrane (N+, Amersham Pharmacia
Biotech), UV crosslinked (Stratalinker, Stratagene) and hy-
bridised overnight at 42 °C in 50% formaldehyde buffer with
HFE and b2microglobulin32P-labelled cDNA probes (Re-
diprime kit,Amersham Pharmacia Biotech).After hybridisa-
tion, blots were washed successively in 2x SSC, 0.1% SDS
for 30 min at room temperature, 2x SSC, 0.1% SDS for
30 min at 42 °C and 0.5x SSC, 0.1% SDS at 65 °C. Exposure
of RNA blots was performed at –80° on X-OMAT film
(Eastman Kodak).
Antibody production : Anti-HFE polyclonal antiserum
was generated as followed: three peptides (numbered from
the start codon) corresponding to amino acids 164-177 for
peptide 1 (a2domain of HFE), 246-260 for peptide 2, (a3
domain of HFE), 326-343 for peptide 3 (carboxyl tail of
HFE) (Feder et al., 1997) and coupled to keyhole limpet
haemocyanin were co-injected in rabbits (Syntem, Nîmes,
France). Rabbits were bled on day 88 after three co-
injections and the antiserum was subsequently immuno-
purified against each peptide separately with NHS-activated
sepharose (Amersham Pharmacia Biotech) following manu-
facturer’s instructions.
Western blot analysis: Membrane-enriched cell protein
extracts were performed on Mel Juso parental cell lines and
clones by two rounds of centrifugation. Cells were collected
in PBS and pellets were lysed in 10 mM Tris-HCl pH 7.6,
10 mM NaCl containing protease inhibitors (CompleteTM
tablets, Roche). After centrifugation at 300 g, for 15 min at
4 °C, the supernatants were cleared by centrifugation at 10
000 g for 30 min, at 4 °C. After determination of protein
concentration by the Bradford assay (Biorad), 50 µg of pro-
teins were electrophoresed on a 10% SDS-polyacrylamide
gel and transferred onto PVDF membranes (Biorad). Mem-
branes were blocked in PBS containing 4% skimmed milk
for 2 hours at room temperature and incubated with pre-
immune or anti-HFE immune serum (dilution 1:1000) or
anti-TfR antibody (1:2000) in PBS containing 4% skimmed
milk overnight at 4 °C. Immune complexes were revealed by
peroxidase conjugatedsecondary
1:10000, Amersham Pharmacia Biotech) and a chemilumi-
nescent reagent (ECL) according to the manufacturer’s in-
structions (Amersham Pharmacia Biotech).
Fluorescence imaging: Parental and GFP-transfected
Mel Juso cells were grown on coverslips and various fixation
and permeabilisation conditions were determined, taking ac-
antibody(dilution
count of antibody supplier’s recommendations, to optimise
our co-labelling experiments. Cells were rinsed 3 times in
PBS, fixed for 2 min in methanol and incubated with mono-
clonal a-tubulin (diluted 1:2000) and HLA class I (clone
w6/32, 1:500), purchased from Sigma, anti-GFP (diluted
1:500, Clontech), and anti-CD63 (1:1000, Beckton Dickin-
son). Alternatively, cells were fixed for 10 min in 3.7%
paraformaldehyde and permeabilised with 0.05% saponin
for HFE and calreticulin labelling (polyclonal antibody di-
luted 1:100, Alexis corporation) or with triton X100, 0.1%
for b-COP (clone M3A5 diluted 1:30, Sigma) andTfR label-
ling(monoclonalantibody,1:100,Serotec).Incubationswith
primary antibodies were performed for 30 min at room tem-
perature in PBS containing 1% BSA except with antib–COP
and anti HLA which were performed overnight at 4 °C. The
affinity-purified anti HFE antibodies (1:30) were revealed
withagoatanti-rabbitbiotinylatedantibody(1:1000,Sigma)
coupled to avidin FITC (Vector) or coupled to avidin Texas
Red (Gibco BRL). Monoclonal and polyclonal antibodies
were detected by species-specific TRITC-conjugated anti-
bodies.An irrelevant monoclonal antibody raised against the
xenopus Eg2 protein (kindly provided by Régis Giet) was
used as control. Brefeldin A (Sigma) was used at a concen-
trationof5µg/mltodisrupttheGolgi,chloroquine(sigma)at
5 mM to disrupt the lysosomes, and Texas Red-labelled
transferrin(Molecularprobes)at100nMtolabeltheendocy-
tosed TfR/Tf complexes. The coverslips were mounted on
glass slides in Vectashield (Vector). Epifluorescence was
monitored with a DM RXA Leica microscope coupled to a
Q550 CW image analysis system (Leica) using DAPI, FITC
and/or rhodamine filters. Confocal analysis was performed
on a TCS NT Leica microscope: Argon/krypton laser,
FITC/TRITC method (530/30BF, LP 590, DD488-568),
EGFP: kexcitation: 488 nm, kemission: 507-509 nm.
Analysis of transferrin uptake: Mel Juso parental cells
and transfected clones were grown in DMEM supplemented
with 7.5 % FCS, glutamine 2 mM, and at 70% confluency,
the culture medium was replaced by DMEM without FCS.
Cells were incubated for 1 hour or overnight alternatively,
with 100 nM diferric Texas-Red labelled transferrin. After
5 mM EDTA treatment for 15 min at 37 °C, cells were rinsed
three times in PBS and flow cytometry analysis was per-
formed on 1 × 104cells, on a FACS Calibur (Becton Dickin-
son). Comparisons were made with the Mann-Whitney test.
P < 0.05 was considered to be statistically significant. In
parallel1×105cellswerecentrifugedontoglassslidesfor10
min at 100 g and analysed by epifluorescence imaging.
Acknowledgements
We are grateful to Richard Wubbolts and Jacques Neefjes
for providing the Mel Juso cell line. We thank Roselyne
Primault from the Département Commun de Microscopies
Electronique et Confocale de l’Université de Rennes I for
confocal microscopy analysis, Yannick Arlot-Bonnemains
253
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255

Page 12

and Claude Prigent for helpfull discussion and Phillip Jordan
for his careful reading of the manuscript.
References
Aniento, F., Gu, F., Parton, R.G., Gruenberg, J., 1996.An endosomal bCOP
is involved in the pH-dependent formation of transport vesicles destined
for late endosomes. J. Cell. Biol. 133, 29–41.
Barham, S., Gilfillan, S., Kuhn, L.C., Moret, R., Schulze, J.B., Lebeau, A.,
Schumann, K., 1999. Experimental hemochromatosis due to MHC class
I HFE deficiency: immune status and iron metabolism. Proc. Natl.Acad.
Sci. USA 96, 13312–13317.
Bastin, J.M., Jones, M., O’Callaghan, C.A., Schmanki, L., Mason, D.Y.,
Townsend, A.R.M., 1998. Kupffer cell staining by an HFE-specific
monoclonal antibody: implications for hereditary haemochromatosis.
Br. J. Hematol. 103, 931–941.
Chiu, I., Davis, D.M., Strominger, J.L., 1999. Trafficking of spontaneously
endocytosed MHC proteins. Proc. Natl. Acad. Sci. USA 96,
13944–13949.
Cormack, B., 1995. In:Ausubel, F., Brent, R., Kingston, R.E., Moore, D.D.,
Seidman,J.G.,Smith,J.A.,Struhl,K.(Eds.),ShortProtocolsInMolecu-
lar Biology. John Wiley & sons, Inc unit 8-5.
Corsi,B.,Levi,S.,Cozzi,A.,Corti,A.,Altimare,D.,Albertini,A.,Arosio,P.,
1999. Overexpression of the hereditary hemochromatosis protein, HFE,
in HeLa cells induces an iron-deficient phenotype. FEBS lett. 460,
149–152.
Davies, P.S., Zhang, A.S., Anderson, E.L., Roy, C.N., Lampson, M.A.,
McGraw, T.E., Enns, C.A., 1 Apr 2003. Evidence for the interaction of
the hereditary hemochromatosis protein, HFE with transferrin receptor
in endocytic compartments. Biochem. J. Immediate Publication manu-
script BJ20030202.
de Sousa, M., Reimao, R., Lacerda, R., Hugo, P., Kaufmann, S.H.E.,
Porto, G., 1994. Iron overload in b2-microglobulin-deficient mice.
Immunol. Lett. 39, 105–111.
Drakesmith, H., Sweetland, E., Schimanski, L., Edwards, J., Cowley, D.,
Ashraf, M., Bastin, J., Townsend, A.R.M., 2002. The hemochromatosis
protein HFE inhibits iron export from macrophages. Proc. Natl. Acad.
Sci. USA 99, 15602–15607.
Feder, J. N., Gnirke, A., Thomas, W., Tsuchihashi, Z., Ruddy, D.A.,
Basava, A., Dormishian, F., Domingo Jr, R., Ellis, M.C., Fullan, A.,
Hinton, L.M., Jones, N.L., Kimmel, B.E., Kronmal, G.S., Lauer, P.,
Lee, V.K., Loeb, D.B., Mapa, F.A., McClelland, E., Meyer, N.C.,
Mintier, G.A., Moeller, N., Moore, T., Morikang, E., Wolff, R.K., 1996.
A novel MHC class I-like gene is mutated in patients with hereditary
haemochromatosis. Nat. Genet. 13, 399–408.
Feder,J.N.,Tsuchihashi,Z.,Irrinki,A.,Lee,V.K.,Mapa,F.A.,Morikang,E.,
Prass, C.E., Starnes, S.M., Wolff, R.K., Parkkila, S., Sly, W.S., Schatz-
man, R.C., 1997. The hemochromatosis founder mutation in HLA-H
disrupts b2-microglobulin interaction and cell surface expression. J.
Biol. Chem. 372, 14025–14028.
Feder, J.N., Penny, D.M., Irrinki, A., Lee, V.K., Lebron, J.A., Watson, N.,
Tsuchihashi, Z., Sigal, E., Bjorkman, P.J., Schatzman, R.C., 1998. The
hemochromatosis gene product complexes with the transferrin receptor
and lowers its affinity for ligand binding. Proc. Natl.Acad. Sci. USA 95,
1472–1477.
Feeney, G.P.,Worwood, M., 2001.The effects of wild-type and mutant HFE
expression upon cellular iron uptake in transfected human embryonic
kidney cells. Bioch. Bioph.Acta 1538, 242–251.
Griffiths, W.J.H., Kelly, A.L., Smith, S.J., Cox, T.M., 2000. Localization of
iron transport and regulatory proteins in human cells. Q. J. Med. 93,
575–587.
Gromme, M., Uytdehaag, F.G.C.M., Janssen, H., Calafat, J., van Binnen-
duk, R.S., Kenter, M.J.H., Tulp, A., Verwoerd, D., Neefjees, J., 1999.
Recycling MHC class I molecules and endosomal peptide loading. Proc.
Natl.Acad. Sci. USA 96, 10326–10331.
Gross, C.N., Irrinki, A., Feder, J.N., Enns, C.A., 1998. Co-trafficking of
HFE, a nonclassical major histocompatibility complex class I Protein,
with the transferrin receptor implies a role in intracellular iron regula-
tion. J. Biol. Chem. 273, 22068–22074.
Ikuta, K., Fujimoto, Y., Suzuki, Y., Tanaka, K., Saito, H., Ohhira, M.,
Sasaki, K., Kohgo, Y., 2000. Overexpression of hemochromatosis pro-
tein, HFE, alters transferrin recycling process in human hepatoma cells.
Bioch. Bioph.Acta. 1496, 221–231.
Jouanolle, A.M., Fergelot, P., Gandon, G., Yaouanq, J., Le Gall, J.Y.,
David, V., 1997. A candidate gene for hemochromatosis: frequency of
the C282Y and H63D mutations. Hum. Genet. 100, 544–547.
Kamhi-Nesher, S., Shenkman, M., Tolshinsky, S., Fromm, V., Ehrlich, R.,
Lederkremer, G.Z., 2001. A novel quality control compartment derived
from the endoplasmic reticulum. Mol Biol Cell. 10, 1711–1723.
Lebròn, J.A., Bennett, M.J., Vaughn, D.E., Chirino, A.J., Snow, P.M.,
Mintier, G.A., Feder, J.N., Bjorkman, P.J., 1998. Crystal structure of the
hemochromatosis protein HFE and characterization of its interaction
with transferrin receptor. Cell 93, 111–123.
Levy, J.E., Montross, L.K., Cohen, D.E., Fleming, M.D., Andrews, N.C.,
1999. The C282Y mutation causing hereditary hemochromatosis does
not produce a null allele. Blood 94, 9–11.
Parkkila, S.,Waheed,A., Britton, R.S., Feder, J.N., Tsuchihashi, Z., Schatz-
man, R.C., Bacon, B.R., Sly, W.S., 1997. Immunochemistry of HLA-H,
the protein defective in patients with hereditary hemochromatosis,
reveals unique pattern of expression in gastrointestinal tract. Proc. Natl.
Acad. Sci. USA 94, 2534–2539.
Parkkila, S., Waheed, A., Britton, R.S., Bacon, B.R., Zhou, X.Y.,
Tomatsu, S., Fleming, R.E., Sly,W.S., 1997.Association of the transfer-
rin receptor in human placenta with HFE, the protein defective in
hemochromatosis. Proc. Natl.Acad. Sci. USA 94, 13198–13202.
Parkkila, S., Parkkila, A.K., Waheed, A., Britton, R.S., Zhou, X.Y., Flem-
ing, R.E., Tomatsu, S., Bacon, B.R., Sly, W.S., 2000. Cell surface
expression of HFE protein in epithelial cells, macrophages, and mono-
cytes. Haematologica 85, 340–345.
Peyroche, A., Antonny, B., Robineau, S., Acker, J., Cherfils, J., Jack-
son,C.L.,1999.BrefeldinAactstostabilizeanabortiveARF-GDP-Sec7
domain protein complex: involvement f specific residues of the Sec7
domain. Mol. Cell 3, 275–285.
Ramalingam, T.S., West Jr,A.P., Lebròn, J.A., Nangiana, J.S., Hogan, T.H.,
Enns, C.A., Bjorkman, P.J., 2000. Binding to the transferrin receptor is
required for endocytosis of HFE and regulation of iron homeostasis. Nat
Cell Biol. 2, 953–957.
Riedel, H.D., Muckenthaler, M.U., Gehrke, S.G., Mohr, I., Brennan, K.,
Herrmann, T., Fitscher, B.A., Hentze, M.W., Stremmel, W., 1999. HFE
downregulates iron uptake from transferrin and induces iron-regulatory
protein activity in stably transfected cells. Blood 94, 3915–3921.
Rothenberg, B.E.,Voland, J.R., 1996. b2 knockout mice develop parenchy-
malironoverload:aputativeroleforclassIgenesofthemajorhistocom-
patibility complex in iron metabolism. Proc. Natl. Acad. Sci. USA 93,
1529–1534.
Roy, C.N., Penny, D.M., Feder, J.N., Enns, C.A., 1999. The hereditary
hemochromatosis protein, HFE, specifically regulates transferrin-
mediated iron uptake in HeLa cells. J. Biol. Chem. 274, 9022–9028.
Roy, C.N., Andrews, N.C., 2001. Recent advances in disorders of iron
metabolism: mutations, mechanisms and modifiers. Hum. Mol Genet.
10, 2181–2186.
Tabuchi, M., Tanaka, N., Nishida-Kitayama, J., Ohno, H., Kishi, F., 2002.
Alternative splicing regulates the subcellular localisation of divalent
metal transporter 1 isoforms. Mol. Biol Cell 13, 4371–4387.
Sadavisan, B., Lehner, P.J., Ortmann, B., Spies, T., Cresswell, P., 1996.
Rolesforcalreticulinandanovelglycoprotein,tapasin,intheinteraction
of MHC class I molecules with TAP. Immunity 5, 103–114.
Salter-Cid, L., Brunmark, A., Li, Y., Leturcq, D., Peterson, P.A., Jack-
son, M.R.,Yang,Y., 1999. Transferrin receptor is negatively modulated
by the hemochromatosis protein HFE: implications for cellular iron
homeostasis. Proc. Natl.Acad. Sci. USA 96, 5434–5439.
254
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255

Page 13

The UK Haemochromatosis Consortium, 1997. A simple genetic test iden-
tifies 90% of the UK patients with haemochromatosis. Gut 41, 841–844.
Waheed, A., Parkkila, S., Zhou, X.Y., Tomatsu, S., Tsuchihashi, Z.,
Feder, J.N., Schatzman, R.C., Britton, R.S., Bacon, B.R., Sly, W.S.,
1997. Hereditary hemochromatosis: effects of C282Y and H63D muta-
tionsonassociationwithb2-microglobulin,intracellularprocessing,and
cell surface expression of the HFE protein in COS-7 cells. Proc. Natl.
Acad. Sci. USA 94, 12384–12389.
Waheed, A., Parkkila, S., Saarnio, J., Fleming, R.E., Zhou, X.Y.,
Tomatsu, S., Britton, R.S., Bacon, B.R., Sly, W.S., 1999.Association of
HFE protein with transferrin receptor in crypt enterocytes of human
duodenum. Proc. Natl.Acad. Sci. USA 96, 1579–1584.
Waheed, A., Grubb, J.H., Zhou, X.Y., Tomatsu, S., Fleming, R.E., Cos-
taldi, M.E., Britton, R.S., Bacon, B.R., Sly, W.S., 2002. Regulation of
transferrin-mediatedironuptakebyHFE,theproteindefectiveinheredi-
tary hemochromatosis. Proc. Natl.Acad. Sci. USA 99, 3117–3122.
Wang, J., Chen, G., Pantopoulos, K., 4 dec 2002. The hemochromatosis
protein HFE induces an apparent iron-deficient phenotype in H1299
cells that is not corrected by co-expression of b2 microglobulin. Bio-
chem. J. Immediate Publication as manuscript BJ20021607.
Whitney, J.A., Gomez, M., Sheff, D., Kreis, T.E., Mellman, I., 1995. Cyto-
plasmic coat proteins involved in endosome function. Cell 83, 703–713.
Witte, D.L., Crosby, W.H., Edwards, C.Q., Fairbanks, V.F., Mitros, F.A.,
1996.PracticeguidelinedevelopmenttaskforceoftheCollegeofAmeri-
can pathologists. Hereditary hemochromatosis. Clin. Chim. Acta 245,
139–200.
Wubbolts, R., Fernandez-Borja, M., Oomen, L., Verwoerd, D., Janssen, H.,
Calafat, J.M.J.H., Tulp, A., Dusseljee, S., Neefjees, J., 1996. Direct
vesiculartransportofMHCclassIImoleculesfromlysosomalstructures
to the cell surface. J. Cell. Biol. 135, 611–622.
Zhou, X.Y., Tomatsu, S., Fleming, R.E., Parkkila, S., Waheed, A., Jiang, J.,
Fei, Y., Brunt, E.M., Ruddy, D.A., Prass, C.E., Schatzman, R.C.,
ONeill, R., Britton, R.S., Bacon, B.R., Sly,W.S., 1998. Hfe gene knock-
out produces mouse model of hereditary hemochromatosis. Proc. Natl.
Acad. Sci. USA 95, 2492–2497.
255
P. Fergelot et al. / Biology of the Cell 95 (2003) 243–255