Tatyana Abramova

Institute of Chemical Biology and Fundamental Medicine · Laboratary of organic synthesis

Inhibitors of human poly(ADP-ribose) polymerase (PARP) are considered as promising agents for treatment of cardiovascular, neurological, and other diseases accompanied by inflammation and oxidative stress. Previously, the ability of natural compounds 7-methylguanine (7mGua) and 8-hydroxy-7-methylguanine (8h7mGua) to suppress activity of the recombi...

Citation: Raskolupova, V.I.; Wang, M.; Dymova, M.A.; Petrov, G.O.; Shchudlo, I.M.; Taskaev, S.Y.; Abramova, T.V.; Godovikova, T.S.; Silnikov, V.N.; Popova, T.V. Design of the New Closo-Dodecarborate-Abstract: Combination therapy is becoming an increasingly important treatment strategy because multi-drugs can maximize therapeutic effect and overcome...

Previously, we have found that a nucleic acid metabolite, 7-methylguanine (7mGua), produced in the body can have an inhibitory effect on the poly(ADP-ribose) polymerase 1 (PARP1) enzyme, an important pharmacological target in anticancer therapy. In this work, using an original method of analysis of PARP1 activity based on monitoring fluorescence an...

BODIPY dyes are photostable neutral derivatives of 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene. These are widely used as chemosensors, laser materials, and molecular probes. At the same time, BODIPY dyes have small or moderate Stokes shifts like most other fluorophores. Large Stokes shifts are preferred for fluorophores because of higher sensitivity...

As the most abundant protein with a variety of physiological functions, human serum albumin (HSA) has been used extensively for the delivery and improvement of therapeutic molecules. Thiolactone chemistry provides a powerful tool to prepare albumin-based multimodal imaging probes and agents for boron neutron capture therapy (BNCT). For this purpose...

We report on the design, synthesis and molecular modeling study of conjugates of adenosine diphosphate (ADP) and morpholino nucleosides as potential selective inhibitors of poly(ADP-ribose)polymerases-1, 2 and 3. Sixteen dinucleoside pyrophosphates containing natural heterocyclic bases as well as 5-haloganeted pyrimidines, and mimicking a main subs...

Methylenecarboxamide (glycine) morpholine oligomers (gMOs) with modified backbone are new and promising nucleic acid analogs. In this work, a combination of circular dichroism spectroscopy, optical melting, and molecular dynamics (MD) simulations were used to investigate hybridization properties of gMOs, as well as the structure and dynamics of the...

Three novel uracil-based morpholine nucleosides containing three different orthogonally reactive functional groups, namely, amino, carboxy and acetylene ones, were synthesized. The obtained monomers are intended for the synthesis of labeled nucleotide, nucleic acid or peptide mimics.

We have studied the excision efficiency of human apurinic/apyrimidinic endonuclease 1 (APE1) and tyrosyl-DNA phosphodiesterase 1 (TDP1) on matched or mismatched bases located at the 3' end of DNA primers. We have used model DNA duplexes, which mimic DNA structures that occur during either replication (DNA with a 3' recessed end) or repair (DNA with...

The development of new derivatives and analogues of nucleic acids for the purposes of molecular biology, biotechnology, gene diagnostics, and medicine has been a hotspot for the last two decades. Methylenecarboxamide (glycine) morpholine oligomer analogues (gM) seem to be promising therapeutic candidates because of the ability to form sequence spec...

A versatile strategy for the synthesis of \(\hbox {NAD}^{+}\) mimetics was developed, involving an efficient pyrophosphate linkage formation in key conjugates containing a functional amino group which acts as useful reactive anchor for further derivatization. These \(\hbox {NAD}^{+}\) mimetics consist of ADP conjugated through a diphosphate chain t...

A convenient approach has been proposed to the synthesis of nicotinamide adenine dinucleotide (NAD⁺) mimetics, which comprise morpholino analogues of nucleosides. The approach is based on the use of ADP conjugates containing an amino group, which is tethered to the terminal phosphate through the aliphatic linker by the phosphodiester bond. We have...

Morpholino nucleoside triphosphates (A, U, G, C, T) bearing the active functional amino group tethered to morpholine residue and their fluorescently labeled derivatives were synthesized. All compounds were characterized by 1H, 13C, and 31P NMR, and mass spectrometry. A possibility of using fluorescently labeled morpholino nucleoside triphosphates a...

Human apurinic/apyrimidinic endonuclease APE1 is one of the key enzymes of the base excision DNA repair system. The main biological function of APE1 is the hydrolysis of the phosphodiester bond on the 5'-side of an apurinic/apyrimidinic site (AP-site) to give the 5'-phosphate and 3'-hydroxyl group. It has long been known that AP-sites have mutageni...

The fundamental role of nucleoside triphosphates and nucleotide cofactors such as NAD+ in biochemistry is well known. In recent decades, more and more research has revealed the key role of 5'-capped RNA and 5',5'-dinucleoside polyphosphates in the regulation of vitally important physiological processes. Last but not least, the commercial potential...

The photo-oxidation of purine nucleotides adenosine-5'-monophosphate (AMP) and guanosine-5'-monophosphate (GMP) by 3,3',4,4'-benzophenone tetracarboxylic acid (TCBP) has been investigated in aqueous solutions using nanosecond laser flash photolysis (LFP) and time-resolved chemically induced dynamic nuclear polarization (CIDNP). The pH dependences o...

An efficient solid-phase-supported peptide synthesis (SPPS) of morpholinoglycine oligonucleotide (MorGly) mimics has been developed. The proposed strategy includes a novel specially designed labile linker group containing the oxalyl residue and the 2-aminomethylmorpholino nucleoside analogues as first subunits.

Conjugates of 2'-deoxyguanosine, L-tryptophan and benzophenone designed to study pathways of fast radical reactions by the photo Chemically Induced Dynamic Nuclear Polarization (photo-CIDNP) method were obtained by the phosphotriester block liquid phase synthesis. The phosphotriester approach to the oligonucleotide synthesis was shown to be a versa...

The advantages and disadvantages of existing approaches to the synthesis of oligodeoxyribonucleotides (ODN) are discussed focusing on large-scale methods. The liquid phase and solid supported synthesis and the synthesis on soluble polymers are discussed. Different problems concerning the methods and implementation of the ODN synthesis are outlined...

Uracyl and adenine containing oligocarboxamide mimetics of nucleic acids based on morpholine nucleosides (MorGly) are synthesized using peptide chemistry methods. Conditions for an analysis of homogeneity of protonated at physiological pH oligomers using a capillary electrophoresis are proposed. Studies of thermostability of complementary complexes...

Uracyl and adenine containing oligomers derived from carboxymethyl derivatives of morpholine nucleoside analogues (MorGly) were synthesized using the methods of peptide chemistry. Capillary electro� phoresis conditions were found for the analysis of the homogeneity of the nucleic acid mimics protonated at physiological pH. The thermal stability of...

An approach to the synthesis of a fluorescent labeled dideoxyuridine triphosphate deriva� tive using the pentafluorophenyl ester of a dicarbocyanine dye was suggested. The use of the dye pentafluorophenyl ester instead of N�oxysuccinimidyl one has the advantage of giving signifi� cantly higher yield of the fluorescent labeled dideoxyuridine�5´�trip...

A simple and effective method for the synthesis of 2'-aminomethylmorpholino-4'-carboxymethyl nucleoside analogues and Boc-modified derivatives as synthons for peptide synthesis was developed.

A simple and efficient method has been developed for the preparation of 2'�aminomethylmor� pholino�4'�carboxymethyl nucleoside analogues and their 2'�N�Boc�modified derivatives as synthons for obtaining oligomers by peptide synthesis methods.

Advances in the synthesis of oligo(deoxy)ribonucleotide analogues and nucleic acid mimetics made in the last decade are summarized. Attention is focused on new methods for the synthesis of derivatives with a modified ribose–phosphate backbone (phosphorothioate, boranophosphate, and nucleoside phosphonate derivatives) and derivatives devoid of the p...

ChemInform is a weekly Abstracting Service, delivering concise information at a glance that was extracted from about 100 leading journals. To access a ChemInform Abstract of an article which was published elsewhere, please select a “Full Text” option. The original article is trackable via the “References” option.

Even several decades after pioneer publications there is continued interest in the construction and synthesis of a variety of novel oligonucleotide analogues. The first oligonucleotide analogues which had a regular, predetermined structure containing nucleoside units joined with carbonate, carbamate, hydroxyacetate and hydroxyacetamide tethers have...

Even several decades after pioneer publications there is continued interest in the construction and synthesis of a variety of novel oligonucleotide analogues. The first oligonucleotide analogues which had a regular, predetermined structure containing nucleoside units joined with carbonate, carbamate, hydroxyacetate and hydroxyacetamide tethers have...

We propose the new approach to the synthesis of 5'-triphosphate derivatives of natural and modified dinucleotides with expanded functionality. Our strategy includes the combination of the solution phase synthesis of necessary dimers using the wide range of nucleic acids chemistry methods and the subsequent introduction of the triphosphate residue....

A new linker bearing two orthogonal precursor groups - an amino group for the reaction with electrophilic agents, and also a terminal triple bond for the reaction with an aliphatic azido group (1,3-dipolar cycloaddition reaction) for the introduction of the different residues into nucleosides is designed and synthesized. 5′-Triphosphates of various...

We report on the successful synthetic procedure for the conversion of 5'-monophosphorylated 2'-deoxydinucleotides into their 5'-triphosphate derivatives in satisfactory to excellent yields. The activation of the terminal phosphate group was achieved under the Mukaiyama conditions in the presence of a nucleophilic catalyst. The reaction conditions (...

We report on the design, synthesis and some of the properties of the new oligonucleotide analogues based on morpholine nucleoside (MorB) subunits joined by an oxalyl diamide tether instead of a phosphate group. The synthetic strategy and oligomer design are optimized to easily obtain target substances without using protective groups. The dimers HOM...

We report a rational approach to the construction of cross-reactive arrays for steroids consisting of five to seven sensors incorporating modified oligonucleotides. The sensors for our arrays were selected to maximize their differential responses to the two steroids most different in an arbitrarily chosen parameter named "shape-length". The arrays...

Oligonucleotide conjugates containing fluorescein residues in the sugar-phosphate back-bone were synthesized by the standard solid-phase phosphoramidite method using phosphor-amidites of 9-[2-deoxy-5-O-(4,4′-dimethoxytrityl)-2-methoxalylamino-β-D-ribofuranosyl]-and 9-[2-deoxy-5-O-(4,4′-dimethoxytrityl)-2-methoxalylamino-β-D-arabinofuranosyl]-N 6-be...

New compounds having tri- or pentamethylenamine linker functions were synthesized. These derivatives were covalently attached through the 5'-phosphoramide linkage to heptanucleotide pd(CCAAACA). Complementary complexes of the octanucleotide pd(TGTTTGGC) and above oligonucleotide conjugates were tested for their thermodynamic response. The T(m) data...

We detail the design, synthesis, and characterization of an o-nitrobenzyl-based photolabile linker containing amine and carboxyl anchor groups. A model nucleoside monomer modified with an imidazole residue and a precursor unit linked to a heterocyclic base through a photolabile tether is constructed Upon UV irradiation (313- 365 nm), the imidazole...

Substrate properties of various morpholinonucleoside triphosphates in the reaction of DNA elongation catalyzed by DNA polymerase beta, reverse transcriptase of human immunodeficiency virus (HIV-1 RT), and reverse transcriptase of Moloney murine leukemia virus (M-MuLV RT) were compared. Morpholinonucleoside triphosphates were utilized by DNA polymer...

Substrate properties of various morpholinonucleoside triphosphates in the reaction of DNA elongation catalyzed by DNA polymerase β, reverse transcriptase of human immunodeficiency virus (HIV-1 RT), and reverse transcriptase of Moloney murine leukemia virus (M-MuLV RT) were compared. Morpholinonucleoside triphosphates were utilized by DNA polymerase...

Substrate properties of various morpholinonucleoside triphosphates in the reaction of DNA elongation catalyzed by DNA polymerase β, reverse transcriptase of human immunodeficiency virus (HIV-1 RT), and reverse transcriptase of Moloney murine leukemia virus (M-MuLV RT) were compared. Morpholinonucleoside triphosphates were utilized by DNA polymerase...

A novel series of phosphoroamidites for the synthesis of 2-modified oligonucleotides was designed and synthesized on the base of 2'-amino uridine and 2'-amino arabinoadenosine. The amino groups in these compounds were acidified by bis-cyanomethyl esters of different dicarbonic acids. Generated reactive linker groups containing cyanomethoxycarbonyl...

Triphosphates of all four ribonucleoside derived morpholine subunits were synthesized and characterized by H-1 and P-31 NMR, UV and mass spectroscopy.

A number of monomers for the standard phosphoamidite oligodeoxynucleotide synthesis that carry reactive methoxyoxalamide groups attached to the thymidine, 2'-deoxycytidine, and 2'-deoxyadenosine heterocyclic bases were prepared. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2004, vol. 30, no. 3; see also http://www.maik...

A convenient preparative synthesis of 2'-amino-2'-deoxyuridine was developed. Starting from 2'-amino-2'-deoxyuridine and 2'-amino-2'-deoxycytidine, monomers for the phosphoamidite oligonucleotide synthesis were obtained that carry a linker with methoxyoxalamide groups in position 2'. The English version of the paper: Russian Journal of Bioorganic C...

Methyl phosphonate oligonucleotides have been used as antisense and antigene agents. Substitution of a methyl group for oxygen in the phosphate ester backbone introduces a new chiral center. Significant differences in physical properties and hybridization abilities are observed between the R(p) and S(p) diastereomers. Chirally pure methylphosphonat...

The synthesis of new metallophthalocyanine-oligonucleotide conjugates is reported. These conjugates can cause sequence-specific photosensitized or catalytic oxidation of DNA by molecular oxygen.

Two-dimensional H-1 NMR (NOESY, COSY) spectroscopy was used to study the spatial structure of a DNA complex CGTTTATTp-Net:AATAAACG with a netropsin analog bound at the terminal 3'-phosphate group in aqueous solution. The positions of the proton NMR signals of the duplex are compared with those for the unmodified duplex and the free ligand. A mean c...

Derivatives of histidine, imidazolylacetic and urocanic acids, containing an N-lm-2,4-dinitrophenyl moiety and a hydroxy group were synthesized and characterized. The applicability of these reagents for anchoring imidazole residues to oligonucleotides to give potential site-specific artificial ribonucleases was shown taking the synthesis of dinucle...

Dinucleoside phosphates that harbor phosphate groups transiently blocked (caged) by o-nitrobenzyl or o-nitroveratryl residues were synthesized. It was shown that the conditions of the UV-induced deprotection largely depend on the nature of the protective group. The phosphotriesters obtained were resistant toward snake venom phosphodiesterase and nu...

The cobalt(II) tetracarboxyphthalocyanine-deoxyribonucleotide pd(TCTTCCCA) conjugate was synthesized. The phthalocyanine N-succinimide ester prepared from phthalocyanine using DCC was mixed in DMF with an aqueous solution of the oligonucleotide bearing a 1,3-diaminopropane linker at the 5'-phosphate. The resulting conjugate was tested in the intrad...

Derivatives of histidine, imidazolylacetic and urocanic acids, containing anN Im-2,4-dinitrophenyl moiety and a hydroxy group were synthesized and characterized. The applicability of these reagents for anchoring imidazole residues to oligonucleotides to give potential site-specific artificial ribonucleases was shown taking the synthesis of dinucleo...

The cobalt(II) tetracarboxyphthalocyanine–deoxyribonucleotide pd(TCTTCCCA) conjugate was synthesized. The phthalocyanine N-succinimide ester prepared from phthalocyanine using DCC was mixed in DMF with an aqueous solution of the oligonucleotide bearing a 1,3-diaminopropane linker at the 5'-phosphate. The resulting conjugate was tested in the intrad...

The derivatives of oligonucleotides with carboxysubstituted porphyrins and phthalocyanins, Fe(III)hematoporphyrin, Pd(II)coproporphyrin I and Co(II)tetracarboxyphthalocyanin, were synthesized using the common approach.

The introduction of various groups into oligonucle-otides is usually performed through linkers attached to the 3'-or 5'-terminus of oligonucleotides, internucle-otide phosphate groups, or heterocyclic bases in the process of the oligonucleotide synthesis or postsynthet-ically [1]. 2 The reversible addition of ligands to oligo-nucleotides opens new...

Oligonucleotide derivatives conjugated to a chemical construction with two histamine residues imitating the catalytic center of ribonuclease A have been synthesized. In experiments with the conjugates complementary to the 3'-end and to the variable loop and the T loop of yeast tRNA(Phe), it was shown that the compounds can accomplish sequence-speci...

Inhibition of the influenza virus protein NP mRNA with derivatives of an antisense oligonucleotide complementary to the 5' terminus of the mRNA was investigated. The derivatives were prepared by conjugation of aromatic 2-chloroethylamine, cholesterol, porphyrin, and phenazine groups to the 5'-terminal phosphate of the oligonucleotide. The most effi...

Oligodeoxyribonucleotides of different lengths have been prepared and linked to new stabilizing agents related to the coumarin family. These ODNSAs (OligoDeoxyriboNucleotides with Stabilizing Agents) were tested against acridine connected oligomers of the same sequence. Melting temperature experiments demonstrated that all ODNSAs formed complexes o...

Antisense oligodeoxynucleotides (ODNs) and their derivatives are highly interesting tools to regulate gene expression and promising drugs for antiviral and anticancer therapy. In view of performing more extensive pharmacological trials requiring relatively great amounts of ODNs, we used a method of ODN synthesis derived from the phosphotriester app...

In order to obtain new building blocks for oligonucleotide (ODN) solution synthesis we are describing the synthesis of the protected dinucleotide 3a carrying 5-fluorouracil and thymine as an example of future development in this field. The synthesis starts assembling a completely protected monomer 1 containing the 5-fluorouracil nucleobase from whi...

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC...

Covalent adduct--the product of intracomplex alkylation at N-3-position of dC-8-nucleoside residue of target octanucleotide pd[TGTTTGGC] was completely synthesized by means of 4-[N-methyl-N-(2-chloroethyl)amino]benzyl-5'-phosphamido derivative of heptanucleotide pd[CCAAACA]. Its melting temperature was shown to be 70 degrees C. Tm did not depend on...

Reaction of 4-(N-2-chloroethyl-N-methylamino)benzylphosphamides of oligonucleotides (RCl-(pT)16 and RCl-(pApC)6) with human chromatin in intact nuclei and with metaphase chromosomes has been investigated. The oligonucleotides were targeted to poly(A) and poly(TG)-repeating DNA sequences. It was found that the reagents alkylate DNA and some proteins...

Covalent adduct-the product of intracomplex alkylation at N-3-position of dC-8 nucleoside residue of target octanucleotide pd[TGTTTGGC] was completely synthesized by means of 4-[N-methyl-N-(2-chloroethyl)amino] benzyl-5'-phosphamido derivative of heptanucleotide pd[CCAAACA]. Its melting temperature was shown to be 70-degrees-C. T(m) did not depend...

The effect of modification of terminal groups of deoxyribooligonucleotides on their stability in cell culture and inside mammalian cells, namely Krebs 2, ascite carcinoma (KAC) and mouse fibroblasts L929, has been investigated. Oligonucleotides and their derivatives were found to be stable in culture medium without serum during 24 h. In the medium...

Experiments with the HIV-1 infected MT-4 cells evidence that coupling of lipophilic and alkylating groups to the antisense oligonucleotides improve their anti-HIV efficiency.

Coupling of lipophilic groups to the termini of oligonucleotides facilitates their binding to mammalian cells and protects them against nucleases attack.

Oligonucleotide derivatives bearing hemin and deuterohemin groups were synthesized. The derivatives efficiently react with the complementary nucleotide sequence in ssDNA forming covalent adducts and piperidine-labile sites. In the case of the deuterohemin derivative, some direct cleavage of the target DNA occurs.

Modification of the human placenta DNA polymerase alpha by 2',3'-epoxyadenosine 5'-triphosphate (eATP) was investigated. The latter binds to the protein both in absence and in presence of template-primer complex. However for inactivation of the enzyme, reagent-complementary template, primer and Me2(+)-ions are required. The inactivation is apparent...

By means of H1 and P31 spin-lattice relaxation and atom-atomic potentials method it is shown that in aquous solution the ATP gamma-p-azidoanilide--Mn2+ complex occurs mainly as a mixture of two conformers in the ratio of 60:40. They both possess folded conformations with distances between aromatic rings 5-6 A, and adenine residue anti-oriented, the...

It is shown that in slightly acidic solution (pH approximately 5.3) reagent CIRCH2NHpT(CT)6 (RCl = -C6H4-N(CH3)CH2CH2Cl) modifies a double-stranded DNA fragment (120 b. p.) containing A(GA)6.T(CT)6 sequence at a single nucleotide residue, viz. G29 located near to this sequence in the DNA chain. The location of this modification point suggests forma...

The alkylation of the cell biopolymers (RNA, DNA, proteins) by reagents Tp'(Et)Tp'(Et)Tp'(Et)TpU(CHRCl) (1) Tp'(Et)Tp''(Et)Tp'(Et)TpU(CHRCl) (2) Tp''(Et)Tp'(Et)Tp''(Et)TpU(CHRCl) (3) Tp''(Et)Tp''(Et)Tp''(Et)TpU(CHRCl) (4) Tp(Et)Tp(Et)Tp(Et)TpU(CHRCl) (5) Tp(Et)Tp(Et)Tp(Et)Tp(Et)U(CHRCl) (6) TpTpTpTpU(CHRCl) (7) where (CHRCl) is the residue of 2',3'...

The alkylating derivatives of four individual diastereomers of the oligonucleotide [dTp(Et)]3dTpU and two individual diastereomers of oligonucleotide [dTp(Et)dTp]4 have been synthesized. The reagents with the phosphorus atoms in the enantiomeric p" configuration are shown to be more efficient in reacting with poly(dA) and with nucleic acids in Kreb...

Alkylating derivatives of the type of Tp(Et)Tp(Et)Tp(Et)TpU(CHRCl), where CHRCl represents a 2',3'-0-)4-(n-(2-chloroethyl)-N-methylamino)benzylidene) residue, have been synthesized from four individual diastereomers of triethyl esters of tetrathymidylyluridine (Tp(Et))âTpU: (CHRCl) (I), Tp'(Et)Tp''(Et)Tp'(Et) x TpU (CHRCl) (II), Tp''(Et)Tp'(Et)Tp''...